Next Article in Journal
Toxocara canis- and Toxocara cati-Induced Neurotoxocarosis Is Associated with Comprehensive Brain Transcriptomic Alterations
Next Article in Special Issue
Nonhemolytic Listeria monocytogenes—Prevalence Rate, Reasons Underlying Atypical Phenotype, and Methods for Accurate Hemolysis Assessment
Previous Article in Journal
The Impact of the COVID-19 Pandemic Lockdown on Pediatric Infections—A Single-Center Retrospective Study
Previous Article in Special Issue
Whole-Genome Sequencing Characterization of Virulence Profiles of Listeria monocytogenes Food and Human Isolates and In Vitro Adhesion/Invasion Assessment
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Modelling the Potential Risk of Infection Associated with Listeria monocytogenes in Irrigation Water and Agricultural Soil in Two District Municipalities in South Africa

by
Chidozie Declan Iwu
1,2,*,
Chinwe Juliana Iwu-Jaja
3,
Rami Elhadi
4,
Lucy Semerjian
4 and
Anthony Ifeanyin Okoh
1,2,4
1
SAMRC Microbial Water Quality Monitoring Centre, University of Fort Hare, Alice 5700, South Africa
2
Applied and Environmental Microbiology Research Group, Department of Biochemistry and Microbiology, University of Fort Hare, Alice 5700, South Africa
3
Division of Health Systems and Public Health, Department of Global Health, Stellenbosch University, Stellenbosch 7600, South Africa
4
Department of Environmental Health Sciences, University of Sharjah, Sharjah P.O. Box 27272, United Arab Emirates
*
Author to whom correspondence should be addressed.
Microorganisms 2022, 10(1), 181; https://doi.org/10.3390/microorganisms10010181
Submission received: 7 December 2021 / Revised: 23 December 2021 / Accepted: 24 December 2021 / Published: 14 January 2022
(This article belongs to the Special Issue An Update on Listeria monocytogenes)

Abstract

Listeria monocytogenes (L. monocytogenes) is the etiologic agent of listeriosis which significantly affects immunocompromised individuals. The potential risk of infection attributed to L. monocytogenes in irrigation water and agricultural soil, which are key transmission pathways of microbial hazards to the human population, was evaluated using the quantitative microbial risk assessment modelling. A Monte Carlo simulation with 10,000 iterations was used to characterize the risks. High counts of L. monocytogenes in irrigation water (mean: 11.96 × 102 CFU/100 mL; range: 0.00 to 56.67 × 102 CFU/100 mL) and agricultural soil samples (mean: 19.64 × 102 CFU/g; range: 1.33 × 102 to 62.33 × 102 CFU/g) were documented. Consequently, a high annual infection risk of 5.50 × 10−2 (0.00 to 48.30 × 10−2), 54.50 × 10−2 (9.10 × 10−3 to 1.00) and 70.50 × 10−2 (3.60 × 10−2 to 1.00) was observed for adults exposed to contaminated irrigation water, adults exposed to contaminated agricultural soil and children exposed to agricultural soil, respectively. This study, therefore, documents a huge public health threat attributed to the high probability of infection in humans exposed to L. monocytogenes in irrigation water and agricultural soil in Amathole and Chris Hani District Municipalities in the Eastern Cape province of South Africa.

1. Introduction

L. monocytogenes is a ubiquitous Gram-positive bacterium naturally occurring in agrarian environments including soil, manure and water [1]. It is psychrotrophic, having the ability to grow below 7 °C under both aerobic and anaerobic conditions and at low levels of water activity in a wide range of pH (4.0–6.0) [2]. It can also persist under high salt concentration, hydrostatic pressure, oxidative stress and extreme energy levels [3]. These tenacious characteristics make L. monocytogenes a potential hazard in the food sector and a significant public health burden [4]. Once exposed, this pathogen causes severe illness due to its ability to induce its own phagocytosis and intracellular replication, cross the epithelial barriers and invade other healthy cells using virulence factors like hemolysins, phospholipases, internalins and surface protein actin A [5,6]. As a result, L. monocytogenes has become a model to study intracellular pathogens [7].
L. monocytogenes represents an unprecedented microbial hazard with public health significance, despite not being recognized as a popular cause of foodborne related illnesses [8]. It causes the disease listeriosis, which may be mild in healthy individuals or invasive in immunocompromised individuals, pregnant women, children and the elderly. While the mild form of listeriosis is characterized by flu-like symptoms, vomiting and diarrhoea, the invasive form is characterized by septicemia, meningitis, fetal infection, abortion and death [9]. The fatality rate of listeriosis is usually high, ranging from 20% to 40%, especially among the high-risk groups [10]. In South Africa, an astounding total of 1024 cases of listeriosis with a 28.6% fatality rate was recorded between 1 January 2017 and 24 April 2018, making it the largest listeriosis outbreak reported by the World Health Organization (WHO) [11].
The incidence rate of listeriosis in the population is generally low compared to other foodborne diseases. However, the distribution of L. monocytogenes in the environment is wide, with a high recovery rate in foods [8]. L. monocytogenes has been isolated from several ready-to-eat (RTE) foods such as ice cream [12], cheese [13], fish [14], meat pâté and meat products [15]. It has also been isolated from minimally processed fruits and vegetables such as caramel-apples [16], cantaloupe, bean sprouts [17], frozen vegetables [18] and packaged salads [19]. This is attributed to its ubiquitous nature in the food processing and agricultural environments [20].
L. monocytogenes is widely dispersed in the agroecosystem, especially in irrigation water sources, agricultural soil, vegetation and organic matters [21,22,23]. Many irrigation water sources harbour numerous enteric pathogens like L. monocytogenes which are introduced by pollutants like faecal materials, sewage, and soil particles [24]. The soil is also a known environmental niche for L. monocytogenes. This pathogen has been recovered from various soil samples in different locations, including mountainous areas, forest areas and grazing lands [1]. In the soil, L. monocytogenes exist naturally as saprophytes, but become pathogenic once present in human and animal cells [25].
The presence of L. monocytogenes in irrigation water and agricultural soil is detrimental to food safety and public health. A systematic risk assessment is therefore required to quantitatively predict the health risks posed by the presence of this pathogen in irrigation water and agricultural soil using information like the nature of the pathogen, its exposure routes and the health effects associated with the exposure [26]. To that effect, a quantitative microbial risk assessment (QMRA) modelling was carried out to predict the risks of infection attributed to L. monocytogenes in irrigation water and agricultural soil samples collected from Amathole and Chris Hani District Municipalities, Eastern Cape Province, South Africa. To the best of our knowledge, this is the first QMRA modelling of L. monocytogenes in irrigation water and agricultural soil to be carried out in the Province.

2. Materials and Methods

2.1. Study Area

This study was conducted in two District Municipalities of the Eastern Cape Province, South Africa. The Province is the second largest province in the country and agriculture is one of its major industries. Samples were collected from 14 sampling sites in Amathole District Municipality, which is situated in the central part of the province, as shown in Figure 1. Samples were also collected from five sampling sites in the Chris Hani District Municipality situated in the northern region of the province, as shown in Figure 2. As of 2016, Amathole District Municipality was made up of 862,000 people (12.3% of Eastern Cape population and 1.55% of South African population) [27] while Chris Hani District Municipality was made up of 849,000 people (12.0% of Eastern Cape population and 1.5% of South Africa population) as of 2017 [28].

2.2. Microbiological Analysis

Using the grab sampling technique, a total of 19 irrigation water samples and 13 agricultural soil samples were aseptically collected from the sampling sites in sterile sample bottles and plastic bags, respectively. The sampling was done in triplicate across all of the sampling sites. The collected samples were transported on ice to the laboratory for microbiological analysis.
To determine the viable counts of L. monocytogenes, all the samples were subjected to serial dilution, which was then followed by membrane filtration for irrigation water samples and the spread plate culture method for soil samples as described in our previous report [29]. All the analyses were done in triplicates and the culture was done using Chromogenic Listeria Agar (ISO) Base (Oxoid Ltd., Hampshire, UK) supplemented with OCLA (ISO) differential supplement (Oxoid Ltd., UK) and the OCLA (ISO) selective supplement (Oxoid Ltd., UK). The concentration of L. monocytogenes was expressed in CFU/100 mL of irrigation water samples and CFU/g of agricultural soil samples.
The polymerase chain reaction (PCR) was used to confirm the identities of the isolates by targeting the prs gene (specific for genus) and prfA gene (specific for species) following the description of [30]. Nine virulence genes commonly associated with L. monocytogenes were screened for in the confirmed isolates using PCR assays as described by [31]. These include inlA, inlB, inlC, inlJ, actA, hlyA, plcA, plcB, and iap. L. monocytogenes ATCC 9525 (ATCC; Manassas, VA, USA) was included in the PCR as a control strain. The primer sequences, the expected amplicon sizes and the cycling conditions used in all the PCR experiments are shown in Table 1.

2.3. Microbial Risk Modelling

The probability of infection associated with L. monocytogenes in irrigation water and agricultural soil from Amathole and Chris Hani DMs was estimated using a four-step science-based approach including hazard identification, hazard characterization, exposure assessment and risk characterization as described by Codex Alimentarius Commission (CAC) [36].

2.3.1. Hazard Identification

L. monocytogenes was selected to predict the health risks associated with contaminated irrigation water and agricultural soil. This pathogen was selected due to its high prevalence in the agricultural and food processing environments and its ability to be transmitted to the food chain where it can instigate severe foodborne related listeriosis. L. monocytogenes was also selected due to its significance in South Africa, having been implicated in the most severe form of listeriosis outbreak ever experienced globally [37].

2.3.2. Hazard Characterization

Hazard characterization was carried out to access the negative health outcomes associated with the occurrence of L. monocytogenes in irrigation water and agricultural soil, based on the assumption that a single cell of L. monocytogenes would cause an infection. This analysis defines the relationship between the dose of L. monocytogenes and the corresponding negative health effects on the exposed population [38]. The following equation [39] was used to determine the ingestion dose of L. monocytogenes.
D = (Iv × Mc)
where D represents the ingestion dose of L. monocytogenes, Iv represents the ingested volume of irrigation water and agricultural soil and Mc represents the mean viable counts of L. monocytogenes.
An “exponential dose-response model” [40] was used to evaluate the risk linked to L. monocytogenes as shown in the following equation;
Pinf = 1 − exp −rD
where Pinf represents the probability of infection that will occur in an individual exposed to a particular dose (D) of L. monocytogenes. D represents the ingestion dose of L. monocytogenes and r represents the probability that a single cell of L. monocytogenes will cause invasive listeriosis. In this equation, r is 1.91 × 10−10 which is constant for L. monocytogenes [41].

2.3.3. Exposure Assessment

Exposure assessment was carried out to describe the possible ways by which susceptible human populations are exposed to L. monocytogenes in irrigation water and agricultural soil as well as to model the number of exposures that exist between humans and L. monocytogenes. Factors such as the counts of pathogen in the environmental matrix, ingested volumes of the matrix, the viability of the pathogen, and the recovery efficacy of the methods were considered in the Exposure (E) assessment using the following equation [42]:
E = CR−1 IM
where E represents Exposure, C represents the counts of L. monocytogenes per 100 mL of irrigation water samples or per gram of soil samples, R represents the recovery efficacy of the isolation method, I represents the fraction of L. monocytogenes capable of causing severe infection, and M represents the amount of irrigation water and soil ingested unintentionally per day. Recovery efficacy (R) was considered to prevent the underestimation of the concentration of the pathogen as well as the exposure [42]. It was estimated using the equation below:
R = (Po − P/Po) × 100
where “Po” represents the presumptive counts of L. monocytogenes isolates in irrigation water and agricultural soil samples and “P” represents the confirmed isolates following cultural and molecular methods. The parameters inputted for exposure assessment are shown in Table 2

2.3.4. Risk Characterization

Risk characterization was done to predict the annuitized risk of infection based on hazard identification, hazard characterization and exposure assessment using the annuitized probability of infection (Pinf/y) equation [39] as shown below.
Pinf/y = 1 − (1 − Pinf)E
where Pinf/y represents the yearly probability of infection, Pinf represents the probability of infection due to a single exposure to an ingested dose (D) of L. monocytogenes and E represents the exposure.
The risk associated with a single exposure to L. monocytogenes was evaluated using a Monte Carlo simulation with 10,000 iterations. The modelling was performed using R software version 3.0.3 (Development Core Team from Vienna, Austria) with the application of the R package (fitdistrplus) to fit the distribution of pathogen concentrations.

3. Results and Discussion

3.1. Hazard Identification and Concentration of L. monocytogenes in the Samples

In this study, the mean concentration of L. monocytogenes in irrigation water samples was 11.96 × 102 CFU/100 mL ranging from 0 to 56.67 × 102 CFU/100 mL as shown in Figure 3. This exceeded 0.0 CFU/100 mL standard set by the South African Department of Water Affairs (DWAF) for faecal coliforms in domestic water [45] and ≤100 CFU/100 mL standard set by the World Health Organization (WHO) for coliforms in wastewater used for agriculture and aquaculture [46]. This suggests that the irrigation waters within the study sites are not of great quality for agricultural activities, hence posing health risks to the exposed population. The findings are also consistent with our previous study which assessed the prevalence of Listeria spp. in river and irrigation water in the Eastern Cape Province of South Africa [47]. A higher mean concentration of L. monocytogenes was recorded in the agricultural soil samples, estimated at 19.64 × 102 CFU/g and ranging from 1.33 × 102 CFU/g to 62.33 × 102 CFU/g, as shown in Figure 3. This is not surprising, as L. monocytogenes is widely dispersed in the soil, also posing human health risks.
Of the 117 presumptive L. monocytogenes recovered from irrigation water samples and 183 presumptive L. monocytogenes isolated from agricultural soil samples, eight (6.8%) and 12 (6.6%) isolates were confirmed, respectively, following the molecular analyses. These findings are lower than the results of a previous study that recovered 11.2% L. monocytogenes from surface water used to irrigate fresh produce, [48] and a study that recovered 4 to 11% L. monocytogenes from the soil of fresh leafy produce production fields [49]. Although L. monocytogenes is almost always recovered in low numbers, they can cause a high rate of infection, especially among the immunocompromised population.
Interestingly, each of the confirmed isolates in this study harbored all the screened virulence genes, indicating that they are highly pathogenic and can cause severe infections in potential exposed populations. This corroborates previous studies that assessed the prevalence of virulence genes in L. monocytogenes isolated from various food and environmental matrices [31,50,51,52,53]. Generally, virulence genes in L. monocytogenes are usually implicated in the various phases of infection induced by the pathogen. For instance, hlyA, prfA and actA genes are involved with the spread of the pathogen between the cells of the host, the inlA, inlB, and inlJ genes are involved with invasion and adhesion, the plcA and plcB genes facilitate the release of the pathogen from bound vacuoles and the hlyA gene is also involved the release of the bacterial cells into the cells of the host [54].

3.2. Dose Modelling and Hazard Characterization

Table 3 shows the results of the dose modelling and hazard characterization of L. monocytogenes in irrigation water and agricultural soil in the study areas. A 2.30 × 10−6 daily risk (probability) of infection was estimated for adults ingesting 11.97 × 103 doses of L. monocytogenes from irrigation water. The daily risk of infection was 1.10 × 10−5 at maximum ingestion dose of 56.67 × 103 and 0.00 at minimum ingestion dose of 0.00. These estimates were based on the assumption that adults intentionally or unintentionally ingest 10 mL of contaminated irrigation water per day [43]. A higher daily risk of infection (4.12 × 10−3) attributed to E. coli in unprotected spring water was recorded in a previous study assuming the ingestion volume was 500 mL [55]. This shows that ingestion volume is correlated to the daily risk of infection. The probability of infection in children was not recorded in this study because the parameter for the ingested volume of irrigation water by children was not available.
Also, a 1.90 × 10−5 daily risk of infection was recorded for adults ingesting 98.21 × 103 doses of L. monocytogenes from agricultural soil. The probability of infection was 1.30 × 10−6 at minimum ingestion dose of 6.67 × 103 and 6.00 × 10−5 at maximum ingestion dose of 311.67 × 103. These estimates were based on the assumption that adults intentionally or unintentionally ingest 50 mg of contaminated soil per day [44]. These estimates were lower than those obtained in a previous study for other enteric pathogens like E. coli (6.38 × 10−2) and Salmonella spp. (2.43 × 10−1) in contaminated soil [55]. In children, a 3.80 × 10−5 probability of infection was recorded at an ingestion dose of 196.41 × 103. The probability of infection was 2.50 × 10−6 at minimum ingestion dose of 13.33 × 103 and 1.20 × 10−4 at maximum ingestion dose of 623.33 × 103. These estimates were also based on the assumption that children intentionally or unintentionally ingest 100 mg of contaminated soil per day [44].
It has been shown that the probability of infection attributed to pathogens in the environment depends on certain factors such as the pathogenicity of the pathogen, the ingestion dose of the pathogen, and the exposure routes to the pathogen [55].

3.3. Exposure Assessment

In this study, the patterns of human exposure to L. monocytogenes in irrigation water and agricultural soil is shown in Figure 4. One of the common routes of exposure is via the ingestion of fresh produce contaminated by L. monocytogenes in irrigation water and agricultural soil. This potentially puts the lives of farmers, their family members, consumers, distributors and processors in danger. Steele et al. indicated that contaminated irrigation water is a significant source of fresh produce contamination, correlating to the rise in the frequency of foodborne infections [56]. Smith et al. also indicated that L. monocytogenes in the soil can be transferred to fresh produce via splashes of soil during rainfall or irrigation, human activities, direct contact of plant surfaces with the soil and through machinery [57]. Other possible exposure routes include the unintentional ingestion, inhalation and dermal contact of contaminated irrigation water and soil particles, therefore putting the lives of farmers, their family members and co-workers at risk. Furthermore, children and community members playing in the soil, swimming and collecting water from irrigation water sources for other domestic purposes have their lives at risk when exposed to L. monocytogenes via ingestion, dermal contact and inhalation.
Considering the parameters inputted for the evaluation of exposure, a 12.87 × 103 exposure with a range of 0.00 to 60.93 × 103 was documented for adults exposed to L. monocytogenes in irrigation water as shown in Table 4. Alternatively, a 105.60 × 103 exposure with a range of 7.17 × 103 to 335.13 × 103 was documented for adults exposed to L. monocytogenes in agricultural soil, while a 211.19 × 103 exposure with a range of 14.34 × 103 to 670.25 × 103 was recorded for children exposed to L. monocytogenes in agricultural soil as shown in Table 4. Numerically, this indicates that people, especially children are more likely to be exposed to L. monocytogenes in agricultural soil than in irrigation water, thus increasing their risks of infection.

3.4. Risk Characterization

The annual risk of infection in adults exposed to L. monocytogenes from irrigation water was 5.50 × 10−2 with a range of 0.00 to 48.30 × 10−2 as shown in Table 5. This exceeded the WHO permissible standard for the annual tolerable reference level of human health risk attributed to drinking water (1 × 10−4) [58] and that attributed to excreta and greywater used for agricultural activities (1 × 10−6 DALY) [59]. This suggests that the irrigation water in this study is of unacceptable quality and poses health risks to the exposed population. A similar finding was recorded in a previous study that used rotavirus as a model organism to estimate the annual risk of infection attributed to irrigation water [60]. Furthermore, a QMRA simulation predicted a high mean risk of infection (8.10 × 10−6 per month) attributed to L. monocytogenes in RTE vegetables [61]. The finding was attributed to the pervasiveness of L. monocytogenes in the environment, which is consistent with our findings.
The annual risk of infection in adults exposed to L. monocytogenes from agricultural soil was 54.50 × 10−2 with a range of 9.10 × 10−3 to 1.00, while the annual risk of infection in children exposed to L. monocytogenes from agricultural soil was 70.50 × 10−2 with a range of 3.60 × 10−2 to 1.00 as shown in Table 5. A similar annual risk of 5.47 × 10−1 attributed to other enteric pathogens like E. coli in open space contaminated soil, which is a playground for children, was documented in a previous study [55]. However, a much higher annual risk of 9.65 × 10−1 attributed to Salmonella spp. in the same soil was documented [55].
The odds of listeriosis occurring while infected with L. monocytogenes is low. However, this pathogen is more likely to cause more devastating effects on pregnant women and their neonates, elderly ones and those with a weakened immune system [62]. Unfortunately, the Eastern Cape Province of South Africa is the second-largest province, yet the most impoverished [63]. The province has a high burden of diseases such as HIV, tuberculosis (TB), HIV/TB coinfection and multidrug-resistant TB (MDR-TB) [64]. This predisposes the residents to the worst outcomes of listeriosis, whose probability of occurring is high and thus calls for urgent attention from relevant stakeholders and risk managers.
To the best of our knowledge, this study was the first to be conducted in the Eastern Cape Province, South Africa. It was not, however, without limitations. The study employed a more general approach by assuming that every exposed individual will ingest the same amount of contaminated irrigation water and agricultural soil, thus having the same risk of infection. This is, however, not always the case, since certain factors such as age and behaviour can affect the amount of contaminated irrigation water and agricultural soil that is ingested. Moreover, certain factors such as age, immune status, infectious dose, gender and co-morbidities can influence the outcome of exposure to pathogens in the environmental matrix [58]. Since the model predicts the risk per annum, the sample size was low, and the grab sampling did not factor in potential exposure fluctuations due to seasonality.

4. Conclusions

The findings of this study indicated that the concentration of L. monocytogenes in irrigation water and agricultural soil samples collected from Amathole and Chris Hani District Municipalities were high, consequently leading to a high annual risk of infection among the exposed population. This poses a huge public health risk and requires urgent control measures. Outcomes from the study may help risk managers apply appropriate and timely interventions to control the health risks.

Author Contributions

Conceptualization, C.D.I. and A.I.O.; methodology, C.D.I.; software, C.D.I.; formal analysis, C.D.I.; resources, A.I.O.; data curation, C.D.I.; writing—original draft preparation, C.D.I.; writing—review and editing, C.D.I., C.J.I.-J., R.E., L.S., A.I.O.; supervision, A.I.O.; funding acquisition, R.E., L.S., A.I.O. All authors have read and agreed to the published version of the manuscript.

Funding

We are grateful to the South African Medical Research Council and the Department of Science and Technology of South Africa, and United States Agency for International Development for financial support.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Linke, K.; Rückerl, I.; Brugger, K.; Karpiskova, R.; Walland, J.; Muri-Klinger, S.; Tichy, A.; Wagner, M.; Stessl, B. Reservoirs of Listeria Species in Three Environmental Ecosystems. Appl. Environ. Microbiol. 2014, 80, 5583–5592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Barba, F.J.; Koubaa, M.; do Prado-Silva, L.; Orlien, V.; Sant’Ana, A.D.S. Mild processing applied to the inactivation of the main foodborne bacterial pathogens: A review. Trends Food Sci. Technol. 2017, 66, 20–35. [Google Scholar] [CrossRef] [Scilit]
  3. Bae, D.; Mezal, E.H.; Smiley, R.D.; Cheng, C.-M.; Khan, A.A. The sub-species characterization and antimicrobial resistance of Listeria monocytogenes isolated from domestic and imported food products from 2004 to 2011. Food Res. Int. J. 2014, 64, 656–663. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Reda, W.W.; Abdel-Moein, K.; Hegazi, A.; Mohamed, Y.; El-Razik, K.A. Listeria monocytogenes: An emerging food-borne pathogen and its public health implications. J. Infect. Dev. Ctries. 2016, 10, 149–154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Matereke, L.T.; Okoh, A.I. Listeria monocytogenes Virulence, Antimicrobial Resistance and Environmental Persistence: A Review. Pathogens 2020, 9, 528. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Kathariou, S. Listeria monocytogenes Virulence and Pathogenicity, a Food Safety Perspective. J. Food Prot. 2002, 65, 1811–1829. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Vivant, A.-L.; Garmyn, D.; Piveteau, P. Listeria monocytogenes, a down-to-earth pathogen. Front. Cell. Infect. Microbiol. 2013, 3, 87. [Google Scholar] [CrossRef] [Scilit]
  8. Buchanan, R.L.; Gorris, L.; Hayman, M.M.; Jackson, T.C.; Whiting, R.C. A review of Listeria monocytogenes: An update on outbreaks, virulence, dose-response, ecology, and risk assessments. Food Control 2017, 75, 1–13. [Google Scholar] [CrossRef] [Scilit]
  9. Kayode, A.J.; Igbinosa, E.O.; Okoh, A. Overview of listeriosis in the Southern African Hemisphere—Review. J. Food Saf. 2019, 40, e12732. [Google Scholar] [CrossRef] [Scilit]
  10. Gohar, S.; Abbas, G.; Sajid, S.; Sarfraz, M.; Ali, S.; Ashraf, M.; Aslam, R.; Yaseen, K. Prevalence and antimicrobial resistance of Listeria monocytogenes isolated from raw milk and dairy products. Matrix Sci. Medica 2017, 1, 10–14. [Google Scholar] [CrossRef] [Scilit]
  11. WHO World Health Organization. Listeriosis–South Africa. Available online: https://www.who.int/csr/don/02-may-2018-listeriosis-south-africa/en/ (accessed on 23 December 2020).
  12. Li, Z.; Pérez-Osorio, A.; Wang, Y.; Eckmann, K.; Glover, W.A.; Allard, M.W.; Brown, E.W.; Chen, Y. Whole genome sequencing analyses of Listeria monocytogenes that persisted in a milkshake machine for a year and caused illnesses in Washington State. BMC Microbiol. 2017, 17, 134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Chen, Y.; Luo, Y.; Carleton, H.; Timme, R.; Melka, D.; Muruvanda, T.; Wang, C.; Kastanis, G.; Katz, L.S.; Turner, L.; et al. Whole Genome and Core Genome Multilocus Sequence Typing and Single Nucleotide Polymorphism Analyses of Listeria monocytogenes Isolates Associated with an Outbreak Linked to Cheese, United States, 2013. Appl. Environ. Microbiol. 2017, 83, e00633-17. [Google Scholar] [CrossRef] [Scilit]
  14. Schjørring, S.; Lassen, S.G.; Jensen, T.; Moura, A.; Kjeldgaard, J.S.; Müller, L.; Thielke, S.; Leclercq, A.; Maury, M.M.; Tourdjman, M.; et al. Cross-border outbreak of listeriosis caused by cold-smoked salmon, revealed by integrated surveillance and whole genome sequencing (WGS), Denmark and France, 2015 to 2017. Eurosurveillance 2017, 22, 17–00762. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Gelbíčová, T.; Zobaníková, M.; Tomáštíková, Z.; Van Walle, I.; Ruppitsch, W.; Karpíšková, R. An outbreak of listeriosis linked to turkey meat products in the Czech Republic, 2012–2016. Epidemiol. Infect. 2018, 146, 1407–1412. [Google Scholar] [CrossRef] [Scilit]
  16. Angelo, K.M.; Conrad, A.R.; Saupe, A.; Dragoo, H.; West, N.; Sorenson, A.; Barnes, A.; Doyle, M.; Beal, J.; Jackson, K.A.; et al. Multistate outbreak of Listeria monocytogenes infections linked to whole apples used in commercially produced, prepackaged caramel apples: United States, 2014–2015. Epidemiol. Infect. 2017, 145, 848–856. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. CDC Centers for Disease Control and Prevention. List of Selected Multistate Foodborne Outbreak Investigations. Available online: https://www.cdc.gov/foodsafety/outbreaks/multistate-outbreaks/outbreaks-list.html (accessed on 25 March 2019).
  18. CDC Centers for Disease Control and Prevention. Multistate Outbreak of Listeriosis Linked to Frozen Vegetables (Final Update). Available online: https://www.cdc.gov/listeria/outbreaks/frozen-vegetables-05-16/index.html (accessed on 25 March 2019).
  19. CDC Centers for Disease Control and Prevention. Multistate Outbreak of Listeriosis Linked to Packaged Salads Produced at Springfield, Ohio Dole Processing Facility (Final Update). Available online: https://www.cdc.gov/listeria/outbreaks/bagged-salads-01-16/index.html (accessed on 25 March 2019).
  20. Iwu, C.D.; Okoh, A.I. Preharvest Transmission Routes of Fresh Produce Associated Bacterial Pathogens with Outbreak Potentials: A Review. Int. J. Environ. Res. Public Health 2019, 16, 4407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Komora, N.; Bruschi, C.; Magalhães, R.; Ferreira, V.B.; Teixeira, P. Survival of Listeria monocytogenes with different antibiotic resistance patterns to food-associated stresses. Int. J. Food Microbiol. 2017, 245, 79–87. [Google Scholar] [CrossRef] [Scilit]
  22. Allen, K.J.; Wałecka-Zacharska, E.; Chen, J.C.; Katarzyna, K.-P.; Devlieghere, F.; Van Meervenne, E.; Osek, J.; Wieczorek, K.; Bania, J. Listeria monocytogenes–An examination of food chain factors potentially contributing to antimicrobial resistance. Food Microbiol. J. 2016, 54, 178–189. [Google Scholar] [CrossRef] [Scilit]
  23. Wang, X.-M.; Lü, X.-F.; Yin, L.; Liu, H.-F.; Zhang, W.-J.; Si, W.; Yu, S.-Y.; Shao, M.-L.; Liu, S.-G. Occurrence and antimicrobial susceptibility of Listeria monocytogenes isolates from retail raw foods. Food Control 2013, 32, 153–158. [Google Scholar] [CrossRef] [Scilit]
  24. Rajwar, A.; Srivastava, P.; Sahgal, M. Microbiology of Fresh Produce: Route of Contamination, Detection Methods, and Remedy. Crit. Rev. Food Sci. Nutr. 2016, 56, 2383–2390. [Google Scholar] [CrossRef] [Scilit]
  25. Zhu, Q.; Gooneratne, S.R.; Hussain, M.A. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels. Foods 2017, 6, 21. [Google Scholar] [CrossRef] [Scilit]
  26. WHO World Health Organization. Quantitative Microbial Risk Assessment: Application for Water Safety Management. Available online: http://www.who.int/water_sanitation_health/publications/qmra/en/ (accessed on 25 April 2018).
  27. ECSECC Eastern Cape Socio Economic Consultative Council. Amathole District Municipality Socio Economic Review and Outlook, 2017; ECSECC Eastern Cape Socio Economic Consultative Council: East London, South Africa, 2017. [Google Scholar]
  28. CHDM about Us–Chris Hani District Municipality. Available online: https://www.chrishanidm.gov.za/municipality/about-us/ (accessed on 30 January 2021).
  29. Iwu, C.D.; Okoh, A.I. Characterization of antibiogram fingerprints in Listeria monocytogenes recovered from irrigation water and agricultural soil samples. PLoS ONE 2020, 15, e0228956. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Jami, S.; Jamshidi, A.; Khanzadi, S. The presence of Listeria monocytogenes in raw milk samples in Mashhad, Iran. Iran. J. Vet. Res. 2010, 11, 363–367. [Google Scholar]
  31. Du, X.-J.; Zhang, X.; Wang, X.-Y.; Su, Y.; Li, P.; Wang, S. Isolation and characterization of Listeria monocytogenes in Chinese food obtained from the central area of China. Food Control 2016, 74, 9–16. [Google Scholar] [CrossRef] [Scilit]
  32. Coroneo, V.; Carraro, V.; Aissani, N.; Sanna, A.; Ruggeri, A.; Succa, S.; Meloni, B.; Pinna, A.; Sanna, C. Detection of Virulence Genes and Growth Potential in Listeria monocytogenes Strains Isolated from Ricotta Salata Cheese. J. Food Sci. 2015, 81, M114–M120. [Google Scholar] [CrossRef] [Scilit]
  33. Liu, D.; Lawrence, M.L.; Austin, F.W.; Ainsworth, A.J. A multiplex PCR for species- and virulence-specific determination of Listeria monocytogenes. J. Microbiol. Methods 2007, 71, 133–140. [Google Scholar] [CrossRef] [Scilit]
  34. Lomonaco, S.; Patti, R.; Knabel, S.J.; Civera, T. Detection of virulence-associated genes and epidemic clone markers in Listeria monocytogenes isolates from PDO Gorgonzola cheese. Int. J. Food Microbiol. 2012, 160, 76–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Kaur, S.; Malik, S.V.S.; Vaidya, V.M.; Barbuddhe, S.B. Listeria monocytogenes in spontaneous abortions in humans and its detection by multiplex PCR. J. Appl. Microbiol. 2007, 103, 1889–1896. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. CAC Codex Alimentarius Commission. Principles and Guidelines for the Conduct of Microbiological Risk Management (MRM). Available online: http://www.fao.org/docrep/004/y1579e/y1579e05.htm (accessed on 26 April 2018).
  37. Smith, A.M.; Tau, N.P.; Smouse, S.L.; Allam, M.; Ismail, A.; Ramalwa, N.R.; Disenyeng, B.; Ngomane, M.; Thomas, J. Outbreak of Listeria monocytogenes in South Africa, 2017–2018: Laboratory Activities and Experiences Associated with Whole-Genome Sequencing Analysis of Isolates. Foodborne Pathog. Dis. 2019, 16, 524–530. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Haas, C.N.; Rose, J.B.; Gerba, C.P. Quantitative Microbial Risk Assessment; John Wiley & Sons, Inc.: New York, NY, USA, 1999; ISBN 9780471183976. [Google Scholar]
  39. Kouamé, P.K.; Nguyen-Viet, H.; Dongo, K.; Zurbrügg, C.; Biémi, J.; Bonfoh, B. Microbiological risk infection assessment using QMRA in agriculture systems in Côte d’Ivoire, West Africa. Environ. Monit. Assess. 2017, 189, 587. [Google Scholar] [CrossRef] [Scilit]
  40. Ding, T.; Iwahori, J.; Kasuga, F.; Wang, J.; Forghani, F.; Park, M.-S.; Oh, D.-H. Risk assessment for Listeria monocytogenes on lettuce from farm to table in Korea. Food Control 2012, 30, 190–199. [Google Scholar] [CrossRef] [Scilit]
  41. Franz, E.; Tromp, S.O.; Rijgersberg, H.; Van Der Fels-Klerx, H.J. Quantitative Microbial Risk Assessment for Escherichia coli O157:H7, Salmonella, and Listeria monocytogenes in Leafy Green Vegetables Consumed at Salad Bars. J. Food Prot. 2010, 73, 274–285. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Balderrama-Carmona, A.P.; Gortáres-Moroyoqui, P.; Álvarez-Valencia, L.H.; Castro-Espinoza, L.; Mondaca-Fernández, I.; Balderas-Cortés, J.D.J.; Chaidez-Quiroz, C.; Meza-Montenegro, M.M. Occurrence and quantitative microbial risk assessment of Cryptosporidium and Giardia in soil and air samples. Int. J. Infect. Dis. 2014, 26, 123–127. [Google Scholar] [CrossRef] [Scilit]
  43. Shuval, H.; Lampert, Y.; Fattal, B. Development of a risk assessment approach for evaluating wastewater reuse standards for agriculture. Water Sci. Technol. 1997, 35, 15–20. [Google Scholar] [CrossRef] [Scilit]
  44. U.S. EPA. Exposure Factors Handbook (1997, Final Report); U.S. Environmental Protection Agency: Washington, DC, USA, 1997.
  45. DWAF Department of Water Affairs and Forestry. South African Water Quality Guidelines. Domest. Water Use 2012, 1, 1–197. [Google Scholar]
  46. WHO World Health Organization. Health Guidelines for the Use of Wastewater in Agriculture and Aquaculture. Available online: https://apps.who.int/iris/bitstream/handle/10665/39401/WHO_TRS_778.pdf?sequence=1&isAllowed=y (accessed on 3 June 2020).
  47. Mpondo, L.; Ebomah, K.E.; Okoh, A.I. Multidrug-Resistant Listeria Species Shows Abundance in Environmental Waters of a Key District Municipality in South Africa. Int. J. Environ. Res. Public Health 2021, 18, 481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Falardeau, J.; Johnson, R.P.; Pagotto, F.; Wang, S. Occurrence, characterization, and potential predictors of verotoxigenic Escherichia coli, Listeria monocytogenes, and Salmonella in surface water used for produce irrigation in the Lower Mainland of British Columbia, Canada. PLoS ONE 2017, 12, e0185437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Weller, D.; Wiedmann, M.; Strawn, L.K. Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State. Appl. Environ. Microbiol. 2015, 81, 6059–6069. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Jamali, H.; Radmehr, B.; Thong, K.L. Prevalence, characterisation, and antimicrobial resistance of Listeria species and Listeria monocytogenes isolates from raw milk in farm bulk tanks. Food Control 2013, 34, 121–125. [Google Scholar] [CrossRef] [Scilit]
  51. Wang, G.; Qian, W.; Zhang, X.; Wang, H.; Ye, K.; Bai, Y.; Zhou, G. Prevalence, genetic diversity and antimicrobial resistance of Listeria monocytogenes isolated from ready-to-eat meat products in Nanjing, China. Food Control 2015, 50, 202–208. [Google Scholar] [CrossRef] [Scilit]
  52. Shi, W.; Qingping, W.; Jumei, Z.; Moutong, C.; Weipeng, G. Analysis of Multilocus Sequence Typing and Virulence Characterization of Listeria monocytogenes Isolates from Chinese Retail Ready-to-Eat Food. Front. Microbiol. 2016, 7, 168. [Google Scholar] [CrossRef] [Scilit]
  53. Olaniran, A.O.; Nzimande, S.B.T.; Mkize, N.G. Antimicrobial resistance and virulence signatures of Listeria and Aeromonas species recovered from treated wastewater effluent and receiving surface water in Durban, South Africa. BMC Microbiol. 2015, 15, 234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Poimenidou, S.V.; Dalmasso, M.; Papadimitriou, K.; Fox, E.; Skandamis, P.N.; Jordan, K. Virulence Gene Sequencing Highlights Similarities and Differences in Sequences in Listeria monocytogenes Serotype 1/2a and 4b Strains of Clinical and Food Origin from 3 Different Geographic Locations. Front. Microbiol. 2018, 9, 1103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Katukiza, A.Y.; Ronteltap, M.; van der Steen, P.; Foppen, J.W.; Lens, P.N.L. Quantification of microbial risks to human health caused by waterborne viruses and bacteria in an urban slum. J. Appl. Microbiol. 2013, 116, 447–463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Steele, M.; Odumeru, J. Irrigation Water as Source of Foodborne Pathogens on Fruit and Vegetables. J. Food Prot. 2004, 67, 2839–2849. [Google Scholar] [CrossRef] [Scilit]
  57. Smith, A.; Moorhouse, E.; Monaghan, J.; Taylor, C.; Singleton, I. Sources and survival of Listeria monocytogenes on fresh, leafy produce. J. Appl. Microbiol. 2018, 125, 930–942. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Fewtrell, L.; Bartram, J. Water quality: Guidelines, standards and health. In Assessment of Risk and Risk Management for Water-Related Infectious Diseases; Fewtrell, L., Bartram, J., Eds.; IWA Publishing: London, UK, 2001; Volume 6, pp. 1–124. [Google Scholar]
  59. WHO World Health Organization. Guidelines for the Safe use of Wastewater, Excreta and Greywater-Volume 4. Available online: http://www.who.int/water_sanitation_health/publications/gsuweg4/en/ (accessed on 18 January 2021).
  60. Forslund, A.; Ensink, J.H.J.; Markussen, B.; Battilani, A.; Psarras, G.; Gola, S.; Sandei, L.; Fletcher, T.; Dalsgaard, A. Escherichia coli contamination and health aspects of soil and tomatoes (Solanum lycopersicum L.) subsurface drip irrigated with on-site treated domestic wastewater. Water Res. 2012, 46, 5917–5934. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. Sant’Ana, A.S.; Franco, B.D.G.M.; Schaffner, D.W. Risk of infection with Salmonella and Listeria monocytogenes due to consumption of ready-to-eat leafy vegetables in Brazil. Food Control 2014, 42, 1–8. [Google Scholar] [CrossRef] [Scilit]
  62. CDC Centers for Disease Control and Prevention. People at Risk. Available online: https://www.cdc.gov/listeria/risk.html (accessed on 29 January 2021).
  63. NDA National Development Agency. State of Poverty and Its Manifestation in the Nine Provinces of South Africa; HSRC: Pretoria, South Africa, 2014. [Google Scholar]
  64. Obaromi, D.; Ndege, J.; Yongsong, Q. Disease mapping of tuberculosis prevalence in Eastern Cape Province, South Africa. J. Public Health 2019, 27, 241–248. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Map showing the sampling sites in Amathole District Municipality (grey area), Eastern Cape Province (red area), South Africa.
Figure 1. Map showing the sampling sites in Amathole District Municipality (grey area), Eastern Cape Province (red area), South Africa.
Microorganisms 10 00181 g001
Figure 2. Map showing the sampling sites in Chris Hani District Municipality (grey area), Eastern Cape Province (red area), South Africa.
Figure 2. Map showing the sampling sites in Chris Hani District Municipality (grey area), Eastern Cape Province (red area), South Africa.
Microorganisms 10 00181 g002
Figure 3. The microbial counts of L. monocytogenes in irrigation water and agricultural soil samples. Agricultural soil samples were not collected from S1, S4, S6, S10, S15 and S19.
Figure 3. The microbial counts of L. monocytogenes in irrigation water and agricultural soil samples. Agricultural soil samples were not collected from S1, S4, S6, S10, S15 and S19.
Microorganisms 10 00181 g003
Figure 4. The human exposure patterns showing possible ways humans can be exposed to L. monocytogenes in irrigation water and agricultural soil.
Figure 4. The human exposure patterns showing possible ways humans can be exposed to L. monocytogenes in irrigation water and agricultural soil.
Microorganisms 10 00181 g004
Table 1. Primer sequence, expected amplicon sizes and cycling conditions used in the detection of L. monocytogenes and screening of virulence genes.
Table 1. Primer sequence, expected amplicon sizes and cycling conditions used in the detection of L. monocytogenes and screening of virulence genes.
Primer Sequence (5′-3′)Target Genes Cycling ConditionsAmplicon Size (bp)References
F: GCTGAAGAGATTGCGAAAGAAG
R: CAAAGAAACCTTGGATTTGCGG
prs5 min 95 °C 35 [30 s 94 °C, 90 s 60 °C, 90 s 72 °C] 5 min 2 °C370[30]
F: GATACAGAAACATCGGTTGGC
R: GTGTAATCTTGATGCCATCAG
prfA5 min 95 °C 35 [30 s 94 °C, 90 s 60 °C, 90 s 72 °C] 5 min 2 °C274[30]
inlAF: CCTAGCAGGTCTAACCGCAC
inlAR: TCGCTAATTTGGTTATGCCC
inlA5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C256[32]
inlBF: TGATGTTGATGGAACGGTAAT
inlBR: CTCGTGGAAGTTTGTAGATGC
inlB5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C272[31]
inlCF: AATTCCCACAGGACACAACC
inlCR: CGGGAATGCAATTTTTCACTA
inlC5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C517[33]
inlJF: TGTAACCCCGCTTACACAGTT
inlJR: AGCGGCTTGGCAGTCTAATA
inlJ5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C238[33]
actAF: CCAAGCGAGGTAAATACGGGA
actAR: GTCCGAAGCATTTACCTCTTC
actA5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C650[34]
hlyF: ATCATCGACGGCAACCTCGGAGAC
hlyR: CACCATTCCCAAGCTAAACCAGTGC
hlyA5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C404[31]
plcAF: CTCGGACCATTGTAGTCATCTT
plcAR: CACTTTCAGGCGTATTAGAAACGA
plcA5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C326[34]
plcBF: AATATTTCAATCAATCGGTGGCTGA
plcBR: GGGTAGTCCGCTTTCGCTCTT
plcB5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C289[31]
iapF: ACAAGCTGCACCTGTTGCAG
iapR: TGACAGCGTGTGTAGTAGCA
iap5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C131[35]
Table 2. Parameters inputted for exposure assessment in adults and children.
Table 2. Parameters inputted for exposure assessment in adults and children.
Irrigation WaterAgricultural Soil
ParameterDataSourceParameterDataSource
Concentration (C) of L. monocytogenes (CFU/100 mL)Min: 0.00
Mean: 11.96 × 102
Max: 56.67 × 102
This studyConcentration (C) of L. monocytogenes (CFU/g)Min: 1.33 × 102
Mean: 19.64 × 102
Max: 62.33 × 102
This study
Recovery efficiency (R) (%)93This studyRecovery efficiency (R) (%)93This study
Proportion (I) of L. monocytogenes capable of causing severe infection (%)100This studyProportion (I) of L. monocytogenes capable of causing severe infection (%)100This study
Amount (M) of water ingested during farming (mL/day)10[43]Amount (M) of soil and dust ingested by adults (mg/day)50[44]
Amount (M) of water ingested by children during farmingNot given Amount (M) of soil and dust ingested by children (mg/day)100[44]
Min: Minimum, Max: Maximum.
Table 3. The daily probability of infection based on hazard characterization in irrigation water and agricultural soil samples.
Table 3. The daily probability of infection based on hazard characterization in irrigation water and agricultural soil samples.
ParameterIrrigation WaterAgricultural Soil
MinMeanMaxMinMeanMax
Ingestion dose (D) in adults0.0011.97 × 10356.67 × 1036.67 × 10398.21 × 103311.67 × 103
Ingestion dose (D) in children---13.33 × 103196.41 × 103623.33 × 103
Probability of infection (Pinf) in adults (daily risk)0.002.30 × 10−61.10 × 10−51.30 × 10−61.90 × 10−56.00 × 10−5
Probability of infection (Pinf) in children (daily risk)---2.50 × 10−63.80 × 10−51.20 × 10−4
Min: Minimum, Max: Maximum.
Table 4. The exposure parameters in adults and children.
Table 4. The exposure parameters in adults and children.
Irrigation WaterAgricultural Soil
ParameterDataData
Exposure (E) in adultsMin: 0.00
Mean: 12.87 × 103
Max: 60.93 × 103
Min: 7.17 × 103
Mean: 105.60 × 103
Max: 335.125 × 103
Exposure (E) in childrenNot determinedMin: 14.34 × 103
Mean: 211.19 × 103
Max: 670.25 × 103
Min: Minimum, Max: Maximum.
Table 5. The annual risk of infection due to ingestion of Listeria monocytogenes in irrigation water and agricultural soil.
Table 5. The annual risk of infection due to ingestion of Listeria monocytogenes in irrigation water and agricultural soil.
ParameterIrrigation WaterAgricultural Soil
MinMeanMaxMinMeanMax
Annual risk (Pinf/y) in adults0.005.50 × 10−248.30 × 10−29.10 × 10−354.50 × 10−21
Annual risk (Pinf/y) in children---3.60 × 10−270.50 × 10−21
Min: Minimum, Max: Maximum.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Iwu, C.D.; Iwu-Jaja, C.J.; Elhadi, R.; Semerjian, L.; Okoh, A.I. Modelling the Potential Risk of Infection Associated with Listeria monocytogenes in Irrigation Water and Agricultural Soil in Two District Municipalities in South Africa. Microorganisms 2022, 10, 181. https://doi.org/10.3390/microorganisms10010181

AMA Style

Iwu CD, Iwu-Jaja CJ, Elhadi R, Semerjian L, Okoh AI. Modelling the Potential Risk of Infection Associated with Listeria monocytogenes in Irrigation Water and Agricultural Soil in Two District Municipalities in South Africa. Microorganisms. 2022; 10(1):181. https://doi.org/10.3390/microorganisms10010181

Chicago/Turabian Style

Iwu, Chidozie Declan, Chinwe Juliana Iwu-Jaja, Rami Elhadi, Lucy Semerjian, and Anthony Ifeanyin Okoh. 2022. "Modelling the Potential Risk of Infection Associated with Listeria monocytogenes in Irrigation Water and Agricultural Soil in Two District Municipalities in South Africa" Microorganisms 10, no. 1: 181. https://doi.org/10.3390/microorganisms10010181

APA Style

Iwu, C. D., Iwu-Jaja, C. J., Elhadi, R., Semerjian, L., & Okoh, A. I. (2022). Modelling the Potential Risk of Infection Associated with Listeria monocytogenes in Irrigation Water and Agricultural Soil in Two District Municipalities in South Africa. Microorganisms, 10(1), 181. https://doi.org/10.3390/microorganisms10010181

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop