Abstract
Serum concentrations of leucine-rich alpha-2 glycoprotein 1 (LRG1) are elevated in several cardio-metabolic and inflammatory diseases. LRG1 also plays an important role in the development of hepatic steatosis and insulin resistance. In lipodystrophies (LDs), severe cardio-metabolic complications can be observed. The dysregulation of several adipokines plays a significant role in the clinical manifestation of this syndrome. To date, there have been no studies of LRG1 levels in non-HIV-LD patients. We performed a cross-sectional analysis of LRG1 serum levels in 60 patients with non-HIV-associated LD and in 60 age-, sex-, and BMI-matched healthy controls. Furthermore, we investigated the gene expression of Lrg1 in a mouse model of generalised LD. No significant difference was found in the median concentration of LRG1 serum levels between LD patients (18.2 ng/L; interquartile range 8.3 ng/L) and healthy controls (17.8 ng/L; interquartile range 11.0 ng/L). LRG1 serum concentrations correlated positively with CRP serum levels (p < 0.001). Lrg1 mRNA expression was downregulated in the adipose tissue, whereas in the liver, no difference in Lrg1 expression between LD and wild-type mice was detected. In summary, circulating levels of LRG1 are associated with low-grade inflammation but cannot distinguish between patients with LD and controls.
1. Introduction
Leucine-rich alpha-2 glycoprotein 1 (LRG1) is a protein that is part of the leucine-rich repeat (LRR) family of proteins. It is involved in various biological processes such as inflammation, immune response, and cell adhesion [1]. Under physiological conditions, LRG1 is secreted primarily by the liver and has been found to be upregulated in various diseases such as cancer, cardiovascular disease, and inflammatory conditions [1]. Since recent studies revealed that LRG1 is also secreted by adipocytes, it has been studied in the context of adipose tissue and obesity [2]. LRG1 expression is upregulated in adipose tissue in obese individuals and may be involved in the modulation of adipogenesis, inflammation, and insulin resistance in adipose tissue [3].
In lipodystrophy (LD) syndromes, a group of rare acquired or congenital disorders, cardio-metabolic complications similar to those found in obesity can be found. Due to loss of adipose tissue in either a general or partial way (which is the pathognomonic symptom of LD), the capacity of adipocyte tissue depots for storage of surplus energy is precociously exceeded in LD. This leads to an increase in circulating lipids and ectopic lipid accumulation with concomitant organ dysfunction [4]. As in obesity, an adverse adipokine secretion profile has been described for LD. Serum concentrations of leptin and adiponectin are reduced in LD [5]. These two adipokines are crucial for an adequate control of energy homeostasis and glucose metabolism [6]. Substitution with recombinant leptin was described as a specific treatment for metabolic complications in LD already 20 years ago [7]. However, individual response to treatment is highly variable, especially in partial LD, which is the most common LD subgroup in Europe [8,9]. Hence, there is a need for finding sufficient predictors for individual responses to leptin substitution as well as for new treatment options in LD.
To the best of our knowledge, LRG1 serum levels have not been investigated in patients with LD so far. We performed a cross-sectional analysis of LRG1 serum levels in non-HIV LD patients and a sex-, age-, and BMI-matched healthy control group. We hypothesised that LRG1 is upregulated in patients with LD and may contribute to vascular and metabolic consequences.
2. Materials and Methods
2.1. Patients
A detailed description of the patient and control groups has been given recently [10]. In short, 60 patients (48 females/12 males) with generalised (n = 5) and partial (n = 55) LD and 60 healthy, age-, BMI-, and sex-matched non-LD subjects were included in our study. Age ranged from 16 to 75 years, and the BMI ranged from 17.4 to 46.1 kg/m2. LD was diagnosed according to the 2016’s Multi-Society Practice Guideline [11]. Hepatic steatosis was assessed in the LD cohort only using vibration-controlled transient elastography (FibroScan; Echosens, Paris, France) with measurement of controlled attenuation parameter (CAP) using either M or XL probe. CAP > 288 dB/m was used as a cut-off for the detection of steatosis [12].
Written informed consent was obtained from all participants prior to enrolment. This study was approved by the local Ethics Committee of the University of Leipzig.
2.2. Laboratory Assays
Serum adipokine concentrations were determined using enzyme-linked immunosorbent assays from Mediagnost, Reutlingen, Germany (leptin and total adiponectin measurement) and Abcam, Cambridge, United Kingdom (LRG1 measurement), according to the manufacturer’s instructions. Measurements of the metabolic and inflammatory parameters, i.e., fasting insulin (FI), fasting glucose (FG), glycated haemoglobin A1c (HbA1c), creatinine, triglycerides (TGs), cholesterol, high-density lipoprotein (HDL) cholesterol, low-density lipoprotein (LDL) cholesterol, free fatty acids (FFAs), and CRP, were performed by standardised laboratory methods in the Institute of Laboratory Medicine, Clinical Chemistry, and Molecular Diagnostics, University of Leipzig Medical Centre. Blood samples were collected after an overnight fast. The homeostasis model assessment of insulin resistance (HOMA-IR) was calculated using the method described by Matthews et al. [13], and the CKD-EPI equation [14] was used to calculate the estimated glomerular filtration rate (eGFR).
2.3. Mouse Experiments
Animal experiments were performed in accordance with the guidelines approved by the State of Saxony, Germany, and in compliance with the recommendations of the local animal Ethics Committee (TVV39/21). In this study, we used male transgenic aP2-SREBP1c mice (SREBP1c-Tg, n = 5) on a C57Bl/6 background to study the congenital generalised LD phenotype [15]. Male wild-type SREBP1c mice (SREBP1c-WT, n = 5), also on a C57Bl/6 background, served as controls. All mice were maintained at 23 °C on a 12 h light/dark cycle, fed standard chow (Ssniff, Soest, Germany), and given ad libitum access to water and food. Mice were sacrificed at an age of 15 weeks, and tissues (inguinal white adipose tissue (iWAT), brown adipose tissue (BAT), and liver) were collected and snap-frozen for further analysis.
2.4. RNA Isolation and Gene Expression Analysis
Isolation of RNA from tissues (iWAT, BAT, and liver) was performed by using the RNeasy Lipid Tissue Mini Kit (Qiagen, Venlo, The Netherlands) according to the manufacturer’s instructions. Subsequently, 1 µg of isolated RNA was transcribed into cDNA by using random hexamer primers and M-MLV reverse transcriptase by Promega (Fitchburg, WI, USA). Quantitative real-time PCR was performed by using the LightCycler-DNA Master SYBR Green I Kit (Roche, Basle, Switzerland) according to standard protocols. Lrg1 (forward sequence: CCATGTCAGTGTGCA; reverse sequence: AAGAGTGAGAGGTGG) gene expression was calculated using the delta-delta CT method with either Rplp0 (forward sequence: TCGGGTCCTAGACCAGTGTTC; reverse sequence: AGATTCGGGATATGCTGTTGGC) or 18s (forward sequence: GTAACCCGTTGAACCCCATT; reverse sequence: CCATCCAATCGGTAGTAGCG) as a reference gene and was adjusted to the control group (SREBP1c-WT).
2.5. Statistical Analysis
Statistical analysis of human data was performed with SPSS Statistics Version 29 (IBM, Armonk, NY, USA). Data were reported as median and interquartile range. The non-parametric Mann–Whitney U test was used to identify differences between the two groups (LD patients and control group). Correlations were presented using Spearman’s rank correlation method. Results with a p-value < 0.05 were considered significant. Statistical analysis of mouse data was performed using GraphPad Prism 10 software (GraphPad, Boston, MA, USA). Group comparisons were evaluated using a two-tailed Student’s t-test, and a p-value of <0.05 was considered statistically significant in all analyses.
3. Results
3.1. Descriptive Statistics
The clinical and laboratory characteristics of LD patients and controls are shown in Table 1. The median LRG1 concentrations did not show a significant difference between LD patients (18.2 ng/L; interquartile range 8.3 ng/L) and controls (17.8 ng/L; interquartile range 11.0 ng/L) (Table 1). The LD cohort showed significantly higher WHR and SBP as well as a significant malfunction of glucose metabolism (i.e., higher HbA1c, FI, and HOMA-IR) and lipid parameters (i.e., lower HDL cholesterol, LDL cholesterol, and higher TG) compared to the controls. Moreover, serum levels of adiponectin and leptin were significantly lower in LD patients as compared to the healthy controls. There was also a significant difference in the liver enzymes, i.e., higher ASAT, ALAT, and GGT, in LD patients. Comparing LD patients with and without complications, we did not find significant differences in LRG1 serum levels between LD patients with insulin resistance (defined as HOMA-IR ≥ 2.5; n = 46) vs. LD patients without insulin resistance (HOMA-IR < 2.5; n = 14; p = 0.327), LD patients with overt diabetes mellitus (n = 38) vs. non-diabetic LD patients (n = 22; p = 0.709), and LD patients with hepatic steatosis (n = 28) vs. no steatosis (n = 20; p = 0.975). Patients with generalised LD had significantly lower BMI, HDL cholesterol, LDL cholesterol, creatinine, adiponectin levels, and leptin levels than patients with partial LD. In contrast, TGs, eGFR, CRP, ALAT, and ASAT were significantly higher in generalised LD as compared to partial LD. Interestingly, there were no significant differences in LRG1 serum concentration and HbA1c between the two LD subgroups (Supplementary Table S1).
Table 1.
Baseline characteristics of the entire study population (n = 60 controls and n = 60 LD). ALAT, alanine aminotransferase; ASAT, aspartate aminotransferase; BMI, Body mass index; CRP, C-reactive protein; DBP, Diastolic blood pressure; eGFR, estimated glomerular filtration rate; FFAs, free fatty acids; FG, fasting glucose; FI, fasting insulin; GGT, Gamma-glutamyltransferase; HbA1c, Glycosylated haemoglobin A1c; HDL, high-density lipoprotein; LRG1, leucine-rich alpha-2 glycoprotein 1; HOMA-IR, homeostasis model assessment of insulin resistance; LD, lipodystrophy; LDL, low-density lipoprotein; SBP, Systolic blood pressure; TGs, triglycerides; WHR, Waist–hip ratio. Values for median (interquartile range) are shown. * indicates p < 0.05 as assessed by Mann–Whitney U test.
3.2. Lrg1 mRNA Expression in Several Tissues of an LD Mouse Model
To detect possible differences in Lrg1 expression between LD mice (SREBP1c-Tg) and WT controls (SREBP1c-WT), we performed mRNA analyses in several adipose tissues and livers of both animal cohorts. Lrg1 mRNA expression was significantly downregulated in the iWAT (p < 0.0001) and BAT (p < 0.0001) of SREBP1c-Tg mice as compared to SREBP1c-WT controls (Figure 1A,B). In contrast, there was a tendency for increased expression of Lrg1 in the livers of the lipodystrophic SREBP1c-Tg mice; however, the observed difference did not achieve statistical significance (Figure 1C).
Figure 1.
(A,B) The expression of Lrg1 in the iWAT and BAT of lipodystrophic SREBP1c-Tg mice (n = 5) was found to be significantly reduced in comparison to wild-type controls (n = 5). (C) Hepatic Lrg1 gene expression in SREBP1c-Tg mice exhibited a tendency towards upregulation. Data are presented as means ± SEM. **** p ≤ 0.0001, compared to wild-type controls, unpaired t-test.
3.3. Correlation Analysis
The entire study cohort was included to test for possible correlations between LRG1 and anthropometric and metabolic parameters. LRG1 serum concentrations correlated positively with CRP serum levels (p < 0.001) (Table 2). No significant association was found between LRG1 levels and BMI, WHR, blood pressure, HbA1c, FG, FI, HOMA-IR, cholesterol, HDL cholesterol, LDL cholesterol, TGs, FFAs, creatinine, eGFR, adiponectin, leptin, and liver enzymes (Table 2).
Table 2.
Univariate correlations with LRG1 in the entire study population. r- and p-values are given. Abbreviations are indicated in Table 1. * indicates significant correlation as assessed by Spearman’s correlation method.
4. Discussion
We have investigated serum concentrations of the adipokine LRG1 in a cohort of 60 patients with different subtypes of non-HIV LD. Several studies show that elevated levels of LRG1 are associated with a wide range of diseases, including cancer, heart failure, and inflammatory diseases [16]. High concentrations of LRG1 are closely linked to obesity and might serve as an early obesity marker in overweight adolescents [3]. It appears to be a marker of cardiovascular and all-cause mortality in patients with diabetes mellitus type 2 (T2DM) [17]. He et al. identified LRG1 as a key molecule mediating the crosstalk between adipocytes and hepatocytes in diet-induced hepatosteatosis and insulin resistance by upregulating de novo lipogenesis and downregulating fatty acid beta-oxidation, most likely via sterol regulatory element-binding transcription factor 1 [2]. Although LD is often associated with hepatic steatosis and insulin resistance, we could not find a significant difference in the serum levels of LRG1 between LD patients and the age-, BMI-, and sex-matched healthy controls. Moreover, comparing subgroups of LD patients with vs. without insulin resistance/diabetes mellitus, with vs. without hepatic steatosis, and with generalised LD vs. partial LD does not show any significant differences in LRG1 serum levels.
Independently of concomitant diabetes mellitus, LD itself is associated with a pro-inflammatory state [18]. Compared to the control group, we detect increased CRP as a circulating key inflammatory marker in the serum of our LD cohort. Since LRG1 serum levels do not significantly differ between patients with LD and controls, circulating LRG1 does not seem to have substantial relevance in this inflammatory process. Therefore, it might be supposed that inflammation in LD is due to the increased serum levels of other pro-inflammatory cytokines, e.g., chemerin, progranulin, tumour necrosis factor alpha, and interleukin 6, which have been determined to be significantly elevated in serum of patients with LD as compared to healthy individuals [19,20,21,22].
LRG1 is predominantly secreted by hepatocytes and immune cells [23]. He and co-workers identify adipose tissue as a source of LRG1 protein expression [2] and show significantly higher LRG1 protein levels in adipose tissue than in the liver. Interestingly, and in contrast to other adipokines such as adiponectin and leptin, the circulating levels of LRG1 are not decreased in our patients despite the lack of adipose tissue in LD. Since serum levels reflect the sum of LRG1 secreted by various tissues, it might be speculated that tissue-specific alterations of Lrg1 mRNA expression and secretion occur in LD. While there are no significant differences in the circulating levels of LRG1 between LD patients and controls, we observe clear tissue-specific expression differences between LD mice and the corresponding wild-type controls. Thus, Lrg1 expression is significantly reduced in the iWAT and BAT of SREBP1c-Tg LD mice in comparison to wild-type control animals. In contrast, we identify no significant differences in Lrg1 mRNA expression in the liver of SREBP1c-Tg mice as compared to SREBP1c-WT controls. Rather, there is a trend towards increased expression of Lrg1 in the liver of LD mice, albeit without statistical significance. In diet-induced obese mice, Lrg1 expression correlates with adipogenesis. Moreover, they show significant induction of Lrg1 mRNA in iWAT [24]. The reduced Lrg1 expression in our transgenic LD mice may reflect adipose tissue dysfunction, which is one of the hallmarks of LD syndromes. Recent studies by Choi et al. indicate that Lrg1 overexpression is associated with enhanced glucose homeostasis and a reduction in macrophage infiltration in white adipose tissue in an obese mouse model [24]. The preserved hepatic Lrg1 expression of LD mice may represent a compensatory mechanism to counterbalance the reduced expression in the dysfunctional adipose tissue. Additionally, Choi et al. identify a reduction in inflammation in the fatty liver of mice overexpressing Lrg1, indicating a potential anti-inflammatory function of LRG1 in hepatic tissue [24]. Consequently, the amount of hepatic Lrg1 expression in SREBP1c-Tg mice may represent an adaptive response in order to promote anti-inflammatory effects and to preserve liver function in LD. However, the potential role of LRG1 in regulating macrophage infiltration and tissue homeostasis in lipodystrophic mice requires further investigation. It would be of interest whether the different mRNA expression profiles in several tissues lead to differences in LRG1 serum concentrations between SREBP1c-Tg mice and SREBP1c-WT controls.
Correlating LRG1 levels of the entire study group with anthropometric and metabolic parameters reveals a positive association between LRG1 and CRP, which is consistent with other studies and reflects the pro-inflammatory role of LRG1. Alhammad et al. show a positive correlation of LRG1 serum concentration with CRP and other obesity markers in a group of overweight and obese adolescents [3]. Recent studies have also shown its association with inflammatory bowel disease and suggest LRG1 as a useful biomarker of endoscopic disease activity during treatment [25,26]. LRG1 has also been characterised as an important player in pathological angiogenesis and vascular endothelial dysfunction. In this context, it is considered an enhancer of transforming growth factor beta-induced renal fibrosis in T2DM patients and a predictor of albuminuria and chronic kidney disease progression [27]. In addition, higher levels of LRG1 seem to be generally associated with renal function decline in T2DM patients and may serve as a predictor for the risk of kidney disease progression [28,29]. Interestingly, we could not find an association between serum LRG1 concentration and renal function parameters (e.g., creatinine, eGFR) in our study group. However, we did not measure urinary albumin excretion.
A shortcoming of our study is the small sample size and the heterogeneity of the LD group. We show that circulating LRG1 is no marker for inflammation and metabolic complications in this aetiologically mixed LD cohort even after subdividing the group into generalised and partial LD. However, the terms generalised and partial LD only describe the extent of adipose tissue loss. Within these two groups, there is a huge variability with regard to aetiology, grade of inflammation, as well as the type and severity of metabolic complications [30,31,32]. Moreover, each LD subtype has specific and varying non-metabolic comorbidities, e.g., cardiovascular signs, glomerulonephritis, neurological manifestations, skeletal manifestations, skin anomalies, and premature ageing [11,33,34]. Thus, whether there is an alteration in LGR1 serum levels in some defined LD subtypes cannot be excluded to date.
5. Conclusions
In conclusion, we show that LRG1 serum levels in LD patients are not significantly different from a group of age-, sex-, and BMI-matched healthy controls. This indicates that, in contrast to other metabolic and inflammatory diseases, circulating LRG1 is not a main marker of inflammation and insulin resistance in patients with LD. Our study also reveals tissue-specific alterations of Lrg1 mRNA expression in LD mice, with significantly reduced levels in several adipose tissues of SREBP1c-Tg animals as compared to wild-type controls. However, mRNA expression in the liver is comparable between both groups and shows a trend towards increased expression in the liver of LD mice. This suggests a complex role for LRG1 in modulating metabolic and inflammatory processes in different tissues.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biom14111474/s1, Table S1: Baseline characteristics of the LD population (n = 60), partial LD vs. generalized LD.
Author Contributions
Conceptualisation, S.K. and K.M.; data collection and investigation, M.K. and L.W.; validation, S.K. and K.M.; writing—original draft preparation, M.K.; writing—review and editing, A.T. and K.M.; supervision, K.M.; project administration, K.M.; funding acquisition A.T. and K.M. All authors have read and agreed to the published version of the manuscript.
Funding
This study was supported by the Deutsche Forschungsgemeinschaft (DFG; German Research Foundation) through CRC1052 “Obesity Mechanisms”, project number 438 209933838 (C6), to A.T.; and the German Diabetes Association (DDG) to K.M.
Institutional Review Board Statement
This study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Ethics Committee of the University of Leipzig (protocol code: 135/13-ek, date of approval: 8 July 2013).
Informed Consent Statement
Informed consent was obtained from all subjects involved in this study.
Data Availability Statement
The datasets presented in this article are not readily available because the data are part of an ongoing study. Requests to access the datasets should be directed to the corresponding author.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Camilli, C.; Hoeh, A.E.; de Rossi, G.; Moss, S.E.; Greenwood, J. LRG1: An emerging player in disease pathogenesis. J. Biomed. Sci. 2022, 29, 6. [Google Scholar] [CrossRef] [PubMed]
- He, S.; Ryu, J.; Liu, J.; Luo, H.; Lv, Y.; Langlais, P.R.; Wen, J.; Dong, F.; Sun, Z.; Xia, W.; et al. LRG1 is an adipokine that mediates obesity-induced hepatosteatosis and insulin resistance. J. Clin. Investig. 2021, 131, e148545. [Google Scholar] [CrossRef] [PubMed]
- Alhammad, R.; Abu-Farha, M.; Hammad, M.M.; Thanaraj, T.A.; Channanath, A.; Alam-Eldin, N.; Al-Sabah, R.; Shaban, L.; Alduraywish, A.; Al-Mulla, F.; et al. Increased LRG1 Levels in Overweight and Obese Adolescents and Its Association with Obesity Markers, Including Leptin, Chemerin, and High Sensitivity C-Reactive Protein. Int. J. Mol. Sci. 2022, 23, 8564. [Google Scholar] [CrossRef] [PubMed]
- Lim, K.; Haider, A.; Adams, C.; Sleigh, A.; Savage, D.B. Lipodistrophy: A paradigm for understanding the consequences of “overloading” adipose tissue. Physiol. Rev. 2021, 101, 907–993. [Google Scholar] [CrossRef] [PubMed]
- Haque, W.A.; Shimomura, I.; Matsuzawa, Y.; Garg, A. Serum adiponectin and leptin levels in patients with lipodystrophies. J. Clin. Endocrinol. Metab. 2002, 87, 2395. [Google Scholar] [CrossRef]
- Fasshauer, M.; Blüher, M. Adipokines in health and disease. Trends Pharmacol. Sci. 2015, 36, 461–470. [Google Scholar] [CrossRef]
- Oral, E.A.; Simha, V.; Ruiz, E.; Andewelt, A.; Premkumar, A.; Snell, P.; Wagner, A.J.; DePaoli, A.M.; Reitman, M.L.; Taylor, S.I.; et al. Leptin-replacement therapy for lipodystrophy. N. Engl. J. Med. 2002, 346, 570–578. [Google Scholar] [CrossRef]
- Diker-Cohen, T.; Cochran, E.; Gorden, P.; Brown, R.J. Partial and generalized lipodystrophy: Comparison of baseline characteristics and response to metreleptin. J. Clin. Endocrinol. Metab. 2015, 100, 1802–1810. [Google Scholar] [CrossRef]
- Mosbah, H.; Vantyghem, M.-C.; Nobécourt, E.; Andreelli, F.; Archambeaud, F.; Bismuth, E.; Briet, C.; Cartigny, M.; Chevalier, B.; Donadille, B.; et al. Therapeutic indications and metabolic effects of metreleptin in patients with lipodystrophy syndromes: Real-life experience from a national reference network. Diabetes Obes. Metab. 2022, 24, 1565–1577. [Google Scholar] [CrossRef]
- Kralisch, S.; Hoffmann, A.; Estrada-Kunz, J.; Stumvoll, M.; Fasshauer, M.; Tönjes, A.; Miehle, K. Increased Growth Differentiation Factor 15 in Patients with Hypoleptinemia-Associated Lipodystrophy. Int. J. Mol. Sci. 2020, 21, 7214. [Google Scholar] [CrossRef]
- Brown, R.J.; Araujo-Vilar, D.; Cheung, P.T.; Dunger, D.; Garg, A.; Jack, M.; Mungai, L.; Oral, E.A.; Patni, N.; Rother, K.I.; et al. The Diagnosis and Management of Lipodystrophy Syndromes: A Multi-Society Practice Guideline. J. Clin. Endocrinol. Metab. 2016, 101, 4500–4511. [Google Scholar] [CrossRef] [PubMed]
- Caussy, C.; Alquiraish, M.H.; Nguyen, P.; Hernandez, C.; Cepin, S.; Fortney, L.E.; Ajmera, V.; Bettencourt, R.; Collier, S.; Hooker, J.; et al. Optimal threshold of controlled attenuation parameter with MRI-PDFF as the gold standard for the detection of hepatic steatosis. Hepatology 2018, 67, 1348–1359. [Google Scholar] [CrossRef] [PubMed]
- Matthews, D.R.; Hosker, J.P.; Rudenski, A.S.; Naylor, B.A.; Treacher, D.F.; Turner, R.C. Homeostasis model assessment: Insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 1985, 28, 412–419. [Google Scholar] [CrossRef] [PubMed]
- Levey, A.S.; Stevens, L.A.; Schmid, C.H.; Zhang, Y.L.; Castro, A.F.; Feldman, H.I.; Kusek, J.W.; Eggers, P.; van Lente, F.; Greene, T.; et al. A new equation to estimate glomerular filtration rate. Ann. Intern. Med. 2009, 150, 604–612. [Google Scholar] [CrossRef]
- Shimomura, I.; Hammer, R.E.; Richardson, J.A.; Ikemoto, S.; Bashmakov, Y.; Goldstein, J.L.; Brown, M.S. Insulin resistance and diabetes mellitus in transgenic mice expressing nuclear SREBP-1c in adipose tissue: Model for congenital generalized lipodystrophy. Genes Dev. 1998, 12, 3182–3194. [Google Scholar] [CrossRef]
- Zou, Y.; Xu, Y.; Chen, X.; Wu, Y.; Fu, L.; Lv, Y. Research Progress on Leucine-Rich Alpha-2 Glycoprotein 1: A Review. Front. Pharmacol. 2021, 12, 809225. [Google Scholar] [CrossRef]
- Liu, J.-J.; Pek, S.L.T.; Liu, S.; Wang, J.; Lee, J.; Ang, K.; Shao, Y.M.; Gurung, R.L.; Tavintharan, S.; Tang, W.E.; et al. Association of Plasma Leucine-Rich Alpha-2 Glycoprotein 1 (LRG1) with All-Cause and Cause-Specific Mortality in Individuals with Type 2 Diabetes. Clin. Chem. 2021, 67, 1640–1649. [Google Scholar] [CrossRef]
- Hegele, R.A.; Kraw, M.E.; Ban, M.R.; Miskie, B.A.; Huff, M.W.; Cao, H. Elevated serum C-reactive protein and free fatty acids among nondiabetic carriers of missense mutations in the gene encoding lamin A/C (LMNA) with partial lipodystrophy. Arterioscler. Thromb. Vasc. Biol. 2003, 23, 111–116. [Google Scholar] [CrossRef]
- Miehle, K.; Ebert, T.; Kralisch, S.; Hoffmann, A.; Kratzsch, J.; Schlögl, H.; Stumvoll, M.; Fasshauer, M. Circulating serum chemerin levels are elevated in lipodystrophy. Clin. Endocrinol. 2016, 84, 932–938. [Google Scholar] [CrossRef]
- Miehle, K.; Ebert, T.; Kralisch, S.; Hoffmann, A.; Kratzsch, J.; Schlögl, H.; Stumvoll, M.; Fasshauer, M. Progranulin is increased in human and murine lipodystrophy. Diabetes Res. Clin. Pract. 2016, 120, 1–7. [Google Scholar] [CrossRef]
- Wong, S.P.Y.; Huda, M.; English, P.; Bargiota, A.; Wilding, J.P.H.; Johnson, A.; Corrall, R.; Pinkney, J.H. Adipokines and the insulin resistance syndrome in familial partial lipodystrophy caused by a mutation in lamin A/C. Diabetologia 2005, 48, 2641–2649. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Foss-Freitas, M.C.; Ferraz, R.C.; Monteiro, L.Z.; Gomes, P.M.; Iwakura, R.; de Freitas, L.C.C.; Foss, M.C. Endoplasmic reticulum stress activation in adipose tissue induces metabolic syndrome in individuals with familial partial lipodystrophy of the Dunnigan type. Diabetol. Metab. Syndr. 2018, 10, 6. [Google Scholar] [CrossRef] [PubMed]
- Druhan, L.J.; Lance, A.; Li, S.; Price, A.E.; Emerson, J.T.; Baxter, S.A.; Gerber, J.M.; Avalos, B.R. Leucine Rich α-2 Glycoprotein: A Novel Neutrophil Granule Protein and Modulator of Myelopoiesis. PLoS ONE 2017, 12, e0170261. [Google Scholar] [CrossRef] [PubMed]
- Choi, C.H.J.; Barr, W.; Zaman, S.; Model, C.; Park, A.; Koenen, M.; Lin, Z.; Szwed, S.K.; Marchildon, F.; Crane, A.; et al. LRG1 is an adipokine that promotes insulin sensitivity and suppresses inflammation. Elife 2022, 11, e81559. [Google Scholar] [CrossRef]
- Abe, I.; Shiga, H.; Chiba, H.; Miyazawa, T.; Oomori, S.; Shimoyama, Y.; Moroi, R.; Kuroha, M.; Kakuta, Y.; Kinouchi, Y.; et al. Serum leucine-rich alpha-2 glycoprotein as a predictive factor of endoscopic remission in Crohn’s disease. J. Gastroenterol. Hepatol. 2022, 37, 1741–1748. [Google Scholar] [CrossRef]
- Shinzaki, S.; Matsuoka, K.; Tanaka, H.; Takeshima, F.; Kato, S.; Torisu, T.; Ohta, Y.; Watanabe, K.; Nakamura, S.; Yoshimura, N.; et al. Leucine-rich alpha-2 glycoprotein is a potential biomarker to monitor disease activity in inflammatory bowel disease receiving adalimumab: PLANET study. J. Gastroenterol. 2021, 56, 560–569. [Google Scholar] [CrossRef]
- Aaron, N.; Kraakman, M.J.; Zhou, Q.; Liu, Q.; Costa, S.; Yang, J.; Liu, L.; Yu, L.; Wang, L.; He, Y.; et al. Adipsin promotes bone marrow adiposity by priming mesenchymal stem cells. Elife 2021, 10, e69209. [Google Scholar] [CrossRef]
- Liu, J.-J.; Pek, S.L.T.; Ang, K.; Tavintharan, S.; Lim, S.C. Plasma Leucine-Rich α-2-Glycoprotein 1 Predicts Rapid eGFR Decline and Albuminuria Progression in Type 2 Diabetes Mellitus. J. Clin. Endocrinol. Metab. 2017, 102, 3683–3691. [Google Scholar] [CrossRef]
- Hong, Q.; Zhang, L.; Fu, J.; Verghese, D.A.; Chauhan, K.; Nadkarni, G.N.; Li, Z.; Ju, W.; Kretzler, M.; Cai, G.-Y.; et al. LRG1 Promotes Diabetic Kidney Disease Progression by Enhancing TGF-β-Induced Angiogenesis. J. Am. Soc. Nephrol. 2019, 30, 546–562. [Google Scholar] [CrossRef]
- Ceccarini, G.; Magno, S.; Gilio, D.; Pelosini, C.; Santini, F. Autoimmunity in lipodystrophy syndromes. Presse Med. 2021, 50, 104073. [Google Scholar] [CrossRef]
- Zammouri, J.; Vatier, C.; Capel, E.; Auclair, M.; Storey-London, C.; Bismuth, E.; Mosbah, H.; Donadille, B.; Janmaat, S.; Fève, B.; et al. Molecular and Cellular Bases of Lipodystrophy Syndromes. Front. Endocrinol. 2021, 12, 803189. [Google Scholar] [CrossRef] [PubMed]
- Jéru, I. Genetics of lipodystrophy syndromes. Presse Med. 2021, 50, 104074. [Google Scholar] [CrossRef] [PubMed]
- Araújo-Vilar, D.; Fernández-Pombo, A.; Cobelo-Gómez, S.; Castro, A.I.; Sánchez-Iglesias, S. Lipodystrophy-associated progeroid syndromes. Hormones 2022, 21, 555–571. [Google Scholar] [CrossRef] [PubMed]
- de Oliveira, T.F.T.; Natal, M.R.C.; Teixeira, A.A.; Machado, B.B. Unusual magnetic resonance imaging findings of cystic bone lesions in congenital generalized lipodystrophy. J. Postgrad. Med. 2022, 68, 236–238. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
