Skip to Content
SustainabilitySustainability
  • Article
  • Open Access

22 September 2025

Upcycling Wheat-Rye Bread and Chokeberry Waste into Sustainable Fermented Beverages with Potential Probiotic Properties

,
,
,
,
,
and
1
Department of Natural Science and Quality Assurance, Institute of Quality Science, Poznań University of Economics and Business, 61-875 Poznań, Poland
2
Scientific Student Association “Inventum”, Department of Natural Science and Quality Assurance, Institute of Quality Science, Poznań University of Economics and Business, 61-875 Poznań, Poland
*
Author to whom correspondence should be addressed.

Abstract

Increasing food consumption and waste generation are today’s most difficult economic and environmental challenges. In line with the sustainable production and consumption concept, wasted food, as a source of valuable resources, can be reused to produce new products of higher value than the raw materials from which they were made. This concept was used in this work to design products that are a plant-based alternative to fermented milk drinks, which arouse great interest among consumers due to their health-promoting properties. This study aimed to design potential probiotic beverages from food industry waste, including wheat-rye bread and chokeberry pomace, using lactic acid fermentation with different strains of lactic acid bacteria (LAB) and to evaluate selected quality features of the obtained beverages. In the first stage of the research, the group of LAB strains was tested for their efficiency in bakery waste fermentation, and then the potential probiotic properties of chosen LAB strains (Lactiplantibacillus plantarum A7, Lacticaseibacillus paracasei INV001, Lacticaseibacillus rhamnosus INV002, Lentilactobacillus buchneri P7, Loigolactobacillus coryniformis INV014) were characterized according to FAO/WHO requirements. For the prepared beverages, microbiological quality, antioxidant properties, and the content of polyphenolic compounds were determined. It was found that bakery and chokeberry waste may constitute a good base for obtaining fermented beverages with some beneficial properties, including a high number of potentially probiotic bacteria, reaching 108 CFU/mL, and antioxidant properties, which positively verified their functional properties. The research confirms the high potential of lactic acid fermentation in managing food waste to create innovative, sustainable food products with probiotic properties.

1. Introduction

The expected population growth and increasing demand for food contribute to the growing problem of food waste and waste generation. Food waste is one of the most difficult economic and environmental problems, posing a huge challenge and requiring sustainable solutions in production and consumption [1,2]. It is estimated that one-third of the food produced is wasted each year, and the global annual waste of edible food is 1.3 billion tones [3,4,5]. Food is wasted throughout the whole food supply chain, from raw materials, through production, to distribution, and by the final consumer. In developed countries, food waste most often occurs after food reaches the consumer, while in developing countries, it occurs both during agricultural production and food production [6,7,8,9]. This indicates a strong need for proper food waste management, which would support achieving sustainable development goals and could reduce hunger worldwide [1,10,11]. Effective actions should focus especially on the improvement of two areas: technologies and techniques for managing food waste more efficiently and cost-effectively, in connection with the principles of the circular economy. Currently, available technologies are mostly focused on the use of waste, e.g., to obtain fertilizer, concentrating mainly on minimizing the amount of food waste [12,13]. However, it is worth noting that these activities can also aim at new possibilities of waste valorization, which is profitable, although less popular [1,14]. Effective food waste management can also reduce the impact of food waste on global warming, considering that industry is responsible for approximately 22% of total global greenhouse gas emissions and 30% of total energy consumption [15]. Food waste is estimated to have a global carbon footprint of approximately 4.4 Gt CO2 equivalent per year, representing 8% of total anthropogenic greenhouse gas emissions [16].
Wasted food is also a valuable resource that can be reused in line with the concept of a circular economy, which involves minimizing waste through reusing, recycling, or implementing more efficient and innovative technologies [13,14]. Therefore, one of the strategies is to create upcycled foods. The term was coined for food produced using ingredients derived from food that would otherwise become food waste. This includes the use of inferior quality, damaged food, by-products, and waste from production processes, which are not suitable for sale as a stand-alone product but still have nutritional value, so their non-use contributes to food waste [17,18,19].
Designing fermented products allows the use of by-products or waste from the food industry, thus being one of the proposals for their management, especially since the market for plant-based alternatives, including fermented plant-based food, has been growing exponentially in recent years. It is even considered the dominant dietary trend today [20,21]. A significant impact on the growth of this segment was noted during the COVID-19 pandemic, as consumers’ interest in the products’ health-promoting properties, especially immune system support, increased. Europe has the largest market of fermented foods, which is divided into different product groups, including dairy alternatives, meat alternatives, sauces, and seasonings.
Fermented plant-based products, such as beverages, are of particular interest for consumers, including conventional (e.g., bakery) and emerging products such as meat and dairy alternatives, with the largest market share held by fermented bakery products [21,22]. It is worth noting that innovative plant-based fermented products are considered more sustainable than traditional dairy beverages because they have a smaller carbon footprint and use fewer natural resources [23,24]. Moreover, the transformation of bioactive compounds occurring during the fermentation process can improve the organoleptic and nutritional quality of the product [21]. Therefore, it is emphasized that fermented plant-based beverages show improved digestibility and increased bioavailability of nutrients, which is due to, among others, the promotion of the synthesis of selected vitamins, the degradation of anti-nutritional compounds, the improvement of protein digestibility [24] and the accumulation of biologically active compounds [25]. The advantages of these products make fermented plant-based beverages an alternative to traditional milk beverages [26], being a good choice for people struggling with milk allergy or lactose intolerance, but also for those who pay attention to a balanced diet or follow plant-based diets [24].
Wheat-rye bread waste and chokeberry pomace with the appropriately selected lactic acid bacteria were used to design the fermented beverages in the presented work. Bread is a product that is commonly consumed all over the world, and at the same time, it is a commonly wasted food, especially in developed countries, which is a serious problem [27]. However, bread is rich in carbohydrates, contains proteins, little fat, and trace amounts of phosphorus, therefore, bakery waste could be valorized into value-added products [28]. In turn, chokeberry fruits contain very high amounts of polyphenolic compounds, making it one of the most potent antioxidant fruits of all [29]. Interestingly, in addition to these fruits, processed products and derived waste are also rich in polyphenols [30]. The literature reports that both chokeberry fruits and their extracts exhibit anti-diabetic, antimutagenic, and anti-cancer effects, as well as protect the cardiovascular system and liver [29]. In vitro studies also indicate high antioxidant properties of chokeberry, both in processed and unprocessed form, as chokeberry ingredients are considered to be the most active ABTS radical scavengers, which confirms this activity [30,31].
The combination of these two types of products allows the use of nutrients in bread and enriches the drink with valuable polyphenolic compounds from chokeberry waste. Therefore, this study aimed to design potentially probiotic beverages from wheat-rye bread waste and chokeberry pomace using lactic acid fermentation with appropriately selected strains of lactic acid bacteria (LAB) and evaluate selected quality features and safety of the obtained beverages.

2. Materials and Methods

2.1. Chemicals, Materials, and Microorganisms

2.1.1. Chemicals

Microbiological media used for the studies were obtained from BioMaxima (Poland) and included De Man–Rogosa–Sharpe (MRS) Agar and Broth, Plate Count Agar (PCA), TBX Agar, VRBG Agar, Sabouraud dextrose with chloramphenicol Agar, Trypticasein Soy Agar (TSA), Trypticasein Soy Broth (TSB), Nutrient Broth (NB), Brain Heart Infusion Agar and Broth (BHI), Yeast Extract Peptone Dextrose Agar and Broth (YPD), and Mueller–Hinton Broth. Chemical reagents used to determine potential probiotic and antioxidant properties of LAB strains such as glucose (Chempur, Piekary Śląskie, Poland), Phosphate Buffered Saline (PBS) (pH 7.4) (BioShop, Burlington, ON, Canada), hydrochloric acid, sodium chloride and toluene (Chempur, Poland), bile extract (Sigma, Darmstadt, Germany), Folin–Ciocalteu reagent (Sigma, Germany), sodium carbonate (Chempur, Poland), gallic acid (Sigma, Germany), methanol (98%) (Stanlab, Poland), 2-2’-azino-bis[3-ethylbenzothiazoline-6-sulfonic acid] (ABTS) diammonium salt (Sigma, Germany), Trolox (6-hydroxy-2,5,5,8-tetramethylchromane-2-carboxylic acid) (Sigma, Germany), potassium persulfate (Chempur, Poland), used in the research were of analytical grade. Antibiotics used to determine the sensitivity of LAB strains, including ampicillin and tetracycline (Sigma, Germany), erythromycin (Acros Organics, Geel, Belgium), streptomycin (Fisher Bioreagents, Pittsburgh, PA, USA), kanamycin, and chloramphenicol (BioShop, Canada), were used to prepare solutions immediately before the test. The following reagents were used for genetic identification: DNA Genomic Mini AX Bacteria+ Spin, PCR Mix Plus Green, and DNA marker 3 (A&A Biotechnology, Gdańsk, Poland), PCR reaction primers 1492R and S-D-Bact-008 (27F) (Future Synthesis, Poznań, Poland), and Biotechnology Grade agarose (BioShop, Canada).

2.1.2. Plant-Based Materials

The ground stale wheat-rye bread and chokeberry pomace were the base for preparing the beverages. The wheat-rye bread, for the duration of this study, was stored sealed in a dry, shaded place at room temperature (±20 °C). Chokeberry pomace was kept frozen at −18 °C. Before preparing the beverage, pomace was dried at 60 °C for 2 h and ground using an analytical mill (IKA® A11, Sigma-Aldrich, Steinheim, Germany).

2.1.3. Microorganisms

Thirteen strains of lactic acid bacteria (LAB) were used in the first stage of study to prepare the fermented beverages: Lentilactobacillus buchneri P7, Levilactobacillus brevis INV009, Loigolactobacillus coryniformis INV014, Limosilactobacillus fermentum INV003, Lactiplantibacillus plantarum A7, Lacticaseibacillus paracasei INV001, Lacticaseibacillus rhamnosus INV002, Leuconostoc mesenteroides INV011, Pediococcus pentosaceus INV010, Lactobacillus helveticus INV008, L. sakei JS032, Lacticaseibacillus zeae, and Streptococcus thermophilus INV017. Antimicrobial properties of selected LAB strains were assessed against ten indicator microorganisms, Gram-positive bacteria: Micrococcus luteus ATCC 4698, Bacillus subtilis DSM 4451, Staphylococcus aureus ATCC 33868, Enterococcus faecalis ATCC 19433, and Listeria monocytogenes ATCC 19111; Gram-negative bacteria: Serratia marcescens PCM 549, Escherichia coli ATCC 25922, Pseudomonas paraeruginosa ATCC 9027, Salmonella Enteritidis ATCC 13076, and yeast, Rhodotorula mucilaginosa DKK 040. The culture conditions of each microorganism are shown in Table 1. All strains used originated from the collection of the Department of Natural Science and Quality Assurance, Poznań University of Economic and Business, Poland. The LAB strains were identified using the MALDI-TOF MS method. When testing the probiotic potential of the LAB strains, they were re-identified. Before each use, LAB strains were cultured in MRS Broth for 24 h at 37 °C. The strains were stored long-term in cryoprobes in MRS Broth, mixed 1:1 with 80% glycerol at −23 °C.
Table 1. List of indicator microorganisms with culture conditions.

2.2. Bread-Waste Beverage Fermentation with LAB

Bread-waste beverages without (BWBs) and with chokeberry pomace (BWB + CPs) were prepared according to the procedure described by Juś et al. [32]. First, 10 g of ground stale wheat–rye bread was soaked in 200 mL of boiling water in a sterile Simax and left to soften for 24 h at room temperature. Next, glucose (5 g) and varying amounts of dried, ground chokeberry pomace (5–10 g) were added (under laminar chamber), depending on the stage of the experiment (Figure 1). Finally, the mixtures were inoculated with 1 mL of LAB cultures (density 1010 CFU/mL) per 100 mL and incubated at 30 °C for 24 h. After fermentation, total LAB counts were estimated by the standard plate count method by culturing microorganisms on MRS Agar at 30 °C for 24–48 h. This study was conducted in three parallel repetitions.
Figure 1. The scheme of fermented beverages development.

2.3. Characterization of the Probiotic Potential of Selected LAB Strains

2.3.1. Identification of Selected LAB Strains

Identification of selected LAB strains was performed by the matrix-assisted laser desorption-ionization (MALDI) time-of-flight mass spectrometry (TOF/MS) method using ribosomal protein profile analysis [33] and 16S rRNA gene sequencing [34]. To identify isolates by the MALDI-TOF MS method, single colonies with homogeneous growth, prepared by a series of reduction plating were sent for identification to the Life Sciences Park in Krakow (Poland) at the Jagiellonian Center of Innovation.
Genetic identification was performed in the following stages: genomic DNA isolation, polymerase chain reaction (PCR), agarose gel electrophoresis, sequencing of PCR reaction products, and their analysis [34]. Isolation of genomic DNA from 24-h cultures of the test strains was performed according to the procedure included with the Genomic Mini AX Bacteria+ Spin kit (A&A Biotechnology).
Polymerase chain reaction (PCR) was performed to amplify a 16S rRNA gene sequence fragment. The primers used were forward S-D-Bact-0008-c-S-20 (27F) (AGAGTTTGATCCTGGCTCAG) and reverse 1492R (TACGGYTACCTTGTTACGACTT) [35]. The primers were diluted in ultrapure water according to the manufacturer’s recommendations (10 µL of primer in 190 µL of ultrapure water). Amplification was performed using PCR Mix Plus Green (2005-100Z, A&A Biotechnology). Samples were prepared in sterile 25 µL Eppendorf tubes with the composition: PCR Mix Plus Green 12.5 µL, 1492R primer 1 µL, S-D-Bact-0008 (27F) primer 1 µL, DNA template 1 µL, ultrapure water 9.5 µL. The PCR reaction was carried out immediately in a Biometra thermocycler according to the scheme: initial denaturation (95 °C, 180 s), primer binding (45 °C, 30 s), elongation (78 °C, 120 s), 30 cycles: denaturation (94 °C, 30 s), primer binding (45 °C, 30 s), elongation (72 °C, 120 s), completed with denaturation (95 °C, 30 s), primer binding (45 °C, 30 s), elongation (72 °C, 420 s). Next, electrophoresis was performed using a 1% agarose gel with Midori Green Advance dye (MG04, NIPPON Genetics Europe) and 1xTBE buffer for 45 min at 5 V/cm. PCR products were compared with a DNA marker (3035-500, A&A Biotechnology) with a range of 100–3000 base pairs. Observation under UV light, using an Omega Lum G gel analyzer (Aplegen), made it possible to observe the efficiency of the polymerase chain reaction performed. PCR products were sent to Genomed SA in Warsaw (Poland) for sequencing. The GeneDoc 2.7 program provided by the National Resource for Biomedical Supercomputing (NRBSC) was used to analyze the obtained sequences. Next, the sequences obtained were compared with the BLAST® database of genetic nucleotide sequences belonging to the National Center for Biotechnology Information (NCBI).

2.3.2. Antimicrobial Activity

The antimicrobial activity of five selected LAB strains (Figure 1) was determined by the well diffusion method against ten indicator microorganisms (Table 1). From 24-h cultures of indicator microorganisms maintained under optimal conditions (Table 1), suspensions were prepared in physiological saline with an optical density of 0.5 on the McFarland scale, and inoculation was performed using the flood method in three parallel replicates. After the medium had solidified, 10 mm diameter wells were cut out with a sterile cork borer. Next, 100 µL of a 24-h LAB culture with an optical density of 10 on the McFarland scale was introduced into each well. The plates were incubated for 24 h at 30 °C or 37 °C, depending on the requirements of the indicator microorganisms. After incubation, the diameter of the growth inhibition zone, including the wells’ diameter, was measured.

2.3.3. Susceptibility to Antibiotics

The sensitivity of LAB strains to six antibiotics: ampicillin, tetracycline, erythromycin, streptomycin, kanamycin, and chloramphenicol in the concentration range of 0.125–256 µg/mL, depending on the substance, was determined using the microplate method. The antibiotics and their used concentrations were selected following EFSA guidelines [36]. First, two-fold dilutions of antibiotic solutions were made in a liquid medium consisting of a Mueller–Hinton and MRS Broths (9:1) mixture in 96-well U-bottom microplates. Then, bacterial suspensions were prepared from 24-h cultures in physiological saline with an optical density of 0.5 on the McFarland scale and diluted 1:100 in the medium. Next, 100 µL of the prepared bacterial suspension was added to the wells of a microplate with the prepared antibiotic dilutions. The microplates were incubated for 24 h at 37 °C, after which the optical density was measured at 600 nm wavelength using a BioTek Epoch 2 (BioTek Instruments Limited, Winooski, VT, USA) microplate spectrophotometer. The negative control was a medium with antibiotics, without the addition of bacterial suspension. The positive control was a medium without the addition of antibiotics. The minimum inhibitory concentration (MIC) value was determined based on the measurements taken and compared with the cut-off values defined by the EFSA [36].

2.3.4. Acidic pH and Bile Salts Tolerance

The low pH and bile salt tolerance were performed using sterile 96-well U-bottom microplates. The LAB suspensions were prepared by centrifuging 2 mL of a 24-h culture for 5 min at 10,000 rpm and washing twice with PBS solution (phosphate buffered saline), centrifuging the biomass each time. Finally, 2 mL of the culture was reconstituted by adding MRS Broth. The preparation of the low pH environment consisted of adjusting the medium pH to 2.0 and 3.0 by adding HCl to MRS broth. Similarly, solutions were prepared to determine LAB tolerance for bile salts. Bile salt extract was added to MRS Broth at final concentrations of 1%, 0.5%, and 0.25%, and the solutions were filtered through a syringe filter with a 0.22 µm pore size. Each well of the microplate was filled with 180 µL of the appropriate pH medium or 180 µL of MRS medium with bile salts and 20 µL of the prepared tested strain cell suspension. The first absorbance measurement at 600 nm was taken immediately after preparation, followed by incubation for 24 h at 37 °C, with absorbance measurements taken every hour using a BioTek Epoch 2 (BioTek Instruments Limited, Winooski, VT, USA) microplate spectrophotometer. The negative control was MRS Broth without added bacterial culture. The positive control was a bacterial culture suspended in MRS Broth at pH 6.5 [37].

2.3.5. The Cell Surface Hydrophobicity Test

The cell hydrophobicity was assessed according to the method described by Taheri et al. [38] and Prasath et al. [39] with some modifications. Tested strains were prepared from a 24-h culture by centrifugation for 5 min at 7500 rpm in a centrifuge 5804R (Eppendorf AG, Hamburg, Germany), and washed twice with PBS solution [39], each time centrifuged under the same conditions. The biomass was resuspended in saline until an optical density of 0.5 was achieved with an absorbance measurement of 600 nm. To sterile Falcon-type tubes, 3 mL of bacterial suspension and 1 mL of toluene were added, then shaken vigorously for 90 s and allowed to stand for 15 min for phase separation. The absorbance of the aqueous phase was measured at 600 nm using Genesys 10S UV–VIS spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The final result is a calculation of the percentage decrease in optical density of suspensions of the tested strains caused by cell adhesion to toluene [38].

2.4. Evaluation of the Quality and Functional Properties of Fermented Beverages

2.4.1. Microbiological Quality and Safety of Fermented Beverages

The microbiological quality and safety of beverages were assessed by the standard plate count method after 0, 24, and 48 h of fermentation. The tests were performed for total bacterial count (PCA, 30 °C), LAB count (MRS Agar, 37 °C), fungi count (yeasts and molds) (Sabouraud dextrose with chloramphenicol Agar, 30 °C), Enterobacteriaceae count (VRBG Agar, 37 °C) and the presence of Escherichia coli (TBX Agar, 37 °C). The plates were incubated for 24–48 h. The assessment of pH value for the beverages was performed with Thermo Scientific Orion Star A111 pH meter (Waltham, MA, USA). Each sample was analyzed three times at room temperature (22.0 ± 2.0 °C).

2.4.2. Determination of Total Phenolic Content (TPC) of Fermented Beverages

Total phenolic content was determined using the Folin–Ciocalteu method on 48-well microtiter plates described by Włodarska et al. [40]. Samples were centrifuged in a MiniSpin centrifuge (Eppendorf) for 5 min at 10,000 rpm. Samples were used for the tests without dilution and diluted 1:1 with demineralized water. The reference sample was demineralized water. The Folin–Ciocalteu reagent was added to the wells with the sample, left for 3 min, next a clear aqueous solution of sodium carbonate 20% was added. Subsequently, demineralized water was introduced into each well and left in a dark place for 2 h. The measurements were performed at 765 nm using a BioTek Epoch 2 microtiter spectrophotometer. Total phenolic content was expressed as mg gallic acid per 100 mL of beverage, calculated from the gallic acid standard curve equation.

2.4.3. Determination of Antioxidant Activity (TEAC) of Fermented Beverages

The antioxidant activity of the tested beverages was determined using the TEAC test based on the ABTS reaction and absorbance decrease. The samples were centrifuged in a MiniSpin centrifuge (Eppendorf) for 5 min at 10,000 rpm, and the measurement was performed in a Genesys 10S UV–VIS spectrophotometer (Thermo Fisher Scientific) [41]. The samples of the tested beverages were diluted to a concentration of 10 mg/mL. TEAC values were expressed in mM Trolox equivalent per liter of beverage. TEAC values were calculated as the equation of the sample dilution ratio and the corresponding Trolox standard curve.

2.5. Statistical Analysis

The results of the studies are presented as the arithmetic mean (±standard deviation) from three–six parallel replicates. The selected results were subjected to one-way analysis of variance (ANOVA) using Tukey’s test with a significance level of p < 0.05. For the TPC and TEAC results, correlation analysis was performed using Pearson’s and Spearman’s correlation coefficients. Microsoft Excel® (Microsoft 365 MSO) and IBM SPSS Statistics 29 (PS IMAGO PRO 10.0) programs were used for statistical analyses.

3. Results

3.1. Screening of LAB Strains Based on the Ability of Bread and Chokeberry Fermentation

In the first stage of the experiment, the ability of 13 LAB strains to ferment bread waste, both without and with the addition of dried chokeberry pomace, was assessed to select strains showing the highest process efficiency (Figure 2). The efficiency of the fermentation process was determined based on the total number of lactic acid bacteria and the value of the increase in the LAB number after fermentation compared to 0 h. Most LAB strains reached cell counts above 7 log CFU/mL after 24 h of fermentation. Lower counts were obtained in beverages fermented by L. helveticus INV008 and L. zeae (below 7 and 6 log CFU/mL, respectively). The addition of dried chokeberry pomace did not negatively affect the number of LAB in BWB, as indicated by the comparable number of LAB population in beverages without and with the addition of chokeberry. The key criterion for selecting strains was the difference in LAB numbers between 0 and 24 h of incubation. The highest difference was observed in beverages inoculated with L. plantarum A7 and L. paracasei INV001, where the difference in the number of LAB between 0 and 24 h of fermentation was above 3 log CFU/mL in both variants (without and with the addition of chokeberry pomace). High LAB growth rates were also noted in beverages inoculated with L. rhamnosus INV002, L. coryniformis INV014, and L. buchneri P7, which were above 2.8 log CFU/mL and above 2.5 log CFU/mL for the BWB and BWB + CP variants, respectively. Based on the above analysis, strains: L. paracasei INV001, L. plantarum A7, L. coryniformis INV014, L. buchneri P7 and L. rhamnosus INV002 were selected as the most effective.
Figure 2. Total count and increase in LAB number in BWBs after 24 h fermentation. BWB—bread-waste beverages without additives; BWB + CP—bread-waste beverages with addition of chokeberry pomace. Yellow highlighting—results obtained for strains selected for the next stage.

3.2. Characterization of the Probiotic Potential of the Selected Strains

The conducted screening tests allowed the selection of five LAB strains (L. paracasei INV001, L. plantarum A7, L. coryniformis INV014, L. buchneri P7, L. rhamnosus INV002), which met the assumptions of the project concerning the development of a fermented beverage based on waste and by-products of the food industry. The added value of the designed beverages was the usage of appropriately selected strains. Therefore, in addition to their fermentation abilities, their potential probiotic properties were determined. Functional features, including antimicrobial properties, antibiotic sensitivity, resistance to digestive tract conditions, and hydrophobicity of cells, were assessed according to FAO/WHO criteria [42].

3.2.1. Identification of LAB

As mentioned earlier, the LAB strains used in the presented studies were identified using the MALDI-TOF MS method, while for five selected strains, species affiliation was also verified by genetic identification. A fragment of the 16S rRNA gene sequence was sequenced, which also enabled phylogenetic classification. The identification results, together with the percentage of identity after comparing the obtained sequence with the BLAST® genetic database, are presented in Table 2. The value of the identification index was interpreted according to the report of the ordered analysis: ≥2.00—identification with high certainty, 1.70–1.99—identification with low certainty, and 0.00–1.69—no identification. Query coverage of the presented LAB identification results obtained using BLAST was 98–100%.
Table 2. Results of the identification of five LAB strains.
The genetic identification confirmed the results of identification using MALDI-TOF MS. Based on the obtained 16S rRNA sequences, molecular phylogeny analysis was performed, and the phylogenetic tree was constructed using the neighbor-joining method (no. of bootstrap replications = 2000) (Figure 3) [43,44,45,46]. Following the phylogenetic analysis, LAB strains INV001 and INV002 were placed in the cluster making up the Lacticaseibacillus genus, subgroups L. paracasei and L. rhamnosus, respectively. The strain P7 was placed in the Lentilactobacillus cluster, L. buchneri subgroup. Next, A7 was allocated in the cluster of Lentilactobacillus, L. plantarum subgroup. Finally, the INV014 strain was placed in the Loigolactobacillus cluster, subgroup L. coryniformis. The conducted phylogenetic analysis also confirmed the correctness of the isolated LAB strains identification (Figure 3).
Figure 3. Phylogenetic tree based on 16S rRNA gene sequences showing the position of selected LAB isolates (marked with a filled red triangle pointing upwards). Bacillus subtilis ATCC 55406 and Escherichia coli ATCC 11775T were taken as an out-group. Bootstrap values are given at branching points.

3.2.2. Antimicrobial Properties of Selected LAB Strains

The antimicrobial activity of LAB strains (Figure 4) was determined against ten indicator microorganisms selected on the EFSA’s requirements for assessing probiotic potential and potential commercialization [47]. Figure 4 shows the results of the assessment.
Figure 4. The antimicrobial properties of LAB strains.
As the results indicate, the tested LAB strains inhibited the growth of indicator microorganisms to a varying extent, and each of them was characterized by a different spectrum of activity. No inhibition of the growth of S. Enteritidis, and the yeast R. mucilaginosa was observed; therefore, they were not included in the graph. Among the tested LAB strains, the L. coryniformis INV014 strain showed the widest spectrum of activity, inhibiting the growth of eight indicator microorganisms (M. luteus, B. subtilis, S. aureus, L. monocytogenes, E. faecalis, S. marcescens, P. paraeruginosa, and E. coli) to a strong or moderate degree. Three strains: L. paracasei INV001, L. rhamnosus INV002, and L. plantarum A7 inhibited the growth of four–five indicator microorganisms, and the strain L. buchneri P7 showed activity only against E. coli. Comparing the sensitivity of the indicator microorganisms used, no trend was observed, while the most strongly inhibited microorganism by most LAB strains was M. luteus. Based on such results, it can be concluded that mixtures of different LAB strains may have a beneficial effect on their ability to inhibit the growth of pathogenic microorganisms and thus expand the scope of their action.

3.2.3. Antibiotic Sensitivity of Selected LAB Strains

The results of the sensitivity assessment of the tested LAB strains to selected antibiotics are presented in Table 3. The numbers in brackets indicate the breakpoints established by the EFSA [47], and the symbol “n.r.” (not required) indicates that this value was not established by the EFSA for a given microorganism. The microorganism was considered resistant when the obtained value exceeded the breakpoint.
Table 3. Sensitivity of selected LAB strains to antibiotics (expressed as MIC—minimal inhibitory concentration).
All strains tested showed sensitivity to ampicillin, kanamycin, erythromycin, tetracycline, and chloramphenicol; however, the MIC values differed between strains. The highest sensitivity to kanamycin was demonstrated by strain L. coryniformis INV014, while the strain L. paracasei INV001 showed the highest susceptibility to erythromycin, tetracycline, and chloramphenicol among all tested strains. Sensitivity to streptomycin was variable. Two strains, L. paracasei INV001 and L. rhamnosus INV002, showed resistance, while the MIC value for the strains L. buchneri P7 and L. coryniformis INV014 was at the cut-off. Similarly, MIC value for the L. plantarum A7 was at the cut-off in case of ampicillin sensitivity.

3.2.4. Tolerance to Gastrointestinal Conditions

The survival of potentially probiotic bacteria under low pH conditions and the presence of bile salts in in vitro tests is crucial because it directly influences the determination of the dose of the microorganism to be administered to the experimental host in in vivo tests. Hydrochloric acid can disrupt the activity of macromolecules, and a reduced pH can inhibit the metabolism and growth capacity of Lactobacilliaceae [48]. Adding hydrochloric acid to the MRS Broth allowed obtaining pH values corresponding to the conditions in the human stomach: pH 2.0 (without food) and pH 3.0 (after a heavy meal) [49]. The results of the determination of low pH tolerance and bile salt tolerance by the tested LAB strains are shown in Table 4. Low pH tolerance was expressed as a percentage of microbial growth compared to the control sample (pH 6.5). Strain L. paracasei INV001 showed the best tolerance at both values of reduced pH, while the percentage of tolerance did not change (87%). High tolerance was also observed for strain L. buchneri P7, showing higher survival at pH 2.0 (87%) than at pH 3.0 (78%). Strains L. rhamnosus INV002 and L. coryniformis INV014 showed similar tolerance at both pH values. In contrast, the lowest tolerance was observed for strain L. plantarum A7, reaching values of 62% at pH 2.0 and 71% at pH 3.0. Figures S1–S10 in the Supplementary Materials show the growth of the tested strains in low pH conditions during 24 h of incubation in more detail. Comparison of cultures on a medium with reduced pH and control medium showed that differences in the growth of strains appeared already within the first 3 h. All strains showed moderate to strong tolerance to low pH values, which emphasizes the usefulness of the tested strains in terms of probiotic potential.
Table 4. Results of survival assessment in the gastrointestinal tract.
The results of the bile salt tolerance determination for the tested LAB strains are shown in Table 4. Tolerance was determined as the percentage of microbial growth compared to the control sample (no bile salts present). Three concentrations of bile salts were used in this study: 0.25%, 0.5% and 1%. In the control sample, all strains showed similar optical density, indicating comparable growth under optimal conditions. However, with increasing bile salt concentration, a decrease in optical density was observed in all strains. The highest tolerance at the highest salt concentration (1%) was shown by strains L. paracasei INV001 and L. plantarum A7, reaching the same value of 74% survival compared to the control sample. Strain L. buchneri P7 showed moderate tolerance (62% at 1% bile salts), while strain L. coryniformis INV014 showed the lowest bile salt tolerance. Based on the results, it was observed that all tested LAB strains showed greater tolerance to 1% bile salt concentration in the environment, compared to lower concentrations. This trend may be related to the ability of lactic acid bacteria, potentially probiotics, to hydrolyze bile salts using the enzyme bile salt hydrolase (BSH) [50]. Strains with higher bile salt tolerance may have greater industrial utility in developing potential probiotic products.

3.2.5. Cell Hydrophobicity

An important parameter for assessing the probiotic potential of bacteria is cell hydrophobicity. High cell hydrophobicity increases the potential ability to adhere to intestinal epithelial cells and survive in the intestines themselves, which increases the chance for better colonization of the intestinal epithelium. In addition, greater adhesion to carbohydrates increases the ability of cells to self-aggregate, which prolongs their residence time in the intestines [50]. The test results are presented in Table 4, and based on them, the microorganisms were divided into three groups depending on the result: highly hydrophobic (>50%), moderately hydrophobic (20–50%), and hydrophilic (<20%) [51]. All tested LAB strains can be described as highly hydrophobic. The lowest hydrophobicity was observed for the L. coryniformis INV014 strain (83.6%), while the remaining strains obtained a result above 95%. The same percentage of hydrophobicity was achieved by L. paracasei INV001 and L. plantarum A7 strains (98.6%).

3.3. Development of Fermented Beverage Based on Wheat Bakery Waste and Chokeberry Pomace

3.3.1. Development of a Basic Beverage Recipe

The strains tested for their probiotic potential were used to develop a recipe for upcycled fermented beverages based on wheat bakery waste and chokeberry pomace. First, the maximum amount of chokeberry pomace added that would not inhibit the growth of starter cultures was determined (Figure 5). The main idea was to add as much additive as possible to the beverage while maximizing the use the fruit waste without affecting the number of bacteria. During the fermentation dried chokeberries in the amount of 5 g, 7.5 g and 10 g were added to 200 ml of the beverage base, and their effect was observed for 48 h, determining the number of bacteria every 24 h. Due to the method of preparation of the beverages, including the use of sterile bottles and boiling water for soaking the bread, the inoculation base was characterized by high microbiological purity (Tables S1 and S2 in the Supplementary Material). Studies have shown that regardless of the additive introduced, intensive bacterial growth was observed in all samples. However, the population size varied, depending mainly on the LAB strain. In beverages inoculated with L. paracasei INV001, L. plantarum A7, and L. rhamnosus INV002, the cell number reached a level comparable to samples without chokeberry, regardless of the amount of the additive. After 48 h, the bacterial count was above 9 log CFU/mL in beverages inoculated with L. paracasei INV001 and above 8 log CFU/mL in samples inoculated with L. plantarum A7 and L. rhamnosus INV002. In most cases, no significant differences were observed between the individual beverage variants. In turn, greater variation in results was observed in beverages inoculated with L. coryniformis INV014 and L. buchneri P7. While the addition of chokeberry in the range of 5–7.5 g did not significantly affect the growth of these strains, 10 g of dried chokeberry significantly slowed down the growth of both strains. The difference observed between the number of bacteria in the control beverage with L. coryniformis INV014 and the variant with the addition of 10 g of chokeberry exceeded one logarithmic unit. For L. buchneri P7, significant differences were also observed between the variants, although the difference between the cell number in the control beverage with L. buchneri P7 and the variant with 10 g added was approximately 0.25 log units.
Figure 5. Microbiological quality of BWBs with the addition of different amounts of dried chokeberry pomace. Averages with different lowercase letters (a–f) for each LAB strain are significantly different at p ˂ 0.05 based on one-way analysis of variance (ANOVA) using Tukey’s test.

3.3.2. Determination of Total Phenolic Compounds (TPC) and Antioxidant Activity (TEAC) of Fermented Beverages

The final version of fermented beverages was a combination of bioferments prepared with five LAB strains and with 5% addition of chokeberry pomace (10 g/200 mL). The functionality of prepared beverages was determined by assessing the content of polyphenolic compounds and antioxidant properties and by monitoring the number of LAB and pH value (Table 5). The effect of fermentation time and strain on the lactic acid bacteria population was assessed using one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test (p < 0.05). The analysis showed significant differences between groups.
Table 5. Results of determination of LAB count, total phenolic compounds (TPC), and antioxidant activity (TEAC) of fermented beverages.
At 0 h (pre-fermentation samples), the mean values ranged from 5.05 log CFU/mL (INV014) to 6.94 log CFU/mL (P7). Significant differences were observed between beverages inoculated with L. coryniformis INV014 and beverages inoculated with L. paracasei INV001, L. buchneri P7, and L. plantarum A7, with the beverage inoculated with L. coryniformis INV014 showing the lowest value (p < 0.05). After 24 h of fermentation, all samples showed a significant increase in LAB counts compared to their 0-h counterparts (p < 0.05). The means ranged from 5.88 log CFU/mL (INV014) to 9.07 log CFU/mL (INV002). Beverages inoculated with L. paracasei INV001, L. rhamnosus INV002, L. buchneri P7, and L. plantarum A7 formed a homogeneous group with no significant differences between them (p < 0.05).Whereas, for L. coryniformis INV014 beverage consistently the lowest LAB values were observed both before and after fermentation. This suggests strain-specific effects on the process outcome. The pH values of the prepared beverages after 24 h of fermentation were 2.54–2.75, significantly lower than the initial values, indicating that the fermentation process was proceeding correctly. It is worth mentioning that the relatively low pH values at 0 h of fermentation (in the range of 3.31–3.45) result from the strong acidification of the beverage base after the addition of chokeberry pomace (Table S2 in Supplementary Material).
The data in Table 5 indicate that the initial content of polyphenolic compounds in the beverages as well as antioxidant activity results differ after inoculation with the selected strains. Both tested values varied significantly depending on the microbial strain used and the fermentation time. Statistical analysis revealed significant differences between strains at both time points, as indicated by differing letter annotations.
The highest content of phenolic compounds at 0 h of fermentation was observed in the L. coryniformis INV014 and L. buchneri P7 beverages, with a value of 462.47 mg GAE/L and 424.52 mg GAE/L, respectively. It is worth noting that the highest TPC value in the beverage inoculated with strain L. coryniformis INV014 significantly exceeded all other beverages. Beverages with strains L. paracasei INV001, L. plantarum A7, and L. buchneri P7 showed intermediate but significantly different values. The least amount of phenolic compounds, before fermentation, was shown in the L. rhamnosus INV002 beverage.
Fermentation led to an increase or decrease in the content of phenolic compounds in the beverages tested. The greatest increase in the total content of phenolic compounds was observed for L. rhamnosus INV002 beverage (18.21% reaching 356.46 mg GAE/L), which was a value significantly higher than all other beverages. A similar trend was observed in the L. coryniformis INV014 beverage, where the process led to a 9.67% increase in TPC, reaching a value of 507.17 mg GAE/L. It is worth noting that this was the beverage with the highest total content of phenolic compounds. In the other beverages, the fermentation process led to a decrease in the concentration of phenolic compounds. The largest decrease in TPC (8.14%) was observed in the beverage inoculated with L. plantarum A7, reaching a value of 317.30 mg GAE/l, which was also the lowest result obtained after the fermentation process.
The antioxidant activity results presented in Table 5 indicate that after the fermentation process, similar trends of decrease or increase in antioxidant activity were observed as in the case of the TPC; however, the dynamics of these changes were different. The highest antioxidant activity before the fermentation process was demonstrated for the beverage inoculated with L. buchneri P7, with a value of 0.463 µM Trolox/mL, and the lowest for the beverage inoculated with L. rhamnosus INV002, with a value of 0.315 µM Trolox/mL. At 0 h, beverages inoculated with strains L. paracasei INV001, L. buchneri P7, and L. coryniformis INV014 exhibited comparably high antioxidant activity. For the beverage inoculated with strain L. plantarum A7 no significant differences were observed comparing with the highest-performing beverages or L. rhamnosus INV002 beverage.
After 24 h of fermentation, a change in antioxidant activity was observed in all samples L. coryniformis INV014 beverage showed the highest increase in antioxidant activity (19.87%), reaching a value of 0.537 µM Trolox/mL, significantly exceeding all other strains. In the beverage inoculated with L. rhamnosus INV002, the increase was slightly lower (14.13%), reaching a value of 0.368 µM Trolox/mL. In turn, in the other samples, a decrease in antioxidant activity was observed. The greatest decrease was observed in the beverage inoculated with L. buchneri P7 (18.36%), where the result of antioxidant activity was 0.463 µM Trolox/mL after 24 h of fermentation. It is worth noting that the value of antioxidant activity did not differ significantly in the beverages inoculated with strains L. paracasei INV001 and L. buchneri P7 as well as inoculated with strains L. rhamnosus INV002 and L. plantarum A7.
A strong positive correlation was observed between the total phenolic compounds (TPC) and antioxidant activity (TEAC). When all samples were analyzed across, the relationship was highly significant (p < 0.01) (Table S3). These findings indicate that a higher phenolic content is consistently associated with greater antioxidant capacity.

4. Discussion

The agricultural and food industries generate significant amounts of waste, which, due to their diverse nutritional and biologically active components, can be transformed into products with high utility value [52]. The growing interest in reusing food waste in recent years has led to proposals for innovative food products, pharmaceuticals, and biomaterials [53]. At the same time, consumers are increasingly interested in healthy eating and are looking for innovative functional food products that provide significant nutritional value and health benefits [54]. In response to consumer expectations and the challenges facing the food production sector, the trend of upcycling is becoming increasingly common in waste management and waste prevention. The beverages designed in this paper are examples of upcycling, as they utilize plant-based waste and, on the other hand, utilize potentially probiotic strains of lactic acid bacteria and the fermentation process, offering consumers a product of higher quality than the raw material used. It is also worth emphasizing that the beverages designed are in line with current trends in the development of dairy-free fermented products, meeting the needs of individuals suffering from allergies or intolerances to milk components. Plant-based fermented beverages are also gaining popularity among vegans, as health-conscious consumers seek plant-based, sustainable, and gut-friendly alternatives to traditional beverages while avoiding animal-derived ingredients [55]. It is worth noting that the global vegan food market grew from USD 14.44 billion in 2020 to USD 15.77 billion in 2021 and is expected to continue growing for the next few years [56]. This trend is particularly noticeable among young consumers, who demand alternative, healthier eating practices than previous generations [57]. The number of people adopting veganism worldwide is steadily increasing, putting veganism at the forefront of demand for healthy eating [58].
It is worth noting that bakery waste are rarely used as a raw material for fermentation [32,59], although bread waste is a growing problem in many developed countries. Our previous research has shown that bread waste can be a base for obtaining fermented beverages characterized by a high number of lactic acid bacteria and antibacterial properties against microorganisms such as E. coli, P. fluorescens, and S. saprophyticus [32]. Sigüenza-Andrés et al. [59] developed eight probiotic plant-based beverages from discarded bread flour using a monoculture of L rhamnosus or a coculture of lactic acid bacteria and Bifidobacterium strains. Depending on the variant and process used, the resulting products varied in terms of the amount of organic acids and individual volatile compounds responsible for the aroma of fermented beverages. The beverage produced using mixed culture gained consumer recognition in a sensory test. In turn, Nguyen et al. [60] investigated the potential for biovalorization of surplus bread on the market to develop probiotic fermented beverages using the probiotics L. rhamnosus GG (LGG) and S cerevisiae CNCM I-3856, both individually and in combination. They noted that proper formulation and dry matter content were important, as a 5% initial dry matter content resulted in better probiotic growth and higher cell counts compared to higher concentrations of bread, which resulted in excessive stickiness and poor texture.
The fermentation of fruit pomace or juice is reported much more often [61,62]. The combination of bread and fruit waste in the beverages designed in this work made it possible, on the one hand, to provide nutrients such as proteins, carbohydrates, vitamins, and minerals from bread and also to enrich the product with polyphenolic compounds originated from fruit waste. According to literature data, the use of chokeberry waste in fermented beverages also concerns the fermentation of juice rather than pomace, and studies on black chokeberry juice fermented by lactic acid bacteria are still scarce. Some authors, such as Zamfir et al. [63], similarly to this work, used a combination of cereal raw material with the addition of a raw material rich in polyphenolic compounds, in this case red beetroot or carrot. The additive affected the biological activity of the resulting beverages.
The main component increasing the value of the products are selected lactic acid strains, which were chosen based on their fermentation abilities and then extensively tested to determine their probiotic properties. Interest in probiotics is constantly growing, as evidenced by the rapidly growing probiotic market. According to a report published by Grand View Research, it is expected to grow at a compound annual growth rate (CAGR) of 14.0% from 2023 to 2030 (GVR) [64]. They are used, among other things, as dietary supplements and food ingredients, encompassing an increasingly wide range of both dairy and non-dairy products including traditional and newly developed probiotic products. Studies have shown that the choice of strain is very important not only due to its probiotic properties, but also due to the changes it introduces in the food matrix. Authors often describe changes in the content of biologically active compounds such as polyphenols and biological properties, including antioxidant activity. In this work, both an increase and a decrease in total polyphenol content and antioxidant activity were observed. Moreover, both strain and fermentation time markedly influence the polyphenolic content and antioxidant capacity of the beverage. In particular, the beverage from the L. coryniformis INV014 strain showed consistently higher polyphenolic content and antioxidant activity, making it a promising candidate for applications where such properties are desired. However, in some beverages, a decrease in both the amount of polyphenols and antioxidant activity was noted. Literature data generally emphasize that the fermentation process causes an increase in the content of polyphenolic compounds. Zamfir et al. [63] prepared beverages with three selected strains (L. plantarum BR9, L. plantarum P35, and La. acidophilus IBB801) in different combinations and observed an increase in the content of polyphenolic compounds and antioxidant properties during fermentation in all beverages, reaching significantly higher values after 24 h compared to the unfermented substrates. Wang et al. [65] investigated the influence of lactic acid bacteria on the phenolic profile, antioxidant activities, and volatiles of black chokeberry juice fermented with L. plantarum, La. acidophilus, and L. rhamnosus. In all fermented samples, an increase in the total phenolic and total flavonoid contents were observed with La. acidophilus demonstrated the highest contents of these compounds. Also, an increase in the reducing power capacity was noted. Similarly to our work, some authors also observed a decrease in the phenolic content. Szutowska et al. [66] described fermented green kale juice, emphasizing that the product’s properties depended on the starter cultures used. Significant differences were observed between the prepared fermented juice variants in the content of phenolic compounds, vitamins, carotenoids, and antibacterial activity. Juice inoculated with the L. plantarum strain showed the lowest loss of total phenolic compounds, while L. sakei reduced their content the most. The authors also noted a decrease in carotenoid content after juice fermentation in all cultures, with the greatest losses observed in juices inoculated with L. plantarum and the MIX B culture (L. plantarum and L. sakei). Harbaum et al. [67] also observed a decrease in the content of flavonoids and some hydroxycinnamic acids during the fermentation process of two pak choi cultivars and two Chinese mustard cultivars. The authors suggested that this may be due to degradation or structural changes. Markkinen et al. [68], tested the impact of L. plantarum fermentation on acids, sugars, and phenolic compounds, among others, in black chokeberry juices prepared with and without pectinolytic enzyme treatment. The authors determined that L. plantarum fermentation led to the reduction in flavanols’ content by 9–14%, as well as hydroxycinnamic acids by 20–24% in the Aronia mitschurinii ‘Viking’ juices. On the other hand, anthocyanins level remained unaffected after the malolactic fermentation. The authors suggested that hydrolysis of both chlorogenic acid and neochlorogenic acid leads to the formation of quinic acid and caffeic acid. Furthermore, L. plantarum fermentation of bog bilberry juice performed by Wei et al. [69] also led to the decrease in anthocyanins, phenolic acids, flavanols and flavanol values. These studies are in accordance with the results presented in this manuscript as the TPC value for the L. plantarum fermented beverages decreased by 9%, for the L. paracasei beverages by 5% but increased for the rest of the tested microorganisms. The impact on the bioactive compounds amount is undeniably related to the microbial strain used for the fermentation. Literature data report that β-glucosidase released by L. plantarum during the fermentation process may cleave anthocyanins into anthocyanidins and sugar moieties [70]. Lactic acid fermentation results in changes in the initial bioactive compounds’ variety and amount due to the different mechanisms. The composition of fruit juices subjected to lactic acid fermentation is related to phenolic acid reductases playing crucial role in quality modulation via reductive modification [71]. Ricci et al. [72] proved that during L. casei, L. paracasei, L. plantarum and L. rhamnosus cherry juice fermentation, these enzymes catalyzed the biotransformation of phenolics. Metabolization of caffeic acid to dihydrocaffeic acid and converting p-coumaric acid into 4-ethylphenol were observed. Interestingly L. plantarum 285 completely degraded caffeic acid and totally metabolized p-coumaric and protocatechuic acids. Furthermore, all of the tested LAB strains produced phenyllactic acid and p-hydroxyphenyllactic acid. Lactic acid fermentation metabolites result in changes in the final products’ color, aromatic characteristics as well as improve its stability through redox equilibrium regulation [71,72]. Nevertheless, non-phenolic antioxidants as for example ascorbic acid or copper, occurring in the product, also may have contribution to the ABTS radical-scavenging capacity [73,74].
In addition to functional properties, consumer safety is undoubtedly an important criterion for microorganisms used in food production. The bacterial species selected in this study are included on the QPS list [75], but the safety of strains used in food products is increasingly being emphasized, and antibiotic susceptibility is a significant trait among the tested traits. Intrinsic antibiotic resistance can be considered a beneficial trait of probiotic bacteria when used during antibiotic therapy. However, attention is drawn to acquired resistance, which is associated with the risk of this trait spreading within the gastrointestinal microbiome and the environment. Lactic acid bacteria used in the food industry may possess intrinsic resistance to antibiotics but should not possess potentially mobile antibiotic resistance genes [76]. Literature data indicate that LAB exhibit intrinsic resistance to aminoglycosides (gentamicin, kanamycin, neomycin, and streptomycin), vancomycin, ciprofloxacin, and trimethoprim, and are generally susceptible to β-lactams (penicillin and ampicillin) as well as protein synthesis inhibitors (tetracycline, erythromycin, chloramphenicol, and linezolid) [77,78,79]. However, studies indicate that acquired resistance to tetracycline, erythromycin, clindamycin, and chloramphenicol is also observed in lactic acid bacteria isolated from fermented foods [80,81], and transfer of resistance from lactobacilli to other organisms is possible [82,83]. In studies of bacterial susceptibility to antibiotics, both phenotypic and genomic assessments are recommended. However, phenotypes are not always reflected in the genomic program of the tested LAB. Sometimes, the presence of a resistance gene for a given antibiotic does not coincide with the phenotype, because other mechanisms, such as efflux or cell surface impermeability, may be involved in resistance [84,85], and sometimes this may result from disturbances in the expression of resistance genes [79]. Current quality control standards for probiotics do not require the inclusion of acquired or transferred antibiotic resistance determinants in their assessment. However, some authors point out the need to consider regulatory changes in the future [85,86].

5. Conclusions

Appropriate food waste management, as well as the implementation of circular economy elements into manufacturing processes, are essential components of sustainable production and consumption. This study involved research aimed at developing a prototype of an innovative, fermented beverage based on food industry waste (wheat-rye bread waste and chokeberry pomace) with potential probiotic properties. It can therefore be concluded that the adopted concept aligns with current sustainable production trends (circular economy, natural processing processes), environmental (reduction and reuse of waste), and social (consumption of products with health-promoting potential). Five selected strains of lactic acid bacteria (LAB) were used to develop the final beverage prototypes. These strains demonstrated the greatest potential for fermenting bread waste and maintained their height growth rate in the presence of chokeberry pomace. All LAB strains were characterized according to FAO/WHO guidelines, confirming their probiotic potential. Nevertheless, no in vivo studies were conducted; therefore, probiotic status of selected LAB strains remains to be confirmed. The addition of chokeberry pomace enriched the beverages with polyphenolic compounds, thus contributing to an increase in their antioxidant activity. However, it should be emphasized that, depending on the strain used, the TPC content and antioxidant properties changed during the 24-h fermentation period. These observations confirm the strain-dependent nature of selected LAB properties and the need for appropriate selection of bacterial cultures for fermentation to achieve products with the desired quality characteristics.
In summary, carefully selected LAB strains should be considered as an interesting element of sustainable food industry waste processing, aimed at obtaining functional, sustainable products. The conclusions from this study can therefore provide a valuable source of information for developing sustainable product strategies, thus incorporating them into the overall food waste management system.
For future investigation plans, despite the conducted tests confirming the probiotic potential of selected LAB strains, their probiotic status needs to be confirmed by in vivo studies. Furthermore, the studies represent a proof of concept of innovative plant-based fermented beverages at the laboratory scale. Consumer acceptance, including sensory evaluation and toxicological validation, of the products has to be assessed before the mass-scale production and consumption stages.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/su17188502/s1, Table S1: Microbiological quality and pH value of the bread waste soaked in boiling water after 24 h, Table S2: Microbiological quality and pH value of the bread-waste beverages with chokeberry pomace without LAB inoculation, Figure S1: Low pH tolerance of strain INV001, Figure S2. Low pH tolerance of strain INV002, Figure S3. Low pH tolerance of strain P7, Figure S4. Low pH tolerance of strain A7, Figure S5. Low pH tolerance of strain INV014, Figure S6. Bile salts tolerance of strain INV001, Figure S7. Bile salts tolerance of strain INV002, Figure S8. Bile salts tolerance of strain P7, Figure S9. Bile salts tolerance of strain A7, Figure S10. Bile salts tolerance of strain INV014, and Table S3. Pearson’s and Spearman’s correlations between TPC and TEAC (all samples, 0 h + 24 h).

Author Contributions

Conceptualization, D.G., K.J. and K.M.; methodology, D.G., K.J. and K.M.; validation, W.S., K.J., P.G., A.O. and M.A.; formal analysis, D.G., W.S., K.J., P.G., A.O., K.M. and M.A.; investigation, W.S., P.G., A.O. and M.A.; resources, D.G., K.J. and K.M.; data curation, W.S., P.G., A.O. and M.A.; writing—original draft preparation, D.G., W.S. and K.J.; writing—review and editing, D.G., W.S. and K.J.; visualization, W.S. and K.J.; supervision, D.G., W.S., K.J. and K.M.; project administration, D.G., K.J. and W.S.; funding acquisition, D.G., K.J. and K.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Polish Ministry of Science and Higher Education (MNiSW) “Student Scientific Association Create Innovations” program, project number SKN/SP/569408/2023.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in this article and in the Supplementary Material.

Acknowledgments

We would like to express our sincere gratitude to the certified organic (PL-EKO-09) and biodynamic plantation Aronia Organic Farm Jóźwiak (Koło, Wielkopolska Province, Poland) for providing research material—Aronia melanocarpa var. Nero berries, under the framework cooperation agreement with the Poznań University of Economics and Business.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
BWBBread-waste beverages
LABLactic acid bacteria
CPChokeberry pomace
WHOWorld Health Organization
FAOFood and Agriculture Organization
TPCTotal phenolic compounds
MALDI-TOF MSMatrix-assisted laser desorption/ionization time-of-flight mass spectrometry
EFSAEuropean Food Safety Authority
GAEGallic acid equivalent
CFUColony forming unit

References

  1. Al-Obadi, M.; Ayad, H.; Pokharel, S.; Ayari, M.A. Perspectives on Food Waste Management: Prevention and Social Innovations. Sustain. Prod. Consum. 2022, 31, 190–208. [Google Scholar] [CrossRef] [Scilit]
  2. Manzoor, S.; Fayaz, U.; Dar, A.H.; Dash, K.K.; Shams, R.; Bashir, I.; Pandey, V.K.; Abdi, G. Sustainable Development Goals through Reducing Food Loss and Food Waste: A Comprehensive Review. Future Foods 2024, 9, 100362. [Google Scholar] [CrossRef] [Scilit]
  3. Food Agriculture Organization of the United Nations. Food Wastage Footprint: Impacts on Natural Resources: Summary Report; FAO: Rome, Italy, 2013; Available online: https://www.fao.org/4/i3347e/i3347e.pdf (accessed on 9 September 2025).
  4. Meacham, T.; Parfitt, J.; Hollins, O.; Barthel, M. Food Waste Within Global Food System—September 2013. Available online: https://www.semanticscholar.org/paper/Food-waste-within-global-food-systems-September-Meacham-Parfitt/6c91c4a4bd7b73d2e51344f5fa8117532f80ceec (accessed on 8 September 2025).
  5. Food and Agriculture Organization of the United Nations. The State of Food and Agriculture 2019: Moving Forward on Food Loss and Waste Reduction; FAO: Rome, Italy, 2019. [Google Scholar]
  6. Faishal, A. Laws and Regulations Regarding Food Waste Management as a Function of Environmental Protection in a Developing Nation. Int. J. Crim. Justice Sci. 2022, 17, 223–237. [Google Scholar]
  7. Food and Agriculture Organization (FAO). Global Food Losses and Food Waste-Extent, Causes and Prevention; FAO: Rome, Italy, 2011; Available online: https://www.fao.org/3/i2697e/i2697e.pdf (accessed on 9 September 2025).
  8. Gustavsson, J.; Bos-Brouwers, H.; Timmermans, T.; Møller, H.; Anderson, G.; Clementine, O.; Soethoudt, H.; Quested, T.; Easteal, S.; Gustavsson, J.; et al. FUSIONS Definitional Framework for Food Waste-Full Report. Project Report FUSIONS. HAL Id: Hal-02800861. 2014. Available online: https://hal.inrae.fr/hal-02800861 (accessed on 9 September 2025).
  9. Jeswani, H.K.; Figueroa-Torres, G.; Azapagic, A. The extent of food waste generation in the UK and its environmental impacts. Sustain. Prod. Consum. 2021, 26, 532–547. [Google Scholar] [CrossRef] [Scilit]
  10. United Nations Environment Programme (UNEP). Food Waste Index Report 2021. Nairobi. 2021. Available online: https://www.unep.org/resources/report/unep-food-waste-index-report-2021 (accessed on 9 September 2025).
  11. United Nations. The 2030 Agenda for Sustainable Development. Sustainable Development Goals. 2022. Available online: https://sdgs.un.org/goals/goal12 (accessed on 9 September 2025).
  12. Du, C.; Abdullah, J.J.; Greetham, D.; Fu, D.; Yu, M.; Ren, L.; Li, S.; Lu, D. Valorization of Food Waste into Biofertiliser and Its Field Application. J. Clean. Prod. 2018, 187, 273–284. [Google Scholar] [CrossRef] [Scilit]
  13. Bigdeloo, M.; Teymourian, T.; Kowsari, E.; Ramakrishna, S.; Ehsani, A. Sustainability and Circular Economy of Food Wastes: Waste Reduction Strategies, Higher Recycling Methods, and Improved Valorization. Mater. Circ. Econ. 2021, 3, 3. [Google Scholar] [CrossRef] [Scilit]
  14. Czerniewicz, K.; Marchwińska, K.; Gwiazdowska, D.; Juś, K.; Olejniczak, A. Fruit and Vegetable Waste Management: Reusing and Recycling Strategies; Sieć Badawcza Łukasiewicz—Instytut Technologii Eksploatacji: Radom, Poland, 2024. [Google Scholar]
  15. Mokrane, S.; Buonocore, E.; Capone, R.; Franzese, P.P. Exploring the Global Scientific Literature on Food Waste and Loss. Sustainability 2023, 15, 4757. [Google Scholar] [CrossRef] [Scilit]
  16. Food and Agriculture Organization (FAO). Food Wastage Footprint: Full Cost-Accounting: Final Report; FAO: Rome, Italy, 2014. [Google Scholar]
  17. Moshtaghian, H.; Bolton, K.; Rousta, K. Challenges for Upcycled Foods: Definition, Inclusion in the Food Waste Management Hierarchy and Public Acceptability. Foods 2021, 10, 2874. [Google Scholar] [CrossRef] [Scilit]
  18. Spratt, O.; Suri, R.; Deutsch, J. Defining Upcycled Food Products. J. Culin. Sci. Technol. 2020, 19, 485–496. [Google Scholar] [CrossRef] [Scilit]
  19. Galila, A.; Kaseireldeil, S.; Abdalkhaliq, N.; Farouk, E.; Eichner, M.; Sarhan, Y. Enhancing Sustainability and Resource Efficiency through Upcycling: A Comprehensive Review and Analytical—Based Framework for Evaluating Building Upcycled Products. Innov. Infrastruct. Solut. 2024, 9, 270. [Google Scholar] [CrossRef] [Scilit]
  20. Vaikma, H.; Kaleda, A.; Rosend, J.; Rosenvald, S. Market Mapping of Plant-Based Milk Alternatives by Using Sensory (RATA) and GC Analysis. Future Foods 2021, 4, 100049. [Google Scholar] [CrossRef] [Scilit]
  21. Boukid, F.; Hassoun, A.; Zouari, A.; Tülbek, M.; Mefleh, M.; Aït-Kaddour, A.; Castellari, M. Fermentation for Designing Innovative Plant-Based Meat and Dairy Alternatives. Foods 2023, 12, 1005. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Research and Markets Fermented Plant-Based Alternatives Market—A Global and Regional Analysis: Focus on Applications, Products, Patent Analysis, and Country Analysis-Analysis and Forecast, 2019–2026. Available online: https://www.researchandmarkets.com/reports/5359984/fermented-plant-based-alternatives-market-a?utm_source=BW&utm_medium=PressRelease&utm_code=hg8tq8&utm_campaign=1570637+-+Global+Fermented+Plant-Based+Alternatives+Market+to+2026+-+Investment+in+Fermented+Plant-Based+Yogurt+Presents+Opportunities&utm_exec=jamu273prd (accessed on 9 September 2025).
  23. Xie, A.; Dong, Y.; Liu, Z.; Li, Z.; Shao, J.; Li, M.; Yue, X. A Review of Plant-Based Drinks Addressing Nutrients, Flavor, and Processing Technologies. Foods 2023, 12, 3952. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Hidalgo-Fuentes, B.; De Jesús-José, E.; Cabrera-Hidalgo, A.D.J.; Sandoval-Castilla, O.; Espinosa-Solares, T.; González-Reza Ricardo, M.; Zambrano-Zaragoza, M.L.; Liceaga, A.M.; Aguilar-Toalá, J.E. Plant-Based Fermented Beverages: Nutritional Composition, Sensory Properties, and Health Benefits. Foods 2024, 13, 844. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Horlacher, N.; Oey, I.; Agyei, D. Learning from Tradition: Health-Promoting Potential of Traditional Lactic Acid Fermentation to Drive Innovation in Fermented Plant-Based Dairy Alternatives. Fermentation 2023, 9, 452. [Google Scholar] [CrossRef] [Scilit]
  26. Liu, H.; Xu, X.; Cui, H.; Xu, J.; Yuan, Z.; Liu, J.; Li, C.; Li, J.; Zhu, D. Plant-Based Fermented Beverages and Key Emerging Processing Technologies. Food Rev. Int. 2023, 39, 5844–5863. [Google Scholar] [CrossRef] [Scilit]
  27. Dymchenko, A.; Geršl, M.; Gregor, T. Trends in Bread Waste Utilisation. Trends Food Sci. Technol. 2023, 132, 93–102. [Google Scholar] [CrossRef] [Scilit]
  28. Mihajlovski, K.; Rajilić-Stojanović, M.; Dimitrijević-Branković, S. Enzymatic Hydrolysis of Waste Bread by Newly Isolated Hymenobacter sp. CKS3: Statistical Optimization and Bioethanol Production. Renew. Energy 2020, 152, 627–633. [Google Scholar] [CrossRef] [Scilit]
  29. Denev, P.; Číž, M.; Kratchanova, M.; Blazheva, D. Black Chokeberry (Aronia melanocarpa) Polyphenols Reveal Different Antioxidant, Antimicrobial and Neutrophil-Modulating Activities. Food Chem. 2019, 284, 108–117. [Google Scholar] [CrossRef] [Scilit]
  30. Sidor, A.; Gramza-Michałowska, A. Black Chokeberry Aronia melanocarpa L.—A Qualitative Composition, Phenolic Profile and Antioxidant Potential. Molecules 2019, 24, 3710. [Google Scholar] [CrossRef] [Scilit]
  31. Tolić, M.-T.; Jurčević, I.L.; Krbavčić, I.P.; Marković, K.; Vahčić, N. Phenolic Content, Antioxidant Capacity and Quality of Chokeberry (Aronia melanocarpa) Products. Food Technol. Biotechnol. 2015, 53, 171–179. [Google Scholar] [CrossRef] [PubMed]
  32. Juś, K.; Ścigaj, M.; Gwiazdowska, D.; Marchwińska, K.; Studenna, W. Innovative Fermented Beverages Based on Bread Waste—Fermentation Parameters and Antibacterial Properties. Appl. Sci. 2024, 14, 5036. [Google Scholar] [CrossRef] [Scilit]
  33. Sauget, M.; Valot, B.; Bertrand, X.; Hocquet, D. Can MALDI-TOF Mass Spectrometry Reasonably Type Bacteria? Trends Microbiol. 2017, 25, 447–455. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Imade, E.E.; Omonigho, S.E.; Babalola, O.O.; Enagbonma, B.J.; Igiehon, O.N.; Ogofure, A.G. Dataset of 16S Ribosomal DNA Sequence-Based Identification of Bacteriocinogenic Lactic Acid Bacteria Isolated from Fermented Food Samples. Data Brief 2024, 52, 110021. [Google Scholar] [CrossRef] [Scilit]
  35. Older, C.E.; Richardson, B.M.; Wood, M.; Waldbieser, G.C.; Ware, C.; Griffin, M.J.; Ott, B.D. Evaluating Nanopore Sequencing for Microbial Community Characterization in Catfish Pond Water. J. World Aquac. Soc. 2024, 55, 289–301. [Google Scholar] [CrossRef] [Scilit]
  36. EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP). Guidance on the Assessment of Bacterial Susceptibility to Antimicrobials of Human and Veterinary Importance. EFS2 2012, 10, 2740. [Google Scholar] [CrossRef] [Scilit]
  37. Marchwińska, K.; Gwiazdowska, D. Isolation and Probiotic Potential of Lactic Acid Bacteria from Swine Feces for Feed Additive Composition. Arch. Microbiol. 2022, 204, 61. [Google Scholar] [CrossRef] [Scilit]
  38. Taheri, H.; Tabandeh, F.; Moravej, H.; Zaghari, M.; Shivazad, M.; Shariati, P. Potential Probiotic of Lactobacillus johnsonii LT171 for Chicken Nutrition. Afr. J. Biotechnol. 2009, 8, 5833–5837. [Google Scholar] [CrossRef] [Scilit]
  39. Prasath, K.G.; Tharani, H.; Kumar, M.S.; Pandian, S.K. Palmitic Acid Inhibits the Virulence Factors of Candida tropicalis: Biofilms, Cell Surface Hydrophobicity, Ergosterol Biosynthesis, and Enzymatic Activity. Front. Microbiol. 2020, 11, 864. [Google Scholar] [CrossRef] [Scilit]
  40. Włodarska, K.; Pawlak-Lemańska, K.; Górecki, T.; Sikorska, E. Classification of Commercial Apple Juices Based on Multivariate Analysis of Their Chemical Profiles. Int. J. Food Prop. 2017, 20, 1773–1785. [Google Scholar] [CrossRef] [Scilit]
  41. Gliszczyńska-Świgło, A. Antioxidant Activity of Water Soluble Vitamins in the TEAC (Trolox Equivalent Antioxidant Capacity) and the FRAP (Ferric Reducing Antioxidant Power) Assays. Food Chem. 2006, 96, 131–136. [Google Scholar] [CrossRef] [Scilit]
  42. FAO/WHO Working Group Report on Drafting Guidelines for the Evaluation of Probiotics in Food. 2002. Available online: https://isappscience.org/wp-content/uploads/2019/04/probiotic_guidelines.pdf (accessed on 9 September 2025).
  43. Felsenstein, J. Confidence Limits on Phylogenies: An Approach Using the Bootstrap. Evolution 1985, 39, 783–791. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Saitou, N.; Imanishi, T. Relative Efficiencies of the Fitch-Margoliash, Maximum-Parsimony, Maximum-Likelihood, Minimum-Evolution, and Neighbor-Joining Methods of Phylogenetic Tree Construction in Obtaining the Correct Tree. Mol. Biol. Evol. 1989, 6, 514. [Google Scholar] [CrossRef] [Scilit]
  45. Tamura, K.; Nei, M.; Kumar, S. Prospects for Inferring Very Large Phylogenies by Using the Neighbor-Joining Method. Proc. Natl. Acad. Sci. USA 2004, 101, 11030–11035. [Google Scholar] [CrossRef] [Scilit]
  46. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit]
  47. EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP); Rychen, G.; Aquilina, G.; Azimonti, G.; Bampidis, V.; de Lourdes Bastos, M.; Bories, G.; Chesson, A.; Cocconcelli, P.S.; Flachowsky, G.; et al. Guidance on the Characterisation of Microorganisms Used as Feed Additives or as Production Organisms. EFS2 2018, 16, e05206. [Google Scholar] [CrossRef] [Scilit]
  48. Jabeen, S.; Hasan, A.; Rizwan, M.; Javed, H.; Raza, M.A.; Ahmad, S.; Hussain, A. Determining Acid-Bile Optimization and Correlation between Optical Density and the Colony Forming Units of Lactobacilli Species: Optimizing Acid-Bile Tolerance of Lactobacilli. FBT 2024, 4, 58–63. [Google Scholar] [CrossRef] [Scilit]
  49. Gbassi, G.K.; Vandamme, T.; Yolou, F.S.; Marchioni, E. In Vitro Effects of pH, Bile Salts and Enzymes on the Release and Viability of Encapsulated Lactobacillus plantarum Strains in a Gastrointestinal Tract Model. Int. Dairy J. 2011, 21, 97–102. [Google Scholar] [CrossRef] [Scilit]
  50. Farid, W.; Masud, T.; Sohail, A.; Ahmad, N.; Naqvi, S.M.S.; Khan, S.; Ali, A.; Khalifa, S.A.; Hussain, A.; Ali, S.; et al. Gastrointestinal Transit Tolerance, Cell Surface Hydrophobicity, and Functional Attributes of Lactobacillus acidophilus Strains Isolated from Indigenous Dahi. Food Sci. Nutr. 2021, 9, 5092–5102. [Google Scholar] [CrossRef] [Scilit]
  51. Tyfa, A.; Kunicka-Styczyńska, A.; Zabielska, J. Evaluation of Hydrophobicity and Quantitative Analysis of Biofilm Formation by Alicyclobacillus sp. Acta Biochim. Pol. 2015, 62, 785–790. [Google Scholar] [CrossRef] [Scilit]
  52. Kim, S.; Ishizawa, H.; Inoue, D.; Toyama, T.; Yu, J.; Mori, K.; Ike, M.; Lee, T. Microalgal Transformation of Food Processing Byproducts into Functional Food Ingredients. Bioresour. Technol. 2022, 344 Pt B, 126324. [Google Scholar] [CrossRef] [Scilit]
  53. Engelberth, A.S. Evaluating Economic Potential of Food Waste Valorization: Onward to a Diverse Feedstock Biorefinery. Curr. Opin. Green. Sustain. Chem. 2020, 26, 100385. [Google Scholar] [CrossRef] [Scilit]
  54. Pathan, A.S.; Ahire, M.R.; Diwane, S.A.; Jain, P.G.; Pandagale, P.M.; Ahire, E.D. Functional Foods in Prevention of Diabetes Mellitus. In Applications of Functional Foods in Disease Prevention; Apple Academic Press: Waretown, NJ, USA, 2024; pp. 139–164. [Google Scholar] [CrossRef] [Scilit]
  55. The Vegan Society. Definition of Veganism; The Vegan Society: Birmingham, UK, 2019; Available online: https://www.vegansociety.com/go-vegan/definition-veganism (accessed on 9 September 2025).
  56. Sentient Media. Increase in Veganism: Why Is Veganism on the Rise in 2021? Sentient Media: San Francisco, CA, USA, 2024; Available online: https://sentientmedia.org/increase-in-veganism (accessed on 9 September 2025).
  57. Maarsman, P. A Quantitative Study to the Underlying Motives for Food Choices: And How Do These Motives Contribute to Healthy Food Choices Among Dutch Young Adults? Master’s Thesis, University of Twente, Enschede, The Netherlands, 2016. Available online: https://www.researchgate.net/publication/378213169_Underlying_Motivations_for_Food_Choices_and_Their_Influence_on_Healthy_Eating_among_Millennials (accessed on 19 September 2024).
  58. Food Revolution Network. Why the Global Rise in Vegan and Plant-Based Eating Isn’t A Fad (600% Increase in U.S. Vegans + Other Astounding Stats). 2022. Available online: https://foodrevolution.org/blog/vegan-statistics-global/ (accessed on 9 September 2025).
  59. Sigüenza-Andrés, T.; Mateo, J.; Rodríguez-Nogales, J.M.; Gómez, M.; Caro, I. Characterization of a Fermented Beverage from Discarded Bread Flour Using Two Commercial Probiotics Starters. Foods 2024, 13, 951. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. Nguyen, T.-L.; Toh, M.; Lu, Y.; Ku, S.; Liu, S.-Q. Biovalorization of Market Surplus Bread for Development of Probiotic-Fermented Potential Functional Beverages. Foods 2022, 11, 250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. Barakat, N.; Bouajila, J.; Beaufort, S.; Rizk, Z.; Taillandier, P.; El Rayess, Y. Development of a New Kombucha from Grape Pomace: The Impact of Fermentation Conditions on Composition and Biological Activities. Beverages 2024, 10, 29. [Google Scholar] [CrossRef] [Scilit]
  62. Wu, Y.; Chen, R.; Liu, M.; Fang, Y.; Wu, J.; Chen, J.; Yang, X.; Fang, Z.; Fang, X.; Dong, S. The Effects of Lactobacillus Fermentation on the Quality Changes and Flavor Characteristics of Aronia melanocarpa Juice Using Physicochemical Analysis and Electronic Nose Techniques. Food Innov. Adv. 2025, 4, 99–107. [Google Scholar] [CrossRef] [Scilit]
  63. Zamfir, M.; Angelescu, I.-R.; Voaides, C.; Cornea, C.-P.; Boiu-Sicuia, O.; Grosu-Tudor, S.-S. Non-Dairy Fermented Beverages Produced with Functional Lactic Acid Bacteria. Microorganisms 2022, 10, 2314. [Google Scholar] [CrossRef] [Scilit]
  64. Grand View Research. Probiotics Market Size & Share|Industry Research Report, 2019–2025. Available online: https://www.grandviewresearch.com/industry-analysis/probiotics-market (accessed on 8 September 2025).
  65. Wang, J.; Wei, B.; Xu, J.; Jiang, H.; Xu, Y.; Wang, C. Influence of Lactic Acid Fermentation on the Phenolic Profile, Antioxidant Activities, and Volatile Compounds of Black Chokeberry (Aronia melanocarpa) Juice. J. Food Sci. 2024, 89, 834–850. [Google Scholar] [CrossRef] [Scilit]
  66. Szutowska, J.; Gwiazdowska, D.; Rybicka, I.; Pawlak-Lemańska, K.; Biegańska-Marecik, R.; Gliszczyńska-Świgło, A. Controlled Fermentation of Curly Kale Juice with the Use of Autochthonous Starter Cultures. Food Res. Int. 2021, 149, 110674. [Google Scholar] [CrossRef] [Scilit]
  67. Harbaum, B.; Hubbermann, E.M.; Zhu, Z.; Schwarz, K. Free and Bound Phenolic Compounds in Leaves of Pak Choi (Brassica campestris L. ssp. chinensis var. communis) and Chinese Leaf Mustard (Brassica juncea Coss). Food Chem. 2008, 110, 838–846. [Google Scholar] [CrossRef] [Scilit]
  68. Markkinen, N.; Laaksonen, O.; Nahku, R.; Kuldjärv, R.; Yang, B. Impact of Lactic Acid Fermentation on Acids, Sugars, and Phenolic Compounds in Black Chokeberry and Sea Buckthorn Juices. Food Chem. 2019, 286, 204–215. [Google Scholar] [CrossRef] [Scilit]
  69. Wei, M.; Wang, S.; Gu, P.; Ouyang, X.; Liu, S.; Li, Y.; Zhang, B.; Zhu, B. Comparison of Physicochemical Indexes, Amino Acids, Phenolic Compounds and Volatile Compounds in Bog Bilberry Juice Fermented by Lactobacillus plantarum under Different PH Conditions. J. Food Sci. Technol. 2018, 55, 2240–2250. [Google Scholar] [CrossRef] [Scilit]
  70. Mousavi, Z.E.; Mousavi, S.M.; Razavi, S.H.; Hadinejad, M.; Emam-Djomeh, Z.; Mirzapour, M. Effect of Fermentation of Pomegranate Juice by Lactobacillus plantarum and Lactobacillus acidophiluson the Antioxidant Activity and Metabolism of Sugars, Organic Acids and Phenolic Compounds. Food Biotechnol. 2013, 27, 1–13. [Google Scholar] [CrossRef] [Scilit]
  71. Lu, C.; Zhang, J.; Zhao, X.; Zi, Y.; Xiao, X. Biotransformation of Phenolic Acids in Foods: Pathways, Key Enzymes, and Technological Applications. Foods 2025, 14, 2187. [Google Scholar] [CrossRef] [Scilit]
  72. Ricci, A.; Cirlini, M.; Maoloni, A.; Del Rio, D.; Calani, L.; Bernini, V.; Galaverna, G.; Neviani, E.; Lazzi, C. Use of Dairy and Plant-Derived Lactobacilli as Starters for Cherry Juice Fermentation. Nutrients 2019, 11, 213. [Google Scholar] [CrossRef] [Scilit]
  73. Re, R.; Pellegrini, N.; Proteggente, A.; Pannala, A.; Yang, M.; Rice-Evans, C. Antioxidant Activity Applying an Improved ABTS Radical Cation Decolorization Assay. Free Radic. Biol. Med. 1999, 26, 1231–1237. [Google Scholar] [CrossRef] [Scilit]
  74. Arts, M.J.T.J.; Sebastiaan Dallinga, J.; Voss, H.-P.; Haenen, G.R.M.M.; Bast, A. A New Approach to Assess the Total Antioxidant Capacity Using the TEAC Assay. Food Chem. 2004, 88, 567–570. [Google Scholar] [CrossRef] [Scilit]
  75. EFSA Panel on Biological Hazards (BIOHAZ); Koutsoumanis, K.; Allende, A.; Álvarez-Ordóñez, A.; Bolton, D.; Bover-Cid, S.; Chemaly, M.; de Cesare, A.; Hilbert, F.; Lindqvist, R.; et al. Update of the list of qualified presumption of safety (QPS) recommended microorganisms intentionally added to food or feed as notified to EFSA. EFSA J. 2023, 21, e07747. [Google Scholar] [CrossRef] [Scilit]
  76. Anisimova, E.; Gorokhova, I.; Karimullina, G.; Yarullina, D. Alarming Antibiotic Resistance of Lactobacilli Isolated from Probiotic Preparations and Dietary Supplements. Antibiotics 2022, 11, 1557. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  77. Gueimonde, M.; Sánchez, B.; Gde Los Reyes-Gavilán, C.; Margolles, A. Antibiotic Resistance in Probiotic Bacteria. Front. Microbiol. 2013, 4, 202. [Google Scholar] [CrossRef] [Scilit]
  78. Sharma, P.; Tomar, S.K.; Sangwan, V.; Goswami, P.; Singh, R. Antibiotic Resistance of Lactobacillus sp. Isolated from Commercial Probiotic Preparations. J. Food Saf. 2015, 36, 38–51. [Google Scholar] [CrossRef] [Scilit]
  79. Campedelli, I.; Mathur, H.; Salvetti, E.; Clarke, S.; Rea, M.C.; Torriani, S.; Ross, R.P.; Hill, C.; O’Toole, P.W. Genus-Wide Assessment of Antibiotic Resistance in Lactobacillus spp. Appl. Environ. Microbiol. 2019, 85, e01738-18. [Google Scholar] [CrossRef] [Scilit]
  80. Thumu, S.C.R.; Halami, P.M. Acquired Resistance to Macrolide–Lincosamide–Streptogramin Antibiotics in Lactic Acid Bacteria of Food Origin. Indian J. Microbiol. 2012, 52, 530–537. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  81. Casado Muñoz Mdel, C.; Benomar, N.; Lerma, L.L.; Gálvez, A.; Abriouel, H. Antibiotic Resistance of Lactobacillus pentosus and Leuconostoc pseudomesenteroides Isolated from Naturally-Fermented Aloreña Table Olives throughout Fermentation Process. Int. J. Food Microbiol. 2014, 172, 110–118. [Google Scholar] [CrossRef] [Scilit]
  82. Feld, L.; Schjørring, S.; Hammer, K.; Licht, T.R.; Danielsen, M.; Krogfelt, K.A.; Wilcks, A. Selective Pressure Affects Transfer and Establishment of a Lactobacillus plantarum Resistance Plasmid in the Gastrointestinal Environment. J. Antimicrob. Chemother. 2008, 61, 845–852. [Google Scholar] [CrossRef] [Scilit]
  83. Nawaz, M.; Wang, J.; Zhou, A.; Ma, C.; Wu, X.; Moore, J.E.; Cherie Millar, B.; Xu, J. Characterization and Transfer of Antibiotic Resistance in Lactic Acid Bacteria from Fermented Food Products. Curr. Microbiol. 2011, 62, 1081–1089. [Google Scholar] [CrossRef] [Scilit]
  84. Anisimova, E.; Yarullina, D. Characterization of Erythromycin and Tetracycline Resistance in Lactobacillus fermentum Strains. Int. J. Microbiol. 2018, 2018, 1–9. [Google Scholar] [CrossRef] [Scilit]
  85. Anisimova, E.A.; Yarullina, D.R. Antibiotic Resistance of Lactobacillus Strains. Curr. Microbiol. 2019, 76, 1407–1416. [Google Scholar] [CrossRef] [Scilit]
  86. de Simone, C. The Unregulated Probiotic Market. Clin. Gastroenterol. Hepatol. 2019, 17, 809–817. [Google Scholar] [CrossRef] [Scilit]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.