Next Article in Journal
Effects of Dietary Inclusion of Enzymatically Hydrolyzed Compound Soy Protein on the Growth Performance and Intestinal Health of Juvenile American Eels (Anguilla rostrata)
Next Article in Special Issue
Characterization of Pseudomonas aeruginosa Isolated from Bovine Mastitis in Northern Jiangsu Province and Correlation to Drug Resistance and Biofilm Formability
Previous Article in Journal
A Novel Ultrasound-Guided Cervical Plexus Block: A Cadaveric Canine Study
Previous Article in Special Issue
Distribution of Bovine Mastitis Pathogens in Quarter Milk Samples from Bavaria, Southern Germany, between 2014 and 2023—A Retrospective Study
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Assessment of Bacterial Contamination and Antimicrobial Resistance of Escherichia coli Isolates from Slovak Dairy Farms

by
Nikola Dančová
,
Gabriela Gregová
and
Tatiana Szabóová
*
Department of Public Veterinary Medicine and Animal Welfare, The University of Veterinary Medicine and Pharmacy in Košice, 041 81 Košice, Slovakia
*
Author to whom correspondence should be addressed.
Animals 2024, 14(21), 3095; https://doi.org/10.3390/ani14213095
Submission received: 19 September 2024 / Revised: 22 October 2024 / Accepted: 25 October 2024 / Published: 26 October 2024

Simple Summary

Intensive livestock farming is now widespread around the world and is also a significant producer of pollutants. Emissions of airborne bacteria or bioaerosols affect not only the health of animals but also affect their products, which can have serious consequences for public health. In our study, we focused on the detection of bacterial pollution on three cattle farms located in Slovakia using a MAS-100 Eco® air sampler. A high total count of bacteria and molds in the air and deficiencies in the ventilation system were detected, which created suitable conditions for their survival. Microbial resistance poses another severe risk to global health. Antimicrobial-resistant bacteria carrying antimicrobial resistance genes can be introduced into the environment through animal feces. Ubiquitous E. coli is the most commonly used indicator bacteria for monitoring the spread of antimicrobial resistance and is a frequent carrier of various resistance genes to antimicrobial agents. We phenotypically and genotypically confirmed the resistance of E. coli isolated from cattle feces to the antimicrobial agents investigated. Our findings revealed the presence of multidrug-resistant E. coli strains.

Abstract

The conditions in livestock housing are suitable for the survival of airborne microorganisms, mainly due to high temperatures, humidity, and the presence of organic material. The total count of airborne bacteria concentrations in cattle farms ranged from 3.01 log10 CFU/mL to 6.90 log10 CFU/mL; for coliform bacteria, they were from 2.18 log10 CFU/mL to 3.34 log10 CFU/mL; and for molds, they ranged from 3.00 log10 CFU/mL to 4.57 log10 CFU/mL. Bacteria resistant to antimicrobial substances and resistance genes can be spread on animal farms. Antimicrobial resistance in ubiquitous Escherichia coli isolated from cattle feces was investigated. Minimum inhibitory concentration (MIC) testing was utilized to identify phenotypic resistance profiles, and the PCR method was employed to detect the presence of resistant genes. A higher percentage of resistance was found to amikacin (65%), tetracycline (61%), streptomycin (56%), ampicillin (55%), and nalidixic acid (45%). Multidrug resistance was determined in up to 64.3% of the isolates studied. The most widespread resistance genes were blaTEM (85.7%), sul2 (66.7%), tetB (52.38%), and sul1 (47.6%). We found that 4.8% of the E. coli isolates had the blaCMY gene. We found that, despite phenotypic resistance, E. coli isolates do not necessarily carry genes conferring resistance to that particular antimicrobial agent.

1. Introduction

The dairy industry plays a vital role in the agricultural sector of the Slovak Republic, contributing significantly to the economy and the population’s nutrition [1]. However, intensive animal husbandry releases high concentrations of air pollutants such as bioaerosols into the environment. In agricultural livestock housing, bioaerosols are a complex mixture of organic dust, biologically active components (e.g., endotoxins and mycotoxins), and microorganisms (e.g., bacteria, fungi, and viruses). The emission and transport of bioaerosols are associated with the development of diseases in animals and also negatively affect the health of farmers and residents of the surrounding areas of livestock enterprises [2].
The concentrations and types of microorganisms in indoor livestock housing air are affected by technical factors (i.e., the type and age of a building), the number of inhabitants, the heating and ventilation systems, and microclimatic conditions such as the temperature, relative humidity, gas concentration, lighting, and dust concentration. Improper working practices and unhygienic conditions may be causes of considerable microbial air pollution [3]. In particular, bacteria are very abundant on farms, with the most important reservoirs and vectors being the farm animals and their feces [2]. Pathogenic zoonotic bacteria in the environment of animal farms include Staphylococcus spp., Enterococcus spp., E. coli, Salmonella spp., Campylobacter spp., Listeria spp., Pseudomonas spp., and others [4]. Animal feed is often contaminated with molds, especially those of the genera Aspergillus, Penicillium, Fusarium, Mucor, or Cladosporium [3].
For these reasons, farm animals are given antimicrobial substances for the treatment and prevention of several infectious diseases. In the past, these agents were also given to promote their growth. The overuse and misuse of antimicrobial substances in animal husbandry have significantly contributed to the emergence and spread of antimicrobial resistance in bacteria, such as E. coli. The use of antimicrobials in the livestock industry is substantially greater than in human medicine, with an estimated annual consumption of over 60,000 tons in intensive livestock farms worldwide. Furthermore, resistant bacteria can be shed and released into the environment, posing a risk of spreading antimicrobial resistance according to the concept of “One Health” [5].
The majority of E. coli strains are non-harmful bacteria that coexist with humans, animals, and birds in their digestive systems. These commensal forms of E. coli are widely present on farms and are commonly used to monitor the spread of antimicrobial resistance in various environments and host species. They also frequently carry different antimicrobial resistance genes. Nonetheless, E. coli can also be harmful and cause a variety of intestinal or extra-intestinal infections [6,7]. The current presence of multidrug-resistant E. coli worldwide is alarming. Until recently, E. coli was susceptible to almost all clinically important antimicrobial drugs. However, this bacterium has shown an impressive ability to receive and donate resistance genes, mainly through horizontal gene transfer. The most problematic mechanisms in E. coli strains involve gaining genes resistant to β-lactams. Furthermore, E. coli originating from animals frequently exhibits resistance to other antimicrobial agents, such as tetracyclines, quinolones, aminoglycosides, phenicols, sulfonamides, trimethoprim, and fosfomycin. Reports of E. coli resistance to colistin have also emerged from various parts of the world [8].
Animal feces are commonly utilized as fertilizer to enhance the nutrient content of agricultural soils. However, animals release many microorganisms in their feces, particularly two prevalent zoonotic bacterial species, E. coli, and Salmonella spp. The application of untreated feces as fertilizer presents a significant risk of environmental contamination, including that of soil, crops, water, and air, with resistant microorganisms, antimicrobial resistance genes, and antimicrobial residues [4]. According to Gou et al. [9], following the administration of antimicrobial substances to farm animals, 75–90% of these substances are excreted into the environment through urine and feces. Antimicrobial resistance in the farm environment and the potential for its further spread are becoming increasingly concerning as part of the “One Health” concept, which connects the health of humans, animals, and the environment. Antimicrobial-resistant E. coli poses a threat to animal health, which also raises worries for human health since these resistant strains can disseminate through the food chain or through direct animal contact [10].
The aim of this study was to determine the level of air pollution of bacteria and molds in the livestock environment in order to estimate the health risk of microbiological air pollution. In addition, we aimed to isolate E. coli from cattle feces and to perform phenotypic and genotypic analysis of the antimicrobial resistance of these bacteria.

2. Materials and Methods

2.1. Collection, Processing and Identification

This study was carried out in 2023 on three dairy cattle farms in the eastern part of the Slovak Republic. On average, the farms housed approximately 200 dairy cows in free-range housing in boxes with deep bedding and natural ventilation. Samples of the air and feces were taken from the animal houses. Using a MAS-100 Eco® air sampler (Merck, Darmstadt, Germany), aerosol samples were taken directly into Petri dishes containing the following agars: Meat Peptone Agar (HiMedia, Mumbai, India), Endo Agar (HiMedia, Mumbai, India), and Sabouraud Agar (Oxoid, Basingstoke, UK). The selective media and incubation conditions applied to carry out microbiological analysis are presented in Table 1. The counts of microorganisms were adjusted using the correction tables and recalculated per 1 m3 of air. The microclimate’s physical parameters were also measured using a thermo-hygrometer (Testo, Titisee-Neustadt, Germany) to record the ambient temperature and relative humidity throughout the day.
Seventy samples of feces were collected as soon as possible after defecation in sterile plastic specimen boxes and transported to the laboratory under aseptic conditions. After being weighed and diluted 1:10 with distilled water, the samples were homogenized. Following the guidelines of ISO 6887-1 [11], a series of ten-fold dilutions were made from the stock suspension and applied to the surface of Meat Peptone Agar (HiMedia, Mumbai, India), Endo Agar (HiMedia, Mumbai, India), and HiCrome Universal Agar (HiMedia, Mumbai, India). The selected culture media were used to identify E. coli. Prepared plates were incubated at 37 °C for 24 h. E. coli bacteria on the surface of Endo Agar formed pink to pinkish-red colonies during lactose fermentation, with a typical metallic sheen. On the surface of HiCrome Universal Agar, due to the production of the enzyme ß-galactosidase, which cleaves chromogenic substrate, characteristic purple colonies were formed. On the surface of Meat Peptone Agar, E. coli formed large, smooth, white-gray, disk-like mucoid colonies. Enterotest 24 N (Erba Lachema, Brno, Czech Republic) was used to detect and identify the suspected E. coli colonies. A single colony of E. coli was isolated from each sample.

2.2. Antimicrobial Resistance Analysis

The minimum inhibitory concentration (MIC) testing was performed according to Gattringer et al. [12] using the automated diagnostic system Miditech (Bel-Miditech, Bratislava, Slovakia). This diagnostic system consisted of the following antimicrobial substances: ampicillin (AMP), ampicillin + sulbactam (A + IB), ertapenem (ETP), meropenem (MEM), ceftriaxon (CTR), ceftiofur (CFF), ceftazidime + clavulanic acid (CAC), cefquinome (CFQ), gentamicin (GEN), streptomycin (STM), neomycin (NEO), nalidixic acid (NAL), enrofloxacin (ENR), amikacin (AMI), ciprofloxacin (CIP), chloramphenicol (CMP), florfenicol (FLO), tetracycline (TET), co-trimoxazole (COT), and colistin (COL). The results of the MIC values of each antimicrobial substance were interpreted using the EUCAST (14.0 version) [13] clinical breakpoints. MIC xG values represent the geometric mean of antimicrobial MIC values (mg/L) in E. coli isolates, as described in our previous study [14].
Genomic DNA of E. coli isolates was extracted using the Bacteria DNA Preparation—Solution Kit (Jena Bioscience, Jena, Germany) from overnight cultures grown on Nutrient agar, according to the manufacturer’s instructions. The acquired DNA was analyzed with a NanoDrop One spectrophotometer (Thermo Fisher Scientific, Madison, WI, USA). E. coli isolates were subjected to species identification using the PCR method according to Amit-Romach et al. [15]. Antimicrobial resistance genes were detected by polymerase chain reactions (PCRs). The PCR programs began with an initial denaturation step at 94 °C/95 °C lasting 3–15 min, followed by 28 to 35 cycles of DNA denaturation at 94 °C/95 °C for 30–60 s, primer annealing at 54–68 °C (depending on the primers) for 25–60 s, and primer extension at 72 °C for 25 s to 2 min. Following the final cycle, a final extension step at 72 °C for 4–10 min was included. The presence of the following genes was monitored: tetracycline resistance genes—tetA and tetB; quinolone resistance genes—qnrA, qnrB, and qnrS; genes for resistance to sulfonamides—sul1 and sul2; β-lactamase-encoding blaTEM and blaSHV; and the ampicillinase gene—blaCMY. All the primers used for the PCR detection of resistance genes in this study are displayed in Table 2. Detection of amplified PCR products was performed by electrophoresis (Thermo Fisher Scientific, Marietta, OH, USA; Major Science, Saratoga, CA, USA) on 1.5% agarose gels with the addition of GoodViewTM fluorescent dye (Amplia s.r.o., Bratislava, Slovak Republic), followed by visualization using a UV transilluminator (Major Science, Saratoga, CA, USA).

3. Results and Discussion

3.1. Microbial Contaminations and Microclimate Conditions

Intensive animal production is associated with increased production, increased risk of various diseases, and the accumulation of waste, which can negatively affect the environment of the farm itself, including the areas near these farms [22]. The massive overgrowth of airborne microbial communities in livestock production negatively affects animal health, productivity, and welfare, as well as the safety of the food produced [23]. Farmworkers are also exposed to a variety of harmful substances (both organic and inorganic) that lead to respiratory diseases [24].
The microorganism numbers in the air samples and the microclimatic conditions on the cattle farms are presented in Table 3.
Szulc et al. [25] report that an average of 4.4 × 104–1.5 × 107 CFU/m3 of microorganisms are found in the air of cattle farm premises. In our study, the concentrations of the total count of bacteria in the cattle farms ranged from 3.01 ± 0.8 log10 CFU/mL for calves in milk nutrition period to 6.90 ± 4.1 log10 CFU/mL for heifers. We found relatively low concentrations of coliform bacteria (2.18 ± 0.4–3.7 ± 2.7 log10 CFU/mL of sample). In the environments with a higher total count of bacteria and molds in the air, deficiencies in the ventilation system were detected, which created suitable conditions for their survival. In general, we found higher numbers of all the studied microorganisms in the air than previously observed by Szulc et al. [25] in cattle on a farm located in central Poland.
In a study by Lange et al. [26], it was found that feed and bedding materials are sources of bioaerosol on dairy farms. The study explored bioaerosol concentrations in a total of 48 dairy cattle barns and demonstrated that the concentrations of different groups of microorganisms varied between the barns by two to three orders of magnitude. They also found that among all the farm management practices, the type of fodder had the strongest correlation with the microorganism concentration. The authors revealed that the feed containing the most moisture, such as bulk feed, has the lowest levels of dust and bacteria in the air. This can be attributed to the fact that aerosols from moist feed settle at a higher rate compared to those from dry feed due to hydration. The type of ventilation was also shown to affect the concentrations of Gram-negative bacteria, dust, and endotoxins in the barns.
In confinement livestock housing, effective ventilation is necessary to supply oxygen, eliminate moisture and odors, avoid heat accumulation, and reduce airborne microorganisms [9].

3.2. Antimicrobial Resistance of E. coli Isolates

According to previous research, cattle are an important source of antimicrobial-resistant bacteria [6].
A dominant percentage of resistance was observed to the aminoglycoside AMI (65%). High levels of resistance were also found against TET (61%), STM (56%), and AMP (55%). Resistance to quinolones was also confirmed for NAL (45%), CIP (11%), and ENR (5%). The MIC levels for AMP (MIC > 22 mg/L), STM (MIC > 21 mg/L), and AMI (MIC > 24 mg/L) were higher compared with the EUCAST clinical breakpoint [13] for AMP (MIC > 8 mg/L), STM (MIC > 16 mg/L), and AMI (MIC > 8 mg/L).
Multidrug resistance (MDR), i.e., resistance to three or more antimicrobial agents from different groups, occurred in up to 64.3% of the isolates studied. The prevalence of MDR E. coli found in cattle from Romania is also high (68%) compared to that in cattle from France (38%) [6].
A positive result was the 100% sensitivity of the investigated isolates to carbapenems (ertapenem and meropenem) and chloramphenicol. Currently, carbapenem resistance in the Enterobacterales family is a growing and ubiquitous threat to global health [27].
The Miditech system automatically generated the following phenotypic mechanisms of resistance during interpretive reading: AGL AAC (6′)I (42%), i.e., incomplete quinolone cross-resistance also conferring resistance to kanamycin; quinolone resistance (20%); penicillinase resistance (19%); multiresistance (13%); and ESBL, i.e., extended-spectrum β-lactamases (6%). The resistance to the tested antimicrobials with the corresponding MIC xG values and the resistance mechanisms in seventy E. coli isolates detected in the cattle feces samples are shown in Figure 1.
The most prevalent infectious disease in dairy animals is mastitis, which has a major negative financial impact on the dairy sector. β-lactams (penicillin, cefapirin, ceftiofur, amoxicillin, hetacillin, and cloxacillin), macrolides (erythromycin), coumarins (novobiocin), and lincosamides (pirlimycin) are among the antimicrobials used to treat it. Infections of the respiratory tract or foot, as well as metritis in dairy cows, are other prevalent infectious diseases in cattle. Ceftiofur and other β-lactams, tylosin, tilmicosin, florfenicol, tetracyclines, and sulfadimethoxine are frequently used to treat respiratory diseases or metritis. Antimicrobial agents such as tetracyclines, lincomycin, β-lactams, and sulfonamides are used to treat foot infections [28].
Twenty-one isolates were selected because they showed resistance to at least one antimicrobial substance, as per the MIC results, or the system automatically generated a probable resistance mechanism for them.
Several different ESBL genes, such as the blaTEM, blaSHV, and blaCTX-M genes present in bacterial plasmids, encode the ESBL enzyme in E. coli [29]. In our study, the most widespread gene was blaTEM, which we confirmed in 85.7% of the examined isolates; the blaSHV gene was detected in more than 23% of the examined isolates. We also detected the presence of the blaCMY gene in 4.8% of the E. coli isolates. The blaCMY ampC β-lactamase genes confer broad-spectrum resistance to β-lactam antimicrobial agents, including ceftriaxone and ceftiofur, as well as to β-lactamase inhibitors such as clavulanic acid, posing a potential risk to public health [30]. The blaTEM gene was found to be prevalent in E. coli obtained from cattle and dairy samples in a livestock farm in Japan. However, none of the samples investigated were positive for the genes blaCTX-M-1, blaCTX-M-2, blaCTX-M-8, and blaCTX-M-9 [5].
The molecular detection of the sul1 and sul2 genes resistant to sulfamethoxazole showed a higher prevalence of sul2 (66.7%) compared to the sul1 gene (47.6%). Similar results were found by Shoaib et al. [31], who identified the sul2 gene in 67.3%, sul1 in 27.9%, and sul3 in 18.1% of tested E. coli from samples from a dairy environment.
Resistance to tetracycline is very common in E. coli strains isolated from dairy cattle and farm environments, as is the prevalence of genes that confer resistance to tetracyclines [32]. In our study, 14.3% of the tetA and 52.4% of the tetracycline-resistant (tetB) genes were detected. Our results are also consistent with the findings of Shoaib et al. [31], in which the tetB gene was more abundant (70.4%) compared with the tetA (11.2%) and tetD (0.0%) genes. In addition to tetA and tetB, Kerluku et al. [7] discovered tetC genes in E. coli that were isolated from dairy cows’ feces.
Furthermore, plasmid-mediated quinolone resistance (PMQR) was also observed, as indicated by the presence of qnrA (23.8%), qnrB (9.5%), and qnrS (23.8%) genes in resistant E. coli isolates. In the study conducted by Kerluku et al. [7], the qnrA gene, responsible for quinolone resistance, was found to have a prevalence of 38.46%. Shoaib et al. [31] discovered a low occurrence of qnr genes (qnrB 0.34%; qnrS 9.43%) in E. coli isolates.
As reported by Kerluku et al. [7], the most common resistance genes in E. coli from livestock were genes for resistance to ampicillin (blaTEM, blaSHV, and blaCMY), tetracyclines (tetA and tetB), co-trimoxazole (sulfamethoxazole (sul1, sul2, and sul3) trimethoprim (dfrA1 and dfrA17)), aminoglycosides (aph(3″)-Ia, aph(6)-Id, and aac(3)-IV), and quinolones (qnrA and aac(6′)-Ib-cr). E. coli strains derived from calves have the primary genes blaCMY, blaCTX-M, mphA, ermB, aac(6′)Ib-cr, and qnrS, which confer resistance to AmpC, macrolides, aminoglycosides, and quinolones.
Despite the confirmed phenotypic resistance, not all isolates in our study had the corresponding antimicrobial resistance gene present. The correlation between phenotype and genotype is complex and depends on the methods, antimicrobials, and targets used. When comparing the results of phenotypic and genotypic resistance detection, three common scenarios can occur: (1) the genotype correlates with the phenotype; (2) a resistance gene is detected in an isolate, but phenotypic testing indicates that the isolate is susceptible to the drug; (3) phenotypic testing indicates that the isolate is resistant to the antimicrobial, but the resistance gene is not detected [33]. Several authors believe that a genetic change (mutations or acquisition of genes by horizontal transfer) is required to acquire phenotypic resistance. However, there are also situations where bacteria become temporarily resistant to antimicrobial substances without a genetic change. The most studied are drug indifference, the growth of biofilms, and the phenomenon of persistence. The induction of specific resistance mechanisms, such as chromosomally encoded β-lactamases, can also lead to increased resistance. Additionally, a resistant phenotype can result from a large inoculum that is heterogeneously resistant [34].
Table 4 summarizes the antimicrobial resistance profiles of selected E. coli isolates. A visualization of the amplified DNA fragments of some of the PCRs performed is shown in Figure 2.
Description:
(A)
L1—standard GeneRuler 100 bp DNA ladder, L2—positive control, L3—negative control, L4—L7 isolates positive for 16S rRNA gene (585 bp);
(B)
L1—standard GeneRuler 100 bp DNA ladder, L2—positive control, L3—negative control, L4—L7 isolates positive for blaTEM gene (858 bp);
(C)
L1—standard GeneRuler 100 bp DNA ladder, L2—positive control (tetA), L3—positive control (tetB), L4—negative control, L5 and L6—isolates positive for tetA gene (372 bp), L7—isolate positive for tetB gene (228 bp);
(D)
L1—standard GeneRuler 100 bp DNA ladder, L2—positive control (qnrA), L3—positive control (qnrB), L4—positive control (qnrS), L5—negative control, L6—isolate positive for qnrA gene (516 bp), L7—isolate positive for qnrB gene (469 bp), L8—isolate positive for qnrS gene (417 bp).

4. Conclusions

The presence of increased concentrations of microorganisms on livestock farms can affect the quality of the environment and use air as a means of spreading. We noticed a high total number of bacteria and molds in the air of diary housing facilities. This was caused by deficiencies in the ventilation system, which created suitable conditions for their survival. Therefore, it is crucial to pay special attention to the air quality as a significant source of pollution for farms and their surroundings.
Despite restrictions in the administration of antimicrobials to livestock, we found the increased resistance of E. coli to various antimicrobials, including β-lactams, aminoglycosides, quinolones, and tetracyclines. The application of such untreated cattle manure to soil can introduce resistant E. coli, which may contaminate the soil or crops. Also, the improper management or application of cattle manure can lead to the leaching of pathogens into groundwater sources.
It is essential to implement effective farm management practices, such as maintaining hygiene and managing manure, to minimize the risk of transmitting antimicrobial-resistant bacteria to humans. This should be accompanied by the decreased usage of antimicrobials in dairy cows. Furthermore, a comprehensive One Health strategy is required to tackle antimicrobial resistance in humans, animals, and the environment.

Author Contributions

Conceptualization, N.D. and G.G.; methodology, N.D., G.G., and T.S.; validation, N.D. and T.S.; formal analysis, N.D., G.G., and T.S.; investigation, N.D., G.G., and T.S.; resources, G.G. and T.S.; data curation, N.D. and G.G.; writing—original draft preparation, N.D. and G.G.; writing—review and editing, N.D. and T.S.; visualization, N.D. and G.G.; supervision, G.G.; funding acquisition, G.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Cultural and Educational Grant Agency of the Ministry of Education and Science of the Slovak Republic (project KEGA 001UVLF-4/2022). It was also supported by the Slovak Research and Development Agency (grant number APVV-23-0488).

Institutional Review Board Statement

In our study, the Ethics Committee at the University of Veterinary Medicine and Pharmacy in Kosice no. EKVP 2022/05 approved all experimental procedures following EU legislation 2010/63/EU, article 1:5 (practices not likely to cause pain, suffering, distress, or lasting harm equivalent to or higher than that caused by the introduction of a needle in accordance with good veterinary practice).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Farkašová, M.; Országhová, D. Slovakia’s Self-sufficiency in Selected Food Products. In Proceedings of the Sustainable, Resilient and Fair Food Systems in the EU and Globally International Scientific Symposium, Bratislava - Nitra, Slovak Republic, 6–7 October 2022. [Google Scholar]
  2. Ru, L.; Ding, L.; Deng, S.; Li, Q.; Zhao, W.; Wang, R.; Li, J.; Lu, Y.; Yao, C. Distribution characteristics and factors influencing culturable bacterial bioaerosols on a dairy farm in northern China. Agriculture 2023, 13, 1752. [Google Scholar] [CrossRef]
  3. Karwowska, E. Microbiological air contamination in farming environment. Pol. J. Environ. Stud. 2005, 14, 445–449. [Google Scholar]
  4. Jeżak, K.; Kozajda, A. Occurrence and spread of antibiotic-resistant bacteria on animal farms and in their vicinity in Poland and Ukraine—Review. Environ. Sci. Pollut. Res. 2022, 29, 9533–9559. [Google Scholar] [CrossRef] [PubMed]
  5. Khishigtuya, T.; Matsuyama, H.; Suzuki, K.; Watanabe, T.; Nishiyama, M. Prevalence of antibiotic-resistant Escherichia coli isolated from beef cattle and dairy cows in a livestock farm in Yamagata, Japan. Microorganisms 2024, 12, 1342. [Google Scholar] [CrossRef]
  6. Tabaran, A.; Soulageon, V.; Chirila, F.; Reget, O.L.; Mihaiu, M.; Borzan, M.; Dan, S.D. Pathogenic E. coli from cattle as a reservoir of resistance genes to various groups of antibiotics. Antibiotics 2022, 11, 404. [Google Scholar] [CrossRef]
  7. Kerluku, M.; Ratkova Manovska, M.; Prodanov, M.; Stojanovska-Dimzoska, B.; Hajrulai-Musliu, Z.; Jankuloski, D.; Blagoevska, K. Phenotypic and genotypic analysis of antimicrobial resistance of commensal Escherichia coli from dairy cows’ feces. Processes 2023, 11, 1929. [Google Scholar] [CrossRef]
  8. Poirel, L.; Madec, J.; Lupo, A.; Schink, A.; Kieffer, N.; Nordmann, P.; Schwarz, S. Antimicrobial resistance in Escherichia coli. Microbiol. Spectr. 2018, 6, 10–1128. [Google Scholar] [CrossRef]
  9. Guo, L.; Zhao, B.; Jia, Y.; He, F.; Chen, W. Mitigation strategies of air pollutants for mechanical ventilated livestock and poultry housing—A review. Atmosphere 2022, 13, 452. [Google Scholar] [CrossRef]
  10. Wang, H.; Qi, J.F.; Qin, R.; Ding, K.; Graham, D.W.; Zhu, Y.G. Intensified livestock farming increases antibiotic resistance genotypes and phenotypes in animal feces. Commun. Earth Environ. 2023, 4, 123. [Google Scholar] [CrossRef]
  11. ISO Standard 6887-1; Microbiology of the Food Chain—Preparation of Test Samples, Initial Suspension and Decimal Dilutions for Microbiological Examination—Part 1: General Rules for the Preparation of the Initial Suspension and Decimal Dilutions. Slovak Standards Institute: Bratislava, Slovakia, 2017.
  12. Gattringer, R.; Niks, M.; Ostertag, R.; Schwarz, K.; Medvedovic, H.; Graninger, W.; Georgopoulos, A. Evaluation of MIDITECH automated colorimetric MIC reading for antimicrobial susceptibility testing. J. Antimicrob. Chemother. 2002, 49, 651–659. [Google Scholar] [CrossRef]
  13. European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 14.0. 2024. Available online: https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_14.0_Breakpoint_Tables.pdf (accessed on 1 January 2024).
  14. Gregová, G.; Kmeť, V.; Szabóová, T. New insight on antibiotic resistance and virulence of Escherichia coli from municipal and animal wastewater. Antibiotics 2021, 10, 1111. [Google Scholar] [CrossRef] [PubMed]
  15. Amit-Romach, E.; Sklan, D.; Uni, Z. Microflora ecology of the chicken intestine using 16S ribosomal DNA primers. Poult. Sci. 2004, 83, 1093–1098. [Google Scholar] [CrossRef]
  16. Guillaume, G.; Verbrugge, D.; Chasseur-Libotte, M.L.; Moens, W.; Collard, J. PCR typing of tetracycline resistance determinants (tetA-E) in Salmonella enterica serotype Hadar and in the microbial community of activated sludges from hospital and urban wastewater treatment facilities in Belgium. FEMS Microbiol. Ecol. 2000, 32, 77–85. [Google Scholar] [CrossRef] [PubMed]
  17. Robicsek, A.; Strahilevitz, J.; Sahm, D.F.; Jacoby, G.A.; Hooper, D.C. Qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother. 2006, 50, 2872–2874. [Google Scholar] [CrossRef]
  18. Kerrn, M.B.; Klemmensen, T.; Frimodt-Møller, N.; Espersen, F. Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteraemia, and distribution of sul genes conferring sulphonamide resistance. J. Antimicrob. Chemother. 2002, 50, 513–516. [Google Scholar] [CrossRef]
  19. Yates, C.; Brown, D.J.; Edwards, G.F.S.; Amyes, S.G.B. Detection of TEM-52 in Salmonella enterica serovar Enteritidis isolated in Scotland. J. Antimicrob. Chemother. 2004, 53, 407–408. [Google Scholar] [CrossRef]
  20. Socohou, A.; Adjobimey, T.; Nanoukon, C.H.; Sina, H.; Kakossou, M.; Moussé, W.; Adjanohoun, A.; Baba-Moussa, L. Genetic diversity and virulence factors of Gram-negative bacilli isolated at the CHU-Z in Abomey-Calavi/So-Ava (Benin). Sci. Afr. 2022, 18, e01426. [Google Scholar] [CrossRef]
  21. Pérez-Pérez, F.J.; Hanson, N.D. Detection of plasmid-mediated AmpC β-lactamase genes in clinical isolates by using multiplex PCR. J. Clin. Microbiol. 2002, 40, 2153–2162. [Google Scholar] [CrossRef] [PubMed]
  22. Clark, B.; Panzone, L.A.; Stewart, G.B.; Kyriazakis, I.; Niemi, J.K.; Latvala, T.; Tranter, R.; Jones, P.; Frewer, L.J. Consumer attitudes towards production diseases in intensive production systems. PLoS ONE 2019, 14, e0210432. [Google Scholar] [CrossRef]
  23. Lou, C.H.; Bai, Y.; Chai, T.; Yu, H.; Lin, T.; Hu, G.; Guan, Y.; Wu, B. Research progress on distribution and exposure risk of microbial aerosols in animal houses. Front. Vet. Sci. 2022, 9, 1015238. [Google Scholar] [CrossRef]
  24. Smit, L.A.M.; Heederik, D. Impacts of intensive livestock production on human health in densely populated regions. GeoHealth 2017, 1, 272–277. [Google Scholar] [CrossRef] [PubMed]
  25. Szulc, J.; Okrasa, M.; Dybka-Stępień, K.; Sulyok, M.; Nowak, A.; Otlewska, A.; Szponar, B.; Majchrzycka, K. Assessment of microbiological indoor air quality in cattle breeding farms. Aerosol Air Qual. Res. 2020, 20, 1353–1373. [Google Scholar] [CrossRef]
  26. Lange, J.L.; Thorne, P.S.; Kullman, G.J. Determinants of culturable bioaerosol concentrations in dairy barns. Ann. Agric. Environ. Med. 1997, 4, 187–194. [Google Scholar]
  27. Black, C.A.; Benavides, R.; Bandy, S.M.; Dallas, S.D.; Gawrys, G.; So, W.; Moreira, A.G.; Aguilar, S.; Quidilla, K.; Smelter, D.F.; et al. Diverse role of blaCTX-M and porins in mediating ertapenem resistance among carbapenem-resistant Enterobacterales. Antibiotics 2024, 13, 185. [Google Scholar] [CrossRef]
  28. Virto, M.; Santamarina-Garcia, G.; Amores, G.; Hernandéz, I. Antibiotics in dairy production: Where is the problem? Dairy 2022, 3, 541–564. [Google Scholar] [CrossRef]
  29. Widodo, A.; Lamid, M.; Effendi, M.H.; Tyasningsih, V.; Raharjo, D.; Khairullah, A.R.; Kurniawan, S.C.; Yustinasari, L.R.; Riwu, K.H.P.; Silaen, O.S.M. Molecular identification of blaTEM and blaCTX-M genes in multidrug-resistant Escherichia coli found in milk samples from dairy cattle farms in Tulungagung, Indonesia. J. Vet. Res. 2023, 67, 381–388. [Google Scholar] [CrossRef]
  30. Heider, L.C.; Hoet, A.E.; Wittum, T.E.; Khaitsa, M.L.; Love, B.C.; Huston, C.L.; Morley, P.S.; Funk, J.A.; Gebreyes, W.A. Genetic and phenotypic characterization of the blaCMY gene from Escherichia coli and Salmonella enterica isolated from food-producing animals, humans, the environment, and retail meat. Foodborne Pathog. Dis. 2009, 6, 1235–1240. [Google Scholar] [CrossRef]
  31. Shoaib, M.; He, Z.; Geng, X.; Tang, M.; Hao, R.; Wang, S.; Shang, R.; Wang, X.; Zhang, H.; Pu, W. The emergence of multi-drug resistant and virulence gene carrying Escherichia coli strains in the dairy environment: A rising threat to the environment, animal, and public health. Front. Microbiol. 2023, 14, 1197579. [Google Scholar] [CrossRef]
  32. Sobur, M.A.; Sabuj, A.A.M.; Sarker, R.; Rahman, A.M.M.T.; Kabir, S.M.L.; Rahman, M.T. Antibiotic-resistant Escherichia coli and Salmonella spp. associated with dairy cattle and farm environment having public health significance. Vet. World 2019, 12, 984–993. [Google Scholar] [CrossRef]
  33. Yee, R.; Bard, J.D.; Simner, P.J. The genopype-to-phenotype dilemma: How should laboratories approach discordant susceptibility results? J. Clin. Microbiol. 2021, 59, e00138-20. [Google Scholar] [CrossRef]
  34. Corona, F.; Martinez, J.L. Phenotypic resistance to antibiotics. Antibiotics 2013, 2, 237–255. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Percentage of resistance and MIC xG values (a); mechanism of resistance (b) in E. coli isolates from cattle feces.
Figure 1. Percentage of resistance and MIC xG values (a); mechanism of resistance (b) in E. coli isolates from cattle feces.
Animals 14 03095 g001
Figure 2. Detection of selected genetic determinants in E. coli isolates by PCR.
Figure 2. Detection of selected genetic determinants in E. coli isolates by PCR.
Animals 14 03095 g002
Table 1. Selective media and incubation conditions used in this study.
Table 1. Selective media and incubation conditions used in this study.
Selective MediumMicroorganismsIncubation
Temperature [°C]Time [h]
Meat Peptone AgarTotal count of bacteria3724
Endo AgarColiform bacteria3724
Sabouraud AgarMolds2272
Table 2. Primers used in this study.
Table 2. Primers used in this study.
GenePrimer Sequences (5′–3′)Annealing Temperature (°C)Product Size (bp)References
16S rRNAGACCTCGGTTTAGTTCACAGA
CACACGCTGACGCTGACCA
55585[15]
tetAGGCCTCAATTTCCTGACG
AAGCAGGATGTAGCCTGTGC
54372[16]
tetBGAGACGCAATCGAATTCGG
TTTAGTGGCTATTCTTCCTGCC
54228
qnrAATTTCTCACGCCAGGATTTG
GATCGGCAAAGGTTAGGTCA
57516[17]
qnrBGATCGTGAAAGCCAGAAAGG
ACGATGCCTGGTAGTTGTCC
57469
qnrSACGACATTCGTCAACTGCAA
TAAATTGGCACCCTGTAGGC
57417
sul1CGGCGTGGGCTACCTGAACG
GCCGATCGCGTGAAGTTCCG
55433[18]
sul2GCGCTCAAGGCAGATGGCATT
GCGTTTGATACCGGCACCCGT
68293
blaTEMATGAGTATTCAACATTTCCG
CCAATGCTTAATCAGTGAGG
55858[19]
blaSHVATGCGTTATATTCGCCTGTG
TTAGCGTTGCCAGTGCTC
57400[20]
blaCMYTGGCCAGAACTGACAGGCAAA
TTTCTCCTGAACGTGGCTGGC
64462[21]
Description: E. coli identification = 16S rRNA; resistance to tetracycline = tetA, tetB; quinolone resistance = qnrA, qnrB, qnrS; sulfonamide resistance = sul1, sul2; β-lactamase-encoding blaTEM, blaSHV; and ampicillinase—blaCMY.
Table 3. Average values of concentrations of microorganisms and microclimate parameters in cattle houses.
Table 3. Average values of concentrations of microorganisms and microclimate parameters in cattle houses.
Place of SamplingTCBCBMoldsT [°C]RH [%]
log10 CFU/mL
Delivery room5.72 ± 2.33.34 ± 1.34.33 ± 2.110.8 ± 1.275.4 ± 6.1
Calves in milk nutrition period3.01 ± 0.82.39 ± 1.03.00 ± 1.17.7 ± 0.886.7 ± 10.3
Calves in vegetable nutrition period4.13 ± 1.72.78 ± 0.94.16 ± 2.48.9 ± 2.777.3 ± 5.7
Dairy cows4.91 ± 1.23.15 ± 1.54.05 ± 2.86.5 ± 3.490.5 ± 6.4
Gravid cows4.21 ± 2.62.18 ± 0.44.03 ± 1.710.1 ± 4.169.9 ± 7.2
Heifers6.90 ± 4.13.7 ± 2.74.57 ± 2.27.4 ± 1.788.2 ± 9.8
Values are expressed as average numerical data ± standard deviation. Abbreviations: TCB = total counts of bacteria; CB = coliform bacteria; CFU/g = colony forming units per 1 g of sample; T = temperature; RH = relative humidity.
Table 4. Antimicrobial resistance profiles in selected E. coli isolates.
Table 4. Antimicrobial resistance profiles in selected E. coli isolates.
No. of IsolatePhenotypic ResistanceMechanism of ResistanceGenotypic Resistance
1AMP, CFT, TZL, NAL, STM, AMI, COTMultiresistanceqnrS, blaTEM, sul1, sul2
2CFT, TZL, STM, AMI, CIPAGL AAC (6′)IqnrS
3AMP, CFT, TZL, STM, CIP, TETMultiresistance;
AGL AAC (6′)I
tetA, blaTEM, qnrA
4AMP, GEN, STM, TET, COTPenicillinase resistancetetB, blaTEM, sul1, sul2
5AMP, CFT, CTR, CFQESBLwithout genes
6AMP, A + IB, CFT, CTR, TZL, CFQ, GEN, STM, CIP, TET, COTESBL; multiresistancetetA, tetB, qnrA, blaTEM, blaCMY, sul1, sul2
7AMP, CIP, TETPenicillinase resistancetetB, qnrA, blaTEM, sul2
8AMP, NAL, TETQuinolone resistancetetA, qnrA, blaTEM, sul1, sul2
9AMP, A + IB, CFT, CTR, CFQ, TET, COL, COTESBL; quinolone
resistance; multiresistance
blaTEM, sul1, sul2
10AMP, A + IB, CFT, CTR, NAL, TET, COL, COTMultiresistance;
quinolone resistance
blaTEM, blaSHV, sul1, sul2
Abbreviations: AMP = ampicillin; A + IB = ampicillin+sulbactam; CFT = ceftiofur; CFQ = cefquinome; CTR = ceftriaxon; TZL = ceftazidime+clavulanic acid; GEN = gentamycin; AMI = amikacin; STM = streptomycin; NAL = nalidixic acid; CIP = ciprofloxacin; TET = tetracycline; COT = co-trimoxazole; COL = colistin.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Dančová, N.; Gregová, G.; Szabóová, T. Assessment of Bacterial Contamination and Antimicrobial Resistance of Escherichia coli Isolates from Slovak Dairy Farms. Animals 2024, 14, 3095. https://doi.org/10.3390/ani14213095

AMA Style

Dančová N, Gregová G, Szabóová T. Assessment of Bacterial Contamination and Antimicrobial Resistance of Escherichia coli Isolates from Slovak Dairy Farms. Animals. 2024; 14(21):3095. https://doi.org/10.3390/ani14213095

Chicago/Turabian Style

Dančová, Nikola, Gabriela Gregová, and Tatiana Szabóová. 2024. "Assessment of Bacterial Contamination and Antimicrobial Resistance of Escherichia coli Isolates from Slovak Dairy Farms" Animals 14, no. 21: 3095. https://doi.org/10.3390/ani14213095

APA Style

Dančová, N., Gregová, G., & Szabóová, T. (2024). Assessment of Bacterial Contamination and Antimicrobial Resistance of Escherichia coli Isolates from Slovak Dairy Farms. Animals, 14(21), 3095. https://doi.org/10.3390/ani14213095

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop