Visual and High-Efficiency Secretion of SARS-CoV-2 Nanobodies with Escherichia coli
Abstract
:1. Introduction
2. Materials and Methods
2.1. Strains, Plasmids, and Reagents
2.2. Construction of Cloning Vector
2.3. Protein Expression and Purification
2.4. Western Blotting
2.5. Enzyme-Linked Immunosorbent Assay (ELISA)
3. Results
3.1. Expression and Purification of the Recombinant Proteins
3.2. Binding Capacity to S1 of the Recombinant Nanobodies
3.3. Multi-Epitope Nanobody with Enhanced Affinity
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kissler, S.M.; Tedijanto, C.; Goldstein, E.; Grad, Y.H.; Lipsitch, M. Projecting the transmission dynamics of SARS-CoV-2 through the postpandemic period. Science 2020, 368, 860–868. [Google Scholar] [CrossRef] [PubMed]
- Wu, F.; Zhao, S.; Yu, B.; Chen, Y.M.; Wang, W.; Song, Z.G.; Hu, Y.; Tao, Z.W.; Tian, J.H.; Pei, Y.Y.; et al. A new coronavirus associated with human respiratory disease in China. Nature 2020, 579, 265–269. [Google Scholar] [CrossRef] [PubMed]
- Stein, S.R.; Ramelli, S.C.; Grazioli, A.; Chung, J.-Y.; Singh, M.; Yinda, C.K.; Winkler, C.W.; Sun, J.; Dickey, J.M.; Ylaya, K.; et al. SARS-CoV-2 infection and persistence in the human body and brain at autopsy. Nature 2022, 612, 758–763. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Rao, Z. Structural biology of SARS-CoV-2 and implications for therapeutic development. Nat. Rev. Microbiol. 2021, 19, 685–700. [Google Scholar] [CrossRef]
- Dai, L.; Gao, L.; Tao, L.; Hadinegoro, S.R.; Erkin, M.; Ying, Z.; He, P.; Girsang, R.T.; Vergara, H.; Akram, J.; et al. Efficacy and Safety of the RBD-Dimer–Based Covid-19 Vaccine ZF2001 in Adults. N. Engl. J. Med. 2022, 386, 2097–2111. [Google Scholar] [CrossRef]
- Xu, K.; Gao, P.; Liu, S.; Lu, S.; Lei, W.; Zheng, T.; Liu, X.; Xie, Y.; Zhao, Z.; Guo, S.; et al. Protective prototype-Beta and Delta-Omicron chimeric RBD-dimer vaccines against SARS-CoV-2. Cell 2022, 185, 2265–2278.e2214. [Google Scholar] [CrossRef]
- Huang, K.-Y.A.; Chen, X.; Mohapatra, A.; Nguyen, H.T.V.; Schimanski, L.; Tan, T.K.; Rijal, P.; Vester, S.K.; Hills, R.A.; Howarth, M.; et al. Structural basis for a conserved neutralization epitope on the receptor-binding domain of SARS-CoV-2. Nat. Commun. 2023, 14, 311. [Google Scholar] [CrossRef]
- Shi, R.; Shan, C.; Duan, X.; Chen, Z.; Liu, P.; Song, J.; Song, T.; Bi, X.; Han, C.; Wu, L.; et al. A human neutralizing antibody targets the receptor-binding site of SARS-CoV-2. Nature 2020, 584, 120–124. [Google Scholar] [CrossRef]
- Cox, M.; Peacock, T.P.; Harvey, W.T.; Hughes, J.; Wright, D.W.; Willett, B.J.; Thomson, E.; Gupta, R.K.; Peacock, S.J.; Robertson, D.L.; et al. SARS-CoV-2 variant evasion of monoclonal antibodies based on in vitro studies. Nat. Rev. Microbiol. 2022, 21, 112–124. [Google Scholar] [CrossRef]
- Xu, J.; Xu, K.; Jung, S.; Conte, A.; Lieberman, J.; Muecksch, F.; Lorenzi, J.C.C.; Park, S.; Schmidt, F.; Wang, Z.; et al. Nanobodies from camelid mice and llamas neutralize SARS-CoV-2 variants. Nature 2021, 595, 278–282. [Google Scholar] [CrossRef]
- Koch-Nolte, F. Nanobody-based heavy chain antibodies and chimeric antibodies. Immunol. Rev. 2024, 328, 466–472. [Google Scholar] [CrossRef] [PubMed]
- Li, D.; Wang, R.; Liang, T.; Ren, H.; Park, C.; Tai, C.-H.; Ni, W.; Zhou, J.; Mackay, S.; Edmondson, E.; et al. Camel nanobody-based B7-H3 CAR-T cells show high efficacy against large solid tumours. Nat. Commun. 2023, 14, 5920. [Google Scholar] [CrossRef] [PubMed]
- De Marco, A. Recombinant expression of nanobodies and nanobody-derived immunoreagents. Protein Expr. Purif. 2020, 172, 105645. [Google Scholar] [CrossRef] [PubMed]
- McMahon, C.; Baier, A.S.; Pascolutti, R.; Wegrecki, M.; Zheng, S.; Ong, J.X.; Erlandson, S.C.; Hilger, D.; Rasmussen, S.G.F.; Ring, A.M.; et al. Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nat. Struct. Mol. Biol. 2018, 25, 289–296. [Google Scholar] [CrossRef]
- Custodio, T.F.; Das, H.; Sheward, D.J.; Hanke, L.; Pazicky, S.; Pieprzyk, J.; Sorgenfrei, M.; Schroer, M.A.; Gruzinov, A.Y.; Jeffries, C.M.; et al. Selection, biophysical and structural analysis of synthetic nanobodies that effectively neutralize SARS-CoV-2. Nat. Commun. 2020, 11, 5588. [Google Scholar] [CrossRef]
- Li, T.; Cai, H.; Yao, H.; Zhou, B.; Zhang, N.; van Vlissingen, M.F.; Kuiken, T.; Han, W.; GeurtsvanKessel, C.H.; Gong, Y.; et al. A synthetic nanobody targeting RBD protects hamsters from SARS-CoV-2 infection. Nat. Commun. 2021, 12, 4635. [Google Scholar] [CrossRef]
- Hanke, L.; Das, H.; Sheward, D.J.; Perez Vidakovics, L.; Urgard, E.; Moliner-Morro, A.; Kim, C.; Karl, V.; Pankow, A.; Smith, N.L.; et al. A bispecific monomeric nanobody induces spike trimer dimers and neutralizes SARS-CoV-2 in vivo. Nat. Commun. 2022, 13, 155. [Google Scholar] [CrossRef]
- Schoof, M.; Faust, B.; Saunders, R.A.; Sangwan, S.; Rezelj, V.; Hoppe, N.; Boone, M.; Billesbølle, C.B.; Puchades, C.; Azumaya, C.M.; et al. An ultrapotent synthetic nanobody neutralizes SARS-CoV-2 by stabilizing inactive Spike. Science 2020, 370, 1473–1479. [Google Scholar] [CrossRef]
- Xiang, Y.; Nambulli, S.; Xiao, Z.; Liu, H.; Sang, Z.; Duprex, W.P.; Schneidman-Duhovny, D.; Zhang, C.; Shi, Y. Versatile and multivalent nanobodies efficiently neutralize SARS-CoV-2. Science 2020, 370, 1479–1484. [Google Scholar] [CrossRef]
- Nambulli, S.; Xiang, Y.; Tilston-Lunel, N.L.; Rennick, L.J.; Sang, Z.; Klimstra, W.B.; Reed, D.S.; Crossland, N.A.; Shi, Y.; Duprex, W.P. Inhalable Nanobody (PiN-21) prevents and treats SARS-CoV-2 infections in Syrian hamsters at ultra-low doses. Sci. Adv. 2021, 7, eabh0319. [Google Scholar] [CrossRef]
- Yang, Z.; Wang, Y.; Jin, Y.; Zhu, Y.; Wu, Y.; Li, C.; Kong, Y.; Song, W.; Tian, X.; Zhan, W.; et al. A non-ACE2 competing human single-domain antibody confers broad neutralization against SARS-CoV-2 and circulating variants. Signal Transduct. Target. Ther. 2021, 6, 378. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Huang, H. Expression of single-domain antibody in different systems. Appl. Microbiol. Biotechnol. 2018, 102, 539–551. [Google Scholar] [CrossRef] [PubMed]
- Malaquias, A.D.M.; Marques, L.E.C.; Pereira, S.S.; de Freitas Fernandes, C.; Maranhao, A.Q.; Stabeli, R.G.; Florean, E.; Guedes, M.I.F.; Fernandes, C.F.C. A review of plant-based expression systems as a platform for single-domain recombinant antibody production. Int. J. Biol. Macromol. 2021, 193, 1130–1137. [Google Scholar] [CrossRef]
- Ma, Y.; Lee, C.J.; Park, J.S. Strategies for Optimizing the Production of Proteins and Peptides with Multiple Disulfide Bonds. Antibiotics 2020, 9, 541. [Google Scholar] [CrossRef] [PubMed]
- Hennigan, J.N.; Menacho-Melgar, R.; Sarkar, P.; Golovsky, M.; Lynch, M.D. Scalable, robust, high-throughput expression & purification of nanobodies enabled by 2-stage dynamic control. Metab. Eng. 2024, 85, 116–130. [Google Scholar] [CrossRef]
- Fuhner, V.; Heine, P.A.; Zilkens, K.J.C.; Meier, D.; Roth, K.D.R.; Moreira, G.; Hust, M.; Russo, G. Epitope Mapping via Phage Display from Single-Gene Libraries. Methods Mol. Biol. 2019, 1904, 353–375. [Google Scholar] [CrossRef]
- Tao, Z.; Zhao, X.; Wang, H.; Zhang, J.; Jiang, G.; Yu, B.; Chen, Y.; Zhu, M.; Long, J.; Yin, L.; et al. A method for rapid nanobody screening with no bias of the library diversity. iScience 2024, 27, 108966. [Google Scholar] [CrossRef]
- Jiang, R.; Yuan, S.; Zhou, Y.; Wei, Y.; Li, F.; Wang, M.; Chen, B.; Yu, H. Strategies to overcome the challenges of low or no expression of heterologous proteins in Escherichia coli. Biotechnol. Adv. 2024, 75, 108417. [Google Scholar] [CrossRef]
- Delcour, A.H. Outer membrane permeability and antibiotic resistance. Biochim. Biophys. Acta 2009, 1794, 808–816. [Google Scholar] [CrossRef]
- Gawin, A.; Ertesvåg, H.; Hansen, S.A.H.; Malmo, J.; Brautaset, T. Translational regulation of periplasmic folding assistants and proteases as a valuable strategy to improve production of translocated recombinant proteins in Escherichia coli. BMC Biotech. 2020, 20, 24. [Google Scholar] [CrossRef]
- Zhang, Z.; Tang, R.; Zhu, D.; Wang, W.; Yi, L.; Ma, L. Non-peptide guided auto-secretion of recombinant proteins by super-folder green fluorescent protein in Escherichia coli. Sci. Rep. 2017, 7, 6990. [Google Scholar] [CrossRef] [PubMed]
- Salema, V.; Fernandez, L.A. Escherichia coli surface display for the selection of nanobodies. Microb. Biotechnol. 2017, 10, 1468–1484. [Google Scholar] [CrossRef] [PubMed]
- Zhao, S.; Yang, G.; Xie, X.; Yan, G.; Wang, F.; Chen, W.; Ma, L. Whole-Cell Display of Phosphotransferase in Escherichia coli for High-Efficiency Extracellular ATP Production. Biomolecules 2022, 12, 139. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Wang, B.; Wang, F.; Yang, Z.; Gao, D.; Zhang, C.; Ma, L.; Yu, X. Soluble expression of single-chain variable fragment (scFv) in Escherichia coli using superfolder green fluorescent protein as fusion partner. Appl. Microbiol. Biotechnol. 2019, 103, 6071–6079. [Google Scholar] [CrossRef] [PubMed]
- Yan, X.; Zhang, X.; Li, H.; Deng, D.; Guo, Z.; Kang, L.; Li, A. Engineering of Unspecific Peroxygenases Using a Superfolder-Green-Fluorescent-Protein-Mediated Secretion System in Escherichia coli. JACS Au 2024, 4, 1654–1663. [Google Scholar] [CrossRef] [PubMed]
- Lu, H.; Yu, S.; Qin, F.; Ning, W.; Ma, X.; Tian, K.; Li, Z.; Zhou, K. A secretion-based dual fluorescence assay for high-throughput screening of alcohol dehydrogenases. Biotechnol. Bioeng. 2021, 118, 1624–1635. [Google Scholar] [CrossRef]
- Zeng, W.; Jia, X.; Chi, X.; Zhang, X.; Li, E.; Wu, Y.; Liu, Y.; Han, J.; Ni, K.; Ye, X.; et al. An engineered bispecific nanobody in tetrameric secretory IgA format confers broad neutralization against SARS-CoV-1&2 and most variants. Int. J. Biol. Macromol. 2023, 253, 126817. [Google Scholar] [CrossRef]
- Huang, C.; Huang, J.; Zhu, S.; Tang, T.; Chen, Y.; Qian, F. Multivalent nanobodies with rationally optimized linker and valency for intravitreal VEGF neutralization. Chem. Eng. Sci. 2023, 270, 118521. [Google Scholar] [CrossRef]
- Wang, Y.; Chen, J.; Zhang, S.; Jiang, H.; Zhu, J.; Jiang, G.; Liu, Y.; Zhu, Y.; Li, J. Bispecific Nanobody-Aptamer Conjugates for Enhanced Cancer Therapy in Solid Tumors. Small 2024, 20, 2308265. [Google Scholar] [CrossRef]
- Ma, H.; Zhang, X.; Zheng, P.; Dube, P.H.; Zeng, W.; Chen, S.; Cheng, Q.; Yang, Y.; Wu, Y.; Zhou, J.; et al. Hetero-bivalent nanobodies provide broad-spectrum protection against SARS-CoV-2 variants of concern including Omicron. Cell Res. 2022, 32, 831–842. [Google Scholar] [CrossRef]
- Yu, F.; Li, X.; Wang, F.; Liu, Y.; Zhai, C.; Li, W.; Ma, L.; Chen, W. TLTC, a T5 exonuclease-mediated low-temperature DNA cloning method. Front. Bioeng. Biotechnol. 2023, 11, 1167534. [Google Scholar] [CrossRef] [PubMed]
- Koenig, P.A.; Das, H.; Liu, H.; Kummerer, B.M.; Gohr, F.N.; Jenster, L.M.; Schiffelers, L.D.J.; Tesfamariam, Y.M.; Uchima, M.; Wuerth, J.D.; et al. Structure-guided multivalent nanobodies block SARS-CoV-2 infection and suppress mutational escape. Science 2021, 371, eabe6230. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Wang, F.; Yang, S.; Jiang, W.; Gao, R.; Lin, S.; Deng, B.; Wang, X.; Cheng, W.; Liu, Y.; et al. Development of a Hyperthermostable Artificial Scaffold Based on Ultrahigh-Affinity Protein Pairs and Its Application in Cellulose Degradation. ACS Sustain. Chem. Eng. 2022, 10, 2072–2083. [Google Scholar] [CrossRef]
- Lu, Y.; Li, Q.; Fan, H.; Liao, C.; Zhang, J.; Hu, H.; Yi, H.; Peng, Y.; Lu, J.; Chen, Z. A Multivalent and Thermostable Nanobody Neutralizing SARS-CoV-2 Omicron (B.1.1.529). Int. J. Nanomed. 2023, 18, 353–367. [Google Scholar] [CrossRef]
- Abramson, J.; Adler, J.; Dunger, J.; Evans, R.; Green, T.; Pritzel, A.; Ronneberger, O.; Willmore, L.; Ballard, A.J.; Bambrick, J.; et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 2024, 630, 493–500. [Google Scholar] [CrossRef]
- Huo, J.; Le Bas, A.; Ruza, R.R.; Duyvesteyn, H.M.E.; Mikolajek, H.; Malinauskas, T.; Tan, T.K.; Rijal, P.; Dumoux, M.; Ward, P.N.; et al. Neutralizing nanobodies bind SARS-CoV-2 spike RBD and block interaction with ACE2. Nat. Struct. Mol. Biol. 2020, 27, 846–854. [Google Scholar] [CrossRef]
- Lu, Q.; Zhang, Z.; Li, H.; Zhong, K.; Zhao, Q.; Wang, Z.; Wu, Z.; Yang, D.; Sun, S.; Yang, N.; et al. Development of multivalent nanobodies blocking SARS-CoV-2 infection by targeting RBD of spike protein. J. Nanobiotechnol. 2021, 19, 33. [Google Scholar] [CrossRef]
- Planas, D.; Bruel, T.; Grzelak, L.; Guivel-Benhassine, F.; Staropoli, I.; Porrot, F.; Planchais, C.; Buchrieser, J.; Rajah, M.M.; Bishop, E.; et al. Sensitivity of infectious SARS-CoV-2 B.1.1.7 and B.1.351 variants to neutralizing antibodies. Nat. Med. 2021, 27, 917–924. [Google Scholar] [CrossRef]
- Hu, J.; Peng, P.; Wang, K.; Fang, L.; Luo, F.Y.; Jin, A.S.; Liu, B.Z.; Tang, N.; Huang, A.L. Emerging SARS-CoV-2 variants reduce neutralization sensitivity to convalescent sera and monoclonal antibodies. Cell Mol. Immunol. 2021, 18, 1061–1063. [Google Scholar] [CrossRef]
- Tada, T.; Dcosta, B.M.; Samanovic, M.I.; Herati, R.S.; Cornelius, A.; Zhou, H.; Vaill, A.; Kazmierski, W.; Mulligan, M.J.; Landau, N.R. Convalescent-Phase Sera and Vaccine-Elicited Antibodies Largely Maintain Neutralizing Titer against Global SARS-CoV-2 Variant Spikes. mBio 2021, 12, e0069621. [Google Scholar] [CrossRef]
- Cardoso, F.M.; Ibanez, L.I.; Van den Hoecke, S.; De Baets, S.; Smet, A.; Roose, K.; Schepens, B.; Descamps, F.J.; Fiers, W.; Muyldermans, S.; et al. Single-domain antibodies targeting neuraminidase protect against an H5N1 influenza virus challenge. J. Virol. 2014, 88, 8278–8296. [Google Scholar] [CrossRef] [PubMed]
- Detalle, L.; Stohr, T.; Palomo, C.; Piedra, P.A.; Gilbert, B.E.; Mas, V.; Millar, A.; Power, U.F.; Stortelers, C.; Allosery, K.; et al. Generation and Characterization of ALX-0171, a Potent Novel Therapeutic Nanobody for the Treatment of Respiratory Syncytial Virus Infection. Antimicrob. Agents Chemother. 2016, 60, 6–13. [Google Scholar] [CrossRef] [PubMed]
- Ingram, J.R.; Schmidt, F.I.; Ploegh, H.L. Exploiting Nanobodies’ Singular Traits. Annu. Rev. Immunol. 2018, 36, 695–715. [Google Scholar] [CrossRef] [PubMed]
- Muyldermans, S. Applications of Nanobodies. Annu. Rev. Anim. Biosci. 2021, 9, 401–421. [Google Scholar] [CrossRef]
Gene | Primer | Sequence (5′-3′) |
---|---|---|
Fu2-sfGFP | Fu2-NF | CACCATCATCATCATCATCAGGTTCAGCTGGTTGAAAGC |
Fu2-NR | AGCAGCCGGATCTCATTTATACAGTTCATCCATGCCC | |
sfGFP-Fu2 | Fu2-CF | CACCATCATCATCATCATATGGTGAG |
Fu2-CR | AAGCGTAATCCGGAACATCATACGGGTAGCTGCTAACGGTAACCTGG | |
sfGFP-ANTE | ANTE-F | CACCATCATCATCATCATATGGTGAG |
ANTE-R | AAGCGTAATCCGGAACATCATACGGGTAAGAGCTAACGGTCACTTGC | |
sfGFP-mNb6 | mNb6-F | CACCATCATCATCATCATATGGTGAG |
mNb6-R | GCTGCCGCCGCCGCCGCTACTAACTGTAACTTGTGTTCCC | |
sfGFP-MR3-MR3 | MR3-F | CACCATCATCATCATCATATGGTGAG |
MR3-R | AGCAGCCGGATCTCACTATGCATAATCCGGAACATCATACG | |
n3113.1-sfGFP | n3113-F | CACCATCATCATCATCATGAGGTTCAACTAGTAGAATCAGGTGG |
n3113-R | AGCAGCCGGATCTCATTTATACAGTTCATCCATGCCC | |
pET-23a | 23a-F | TGAGATCCGGCTGCTAACAA |
23a-R | ATGATGATGATGATGGTGCATATGTATAT |
Plasmid/Strain | Description |
---|---|
pET-23a | Vector for expression proteins, T7 promoter, Ampr |
pFu2-sfGFP | pET-23a encoding Fu2-sfGFP, Ampr |
psfGFP-Fu2 | pET-23a encoding sfGFP-Fu2, Ampr |
psfGFP-ANTE | pET-23a encoding sfGFP-ANTE, Ampr |
psfGFP-mNb6 | pET-23a encoding sfGFP-mNb6, Ampr |
psfGFP-MR3-MR3 | pET-23a encoding sfGFP-MR3-MR3, Ampr |
pn3113.1-sfGFP | pET-23a encoding n3113.1-sfGFP, Ampr |
pFu2-sfGFP-ANTE | pET-23a encoding Fu2-sfGFP-ANTE, Ampr |
Strain | |
E-Fu2-sfGFP | E. coli BL21(DE3) (pFu2-sfGFP) |
E-sfGFP-Fu2 | E. coli BL21(DE3) (psfGFP-Fu2) |
E-sfGFP-ANTE | E. coli BL21(DE3) (psfGFP-ANTE) |
E-sfGFP-mNb6 | E. coli BL21(DE3) (psfGFP-mNb6) |
E-sfGFP-MR3-MR3 | E. coli BL21(DE3) (psfGFP-MR3-MR3) |
E-n3113.1-sfGFP | E. coli BL21(DE3) (pn3113.1-sfGFP) |
E-Fu2-sfGFP-ANTE | E. coli BL21(DE3) (pFu2-sfGFP-ANTE) |
Nanobodies | Number of Cysteines | MW (Target Protein) (kDa) | Secretion Production (mg/L) |
---|---|---|---|
Fu2-sfGFP | 4 | 45.1 | 188 |
sfGFP-Fu2 | 4 | 44.1 | 307 |
sfGFP-ANTE | 8 | 70.9 | 335 |
sfGFP-mNb6 | 8 | 82.2 | 331 |
sfGFP-MR3-MR3 | 6 | 69.9 | 294 |
n3113.1-sfGFP | 4 | 42.7 | 235 |
Fu2-sfGFP-ANTE | 10 | 97.9 | 272 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, S.; Zeng, W.; Yu, F.; Xu, P.; Chen, C.-Y.; Chen, W.; Dong, Y.; Wang, F.; Ma, L. Visual and High-Efficiency Secretion of SARS-CoV-2 Nanobodies with Escherichia coli. Biomolecules 2025, 15, 111. https://doi.org/10.3390/biom15010111
Zhao S, Zeng W, Yu F, Xu P, Chen C-Y, Chen W, Dong Y, Wang F, Ma L. Visual and High-Efficiency Secretion of SARS-CoV-2 Nanobodies with Escherichia coli. Biomolecules. 2025; 15(1):111. https://doi.org/10.3390/biom15010111
Chicago/Turabian StyleZhao, Shuai, Wanting Zeng, Fang Yu, Pingping Xu, Chin-Yu Chen, Wanping Chen, Yanming Dong, Fei Wang, and Lixin Ma. 2025. "Visual and High-Efficiency Secretion of SARS-CoV-2 Nanobodies with Escherichia coli" Biomolecules 15, no. 1: 111. https://doi.org/10.3390/biom15010111
APA StyleZhao, S., Zeng, W., Yu, F., Xu, P., Chen, C.-Y., Chen, W., Dong, Y., Wang, F., & Ma, L. (2025). Visual and High-Efficiency Secretion of SARS-CoV-2 Nanobodies with Escherichia coli. Biomolecules, 15(1), 111. https://doi.org/10.3390/biom15010111