Short-Term Zinc Supplementation Stimulates Visceral Adipose Catabolism and Inflammation in Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Study
2.2. Analysis of Serum Zinc Content
2.3. Analysis of the Metabolite Profiles and Hormone Concentration in Serum
2.4. Histology Staining
2.5. RNA Extraction and Real-Time PCR (qRT-PCR)
2.6. Western Blot Analysis
2.7. Statistical Analysis
3. Results
3.1. Short-Term Zinc Supplementation Decreased Fat Deposition in Mice
3.2. Short-Term Zinc Supplementation Induced Hyperglycemia and Hyperinsulinism in Mice
3.3. Short-Term Zinc Supplementation Reduced Serum NEFA Concentration
3.4. Short-Term Zinc Supplementation Impaired Lipogenesis in the Epididymal Adipose Tissue
3.5. Short-Term Zinc Supplementation Promoted the Expressions of Lipolytic Genes and Proteins in the Epididymal Adipose Tissue
3.6. Short-Term Zinc Supplementation Increased the Expressions of Inflammatory Genes in Adipose Tissue
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Stevens, G.A.; Beal, T.; Mbuya, M.N.N.; Luo, H.; Neufeld, L.M.; Global Micronutrient Deficiencies Research, G. Micronutrient deficiencies among preschool-aged children and women of reproductive age worldwide: A pooled analysis of individual-level data from population-representative surveys. Lancet Glob. Health 2022, 10, e1590–e1599. [Google Scholar] [CrossRef] [PubMed]
- Black, R.E.; Victora, C.G.; Walker, S.P.; Bhutta, Z.A.; Christian, P.; de Onis, M.; Ezzati, M.; Grantham-McGregor, S.; Katz, J.; Martorell, R.; et al. Maternal and child undernutrition and overweight in low-income and middle-income countries. Lancet 2013, 382, 427–451. [Google Scholar] [CrossRef] [PubMed]
- Wells, J.C.; Sawaya, A.L.; Wibaek, R.; Mwangome, M.; Poullas, M.S.; Yajnik, C.S.; Demaio, A. The double burden of malnutrition: Aetiological pathways and consequences for health. Lancet 2020, 395, 75–88. [Google Scholar] [CrossRef]
- Foster, M.; Chu, A.; Petocz, P.; Samman, S. Effect of vegetarian diets on zinc status: A systematic review and meta-analysis of studies in humans. J. Sci. Food Agric. 2013, 93, 2362–2371. [Google Scholar] [CrossRef]
- Bhutta, Z.A.; Das, J.K.; Rizvi, A.; Gaffey, M.F.; Walker, N.; Horton, S.; Webb, P.; Lartey, A.; Black, R.E.; The Lancet Nutrition Interventions Review Group; et al. Evidence-based interventions for improvement of maternal and child nutrition: What can be done and at what cost? Lancet 2013, 382, 452–477. [Google Scholar] [CrossRef] [PubMed]
- Tam, E.; Keats, E.C.; Rind, F.; Das, J.K.; Bhutta, A.Z.A. Micronutrient supplementation and fortification interventions on health and development outcomes among children under-five in low- and middle-income countries: A systematic review and meta-analysis. Nutrients 2020, 12, 289. [Google Scholar] [CrossRef]
- Prasad, A.S. Discovery of human zinc deficiency: Its impact on human health and disease. Adv. Nutr. 2013, 4, 176–190. [Google Scholar] [CrossRef]
- Wang, X.; Wu, W.; Zheng, W.; Fang, X.; Chen, L.; Rink, L.; Min, J.; Wang, F. Zinc supplementation improves glycemic control for diabetes prevention and management: A systematic review and meta-analysis of randomized controlled trials. Am. J. Clin. Nutr. 2019, 110, 76–90. [Google Scholar] [CrossRef]
- Rondanelli, M.; Miccono, A.; Lamburghini, S.; Avanzato, I.; Riva, A.; Allegrini, P.; Faliva, M.A.; Peroni, G.; Nichetti, M.; Perna, S. Self-Care for Common Colds: The Pivotal Role of Vitamin D, Vitamin C, Zinc, and Echinacea in Three Main Immune Interactive Clusters (Physical Barriers, Innate and Adaptive Immunity) Involved during an Episode of Common Colds-Practical Advice on Dosages and on the Time to Take These Nutrients/Botanicals in order to Prevent or Treat Common Colds. Evid.-Based Complement. Altern. Med. 2018, 2018, 5813095. [Google Scholar]
- Rech, L.; Zahradka, P.; Taylor, C.G. Marginal Zinc Deficiency Promotes Pancreatic Islet Enlargement While Zinc Supplementation Improves the Pancreatic Insulin Response in Zucker Diabetic Fatty Rats. Nutrients 2024, 16, 1819. [Google Scholar] [CrossRef]
- Mendes Garrido Abregu, F.; Caniffi, C.; Arranz, C.T.; Tomat, A.L. Impact of Zinc Deficiency During Prenatal and/or Postnatal Life on Cardiovascular and Metabolic Diseases: Experimental and Clinical Evidence. Adv. Nutr. 2022, 13, 833–845. [Google Scholar] [CrossRef] [PubMed]
- Aslam, M.; Bashir, S.; Zeb, A. Effect of zinc supplementation on blood glucose level in different age groups of diabetes type 2. Nutr. Health 2023, 29, 599–605. [Google Scholar] [CrossRef] [PubMed]
- Beloucif, A.; Kechrid, Z.; Bekada, A.M.A. Effect of zinc deficiency on blood glucose, lipid profile, and antioxidant status in streptozotocin diabetic rats and the potential role of sesame oil. Biol. Trace Elem. Res. 2022, 200, 3236–3247. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.J.; Bao, S.; Bolin, E.R.; Burris, D.L.; Xu, X.; Sun, Q.; Killilea, D.W.; Shen, Q.; Ziouzenkova, O.; Belury, M.A.; et al. Zinc deficiency augments leptin production and exacerbates macrophage infiltration into adipose tissue in mice fed a high-fat diet. J. Nutr. 2013, 143, 1036–1045. [Google Scholar] [CrossRef]
- Saunders, A.V.; Craig, W.J.; Baines, S.K. Zinc and vegetarian diets. Med. J. Aust. 2013, 199, S17–S21. [Google Scholar] [CrossRef]
- Perry, R.J.; Samuel, V.T.; Petersen, K.F.; Shulman, G.I. The role of hepatic lipids in hepatic insulin resistance and type 2 diabetes. Nature 2014, 510, 84–91. [Google Scholar] [CrossRef]
- Sun, K.; Kusminski, C.M.; Scherer, P.E. Adipose tissue remodeling and obesity. J. Clin. Investig. 2011, 121, 2094–2101. [Google Scholar] [CrossRef]
- Ferre, P.; Foufelle, F. Hepatic steatosis: A role for de novo lipogenesis and the transcription factor SREBP-1c. Diabetes Obes. Metab. 2010, 12 (Suppl. S2), 83–92. [Google Scholar] [CrossRef]
- McTernan, P.G.; Harte, A.L.; Anderson, L.A.; Green, A.; Smith, S.A.; Holder, J.C.; Barnett, A.H.; Eggo, M.C.; Kumar, S. Insulin and rosiglitazone regulation of lipolysis and lipogenesis in human adipose tissue in vitro. Diabetes 2002, 51, 1493–1498. [Google Scholar] [CrossRef]
- Huang, X.; Jiang, D.; Zhu, Y.; Fang, Z.; Che, L.; Lin, Y.; Xu, S.; Li, J.; Huang, C.; Zou, Y.; et al. Chronic high dose zinc supplementation induces visceral adipose tissue hypertrophy without altering body weight in mice. Nutrients 2017, 9, 1138. [Google Scholar] [CrossRef]
- Huang, X.; He, Q.; Zhu, H.; Fang, Z.; Che, L.; Lin, Y.; Xu, S.; Zhuo, Y.; Hua, L.; Wang, J.; et al. Hepatic leptin signaling improves hyperglycemia by stimulating MAPK Phosphatase-3 protein degradation via STAT3. Cell. Mol. Gastroenterol. Hepatol. 2022, 14, 983–1001. [Google Scholar] [CrossRef] [PubMed]
- Smith, E.R.; Shankar, A.H.; Wu, L.S.; Aboud, S.; Adu-Afarwuah, S.; Ali, H.; Agustina, R.; Arifeen, S.; Ashorn, P.; Bhutta, Z.A.; et al. Modifiers of the effect of maternal multiple micronutrient supplementation on stillbirth, birth outcomes, and infant mortality: A meta-analysis of individual patient data from 17 randomised trials in low-income and middle-income countries. Lancet Glob. Health 2017, 5, e1090–e1100. [Google Scholar] [CrossRef] [PubMed]
- Bolatimi, O.E.; Head, K.Z.; Luo, J.; Gripshover, T.C.; Lin, Q.; Adiele, N.V.; Watson, W.H.; Wilkerson, C.; Cai, L.; Cave, M.C.; et al. Can zinc supplementation attenuate high fat diet-induced non-alcoholic fatty liver disease? Int. J. Mol. Sci. 2023, 24, 1763. [Google Scholar] [CrossRef] [PubMed]
- Onaolapo, O.J.; Jegede, O.R.; Adegoke, O.; Ayinde, M.O.; Akeredolu, O.M.; Onaolapo, A.Y. Dietary zinc supplement militates against ketamine-induced behaviours by age-dependent modulation of oxidative stress and acetylcholinesterase activity in mice. Pharmacol. Rep. 2020, 72, 55–66. [Google Scholar] [CrossRef] [PubMed]
- Jiang, J.; Zhou, D.; Zhang, A.; Yu, W.; Du, L.; Yuan, H.; Zhang, C.; Wang, Z.; Jia, X.; Zhang, Z.N.; et al. Thermogenic adipocyte-derived zinc promotes sympathetic innervation in male mice. Nat. Metab. 2023, 5, 481–494. [Google Scholar] [CrossRef]
- Xu, Y.C.; Zheng, H.; Hogstrand, C.; Tan, X.Y.; Zhao, T.; Song, Y.F.; Wei, X.L.; Wu, L.X.; Luo, Z. Novel mechanism for zinc inducing hepatic lipolysis via the HDAC3-mediated deacetylation of beta-catenin at lysine 311. J. Nutr. Biochem. 2023, 121, 109429. [Google Scholar] [CrossRef]
- Hernandez-Mendoza, H.; Martinez-Navarro, I.; Hernandez-Ochoa, E.; Espinoza-Ruiz, M.; Lugo-Trampe, A.; Trujillo-Murillo, K.D.C.; Lopez-Garcia, M.A.; Rios-Lugo, M.J.; Chang-Rueda, C. Serum zinc levels are associated with obesity and low-density lipoprotein cholesterol in Mexican adults. J. Trace Elem. Med. Biol. 2022, 73, 127002. [Google Scholar] [CrossRef]
- Gu, K.; Xiang, W.; Zhang, Y.; Sun, K.; Jiang, X. The association between serum zinc level and overweight/obesity: A meta-analysis. Eur. J. Nutr. 2019, 58, 2971–2982. [Google Scholar] [CrossRef]
- Rios-Lugo, M.J.; Madrigal-Arellano, C.; Gaytan-Hernandez, D.; Hernandez-Mendoza, H.; Romero-Guzman, E.T. Association of Serum Zinc Levels in Overweight and Obesity. Biol. Trace Elem. Res. 2020, 198, 51–57. [Google Scholar] [CrossRef]
- Samuel, V.T.; Shulman, G.I. Mechanisms for insulin resistance: Common threads and missing links. Cell 2012, 148, 852–871. [Google Scholar] [CrossRef]
- Abel, E.D.; Peroni, O.; Kim, J.K.; Kim, Y.B.; Boss, O.; Hadro, E.; Minnemann, T.; Shulman, G.I.; Kahn, B.B. Adipose-selective targeting of the GLUT4 gene impairs insulin action in muscle and liver. Nature 2001, 409, 729–733. [Google Scholar] [CrossRef] [PubMed]
- Zisman, A.; Peroni, O.D.; Abel, E.D.; Michael, M.D.; Mauvais-Jarvis, F.; Lowell, B.B.; Wojtaszewski, J.F.; Hirshman, M.F.; Virkamaki, A.; Goodyear, L.J.; et al. Targeted disruption of the glucose transporter 4 selectively in muscle causes insulin resistance and glucose intolerance. Nat. Med. 2000, 6, 924–928. [Google Scholar] [CrossRef] [PubMed]
- Garvey, W.T.; Maianu, L.; Zhu, J.H.; Brechtel-Hook, G.; Wallace, P.; Baron, A.D. Evidence for defects in the trafficking and translocation of GLUT4 glucose transporters in skeletal muscle as a cause of human insulin resistance. J. Clin. Investig. 1998, 101, 2377–2386. [Google Scholar] [CrossRef] [PubMed]
- Garvey, W.T.; Maianu, L.; Zhu, J.H.; Hancock, J.A.; Golichowski, A.M. Multiple defects in the adipocyte glucose transport system cause cellular insulin resistance in gestational diabetes. Heterogeneity in the number and a novel abnormality in subcellular localization of GLUT4 glucose transporters. Diabetes 1993, 42, 1773–1785. [Google Scholar] [CrossRef]
- Maan, M.; Peters, J.M.; Dutta, M.; Patterson, A.D. Lipid metabolism and lipophagy in cancer. Biochem. Biophys. Res. Commun. 2018, 504, 582–589. [Google Scholar] [CrossRef]
- Morak, M.; Schmidinger, H.; Riesenhuber, G.; Rechberger, G.N.; Kollroser, M.; Haemmerle, G.; Zechner, R.; Kronenberg, F.; Hermetter, A. Adipose triglyceride lipase (ATGL) and hormone-sensitive lipase (HSL) deficiencies affect expression of lipolytic activities in mouse adipose tissues. Mol. Cell. Proteom. 2012, 11, 1777–1789. [Google Scholar] [CrossRef]
- Egan, J.J.; Greenberg, A.S.; Chang, M.K.; Wek, S.A.; Moos, M.C., Jr.; Londos, C. Mechanism of hormone-stimulated lipolysis in adipocytes: Translocation of hormone-sensitive lipase to the lipid storage droplet. Proc. Natl. Acad. Sci. USA 1992, 89, 8537–8541. [Google Scholar] [CrossRef]
- Snorgaard, O.; Poulsen, G.M.; Andersen, H.K.; Astrup, A. Systematic review and meta-analysis of dietary carbohydrate restriction in patients with type 2 diabetes. BMJ Open Diabetes Res. Care 2017, 5, e000354. [Google Scholar] [CrossRef]
- Daquinag, A.C.; Gao, Z.; Fussell, C.; Immaraj, L.; Pasqualini, R.; Arap, W.; Akimzhanov, A.M.; Febbraio, M.; Kolonin, M.G. Fatty acid mobilization from adipose tissue is mediated by CD36 posttranslational modifications and intracellular trafficking. JCI Insight 2021, 6, e147057. [Google Scholar] [CrossRef]
- Ahmed, B.; Sultana, R.; Greene, M.W. Adipose tissue and insulin resistance in obese. Biomed. Pharmacother. 2021, 137, 111315. [Google Scholar] [CrossRef]
- Feng, B.; Jiao, P.; Nie, Y.; Kim, T.; Jun, D.; van Rooijen, N.; Yang, Z.; Xu, H. Clodronate liposomes improve metabolic profile and reduce visceral adipose macrophage content in diet-induced obese mice. PLoS ONE 2011, 6, e24358. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Barnes, G.T.; Yang, Q.; Tan, G.; Yang, D.; Chou, C.J.; Sole, J.; Nichols, A.; Ross, J.S.; Tartaglia, L.A.; et al. Chronic inflammation in fat plays a crucial role in the development of obesity-related insulin resistance. J. Clin. Investig. 2003, 112, 1821–1830. [Google Scholar] [CrossRef] [PubMed]







| Genes | Forward | Reverse |
|---|---|---|
| Actb | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
| Acc1 | CGGACCTTTGAAGATTTTGTCAGG | GCTTTATTCTGCTGGGTGAACTCTC |
| Acc2 | GGAAGCAGGCACACATCAAGA | CGGGAGGAGTTCTGGAAGGA |
| Apob | TTGGCAAACTGCATAGCATCC | TCAAATTGGGACTCTCCTTTAGC |
| Atgl | CTGTGTGGAACCAAAGGACCTG | GCTACCCGTCTGCTCTTTCATC |
| Cd11c | CTGGATAGCCTTTCTTCTGCTG | GCACACTGTGTCCGAACTCA |
| Cd36 | ATGGGCTGTGATCGGAACTG | GTCTTCCCAATAAGCATGTCTCC |
| Dgat1 | TCCGTCCAGGGTGGTAGTG | TGAACAAAGAATCTTGCAGACGA |
| Fasn | GGCTCTATGGATTACCCAAGC | CCAGTGTTCGTTCCTCGGA |
| F4/80 | TGACTCACCTTGTGGTCCTAA | CTTCCCAGAATCCAGTCTTTCC |
| Glut4 | ACCGGATTCCATCCCACAAG | TCCCAACCATTGAGAAATGATGC |
| Hsl | TGAAGCCAAAGATGAAGTGAGAC | CTTGACTATGGGTGACGTGTAGAG |
| Il6 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
| Leptin | GAGACCCCTGTGTCGGTTC | CTGCGTGTGTGAAATGTCATTG |
| Mcp1 | TTAAAAACCTGGATCGGAACCAA | GCATTAGCTTCAGATTTACGGGT |
| Mcp2 | CCCTTCGGGTGCTGAAAAG | CCACTTCTGTGTGGGGTCTAC |
| Mgll | CGGACTTCCAAGTTTTTGTCAGA | GCAGCCACTAGGATGGAGATG |
| Pgc1a | TATGGAGTGACATAGAGTGTGCT | CCACTTCAATCCACCCAGAAAG |
| Plin | CGTGGAGAGTAAGGATGTCAATG | GGCTTCTTTGGTGCTGTTGTAG |
| Pparg | GGAAGACCACTCGCATTCCTT | TCGCACTTTGGTATTCTTGGAG |
| Scd1 | CCTACGACAAGAACATTCAATCCC | CAGGAACTCAGAAGCCCAAAGC |
| Srebf1 | AACTGCCCATCCACCGACTC | ATTGATAGAAGACCGGTAGCGC |
| Tnfa | GACCCTCACACTCAGATCATCTTCT | CCACTTGGTGGTTTGCTACGA |
| Control | 30 ppm ZnSO4 | 90 ppm ZnSO4 | p Value | |
|---|---|---|---|---|
| Body weight (g) | 28.682 ± 0.282 | 29.100 ± 0.343 | 28.767 ± 0.388 | 0.6823 |
| Tissue weight (g) | ||||
| Liver weight | 1.282 ± 0.065 | 1.425 ± 0.025 | 1.353 ± 0.023 | 0.1364 |
| Epididymal fat | 0.428 ± 0.018 | 0.345 ± 0.033 | 0.348 ± 0.024 | 0.0704 |
| Perirenal fat | 0.158 ± 0.010 a | 0.105 ± 0.015 b | 0.114 ± 0.012 b | 0.0248 |
| Subcutaneous fat | 0.304 ± 0.018 a | 0.206 ± 0.024 b | 0.232 ± 0.013 b | 0.0099 |
| Sum of white fat depots | 0.890 ± 0.045 a | 0.656 ± 0.064 b | 0.695 ± 0.046 b | 0.0184 |
| Brown fat | 0.062 ± 0.002 | 0.061 ± 0.001 | 0.052 ± 0.002 | 0.1930 |
| Tissue weight index (%) | ||||
| Liver weight | 4.469 ± 0.222 | 4.898 ± 0.075 | 4.707 ± 0.087 | 0.2080 |
| Epididymal fat | 1.493 ± 0.057 a | 1.182 ± 0.108 b | 1.214 ± 0.088 b | 0.0496 |
| Perirenal fat | 0.549 ± 0.031 a | 0.360 ± 0.051 b | 0.398 ± 0.044 b | 0.0200 |
| Subcutaneous fat | 1.057 ± 0.060 a | 0.710 ± 0.084 b | 0.808 ± 0.046 b | 0.0076 |
| Sum of white fat depots | 3.099 ± 0.143 a | 2.253 ± 0.217 b | 2.421 ± 0.171 b | 0.0135 |
| Brown fat | 0.214 ± 0.006 | 0.210 ± 0.019 | 0.182 ± 0.007 | 0.1590 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, X.; Jiang, D.; Zhu, Y.; Fang, Z.; Feng, B. Short-Term Zinc Supplementation Stimulates Visceral Adipose Catabolism and Inflammation in Mice. Nutrients 2024, 16, 3719. https://doi.org/10.3390/nu16213719
Huang X, Jiang D, Zhu Y, Fang Z, Feng B. Short-Term Zinc Supplementation Stimulates Visceral Adipose Catabolism and Inflammation in Mice. Nutrients. 2024; 16(21):3719. https://doi.org/10.3390/nu16213719
Chicago/Turabian StyleHuang, Xiaohua, Dandan Jiang, Yingguo Zhu, Zhengfeng Fang, and Bin Feng. 2024. "Short-Term Zinc Supplementation Stimulates Visceral Adipose Catabolism and Inflammation in Mice" Nutrients 16, no. 21: 3719. https://doi.org/10.3390/nu16213719
APA StyleHuang, X., Jiang, D., Zhu, Y., Fang, Z., & Feng, B. (2024). Short-Term Zinc Supplementation Stimulates Visceral Adipose Catabolism and Inflammation in Mice. Nutrients, 16(21), 3719. https://doi.org/10.3390/nu16213719

