Aging and Caloric Restriction Modulate the DNA Methylation Profile of the Ribosomal RNA Locus in Human and Rat Liver
Abstract
:1. Introduction
2. Materials and Methods
2.1. Human Samples
2.2. Rat Samples
2.3. Quantitative DNA Methylation Analysis
2.4. Gene Expression Analysis
2.5. Statistical Analysis
3. Results
3.1. Age-Related Increase in DNA Methylation Levels of rDNA Genes in Rat and Human Liver
3.2. Impact of CR on the DNA Methylation Profiles of rDNA Locus during Aging
3.3. Impact of Aging and of CR on the Expression of the 45S Precursor and of the Rrn3 Gene.
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Appendix A
Name | Sequence |
RiboPromoter Fw Human | AGGAAGAGAGGTGTGTTTTGGGGTTGATTAGAG |
RiboPromoter Rv Human | CAGTAATACGACTCACTATAGGGAGAAGGCTAAAACCCAACCTCTCCAAC |
18S Fw Human | AGGAAGAGAGGTTTGTTGTTTTTTTTGGATGTGG |
18S Rv Human | CAGTAATACGACTCACTATAGGGAGAAGGCTCCTTACCTACCTAATTAATCCTACCAA |
28S Fw Human | AGGAAGAGAGGGTATTTAGTTTTAGATGGAGTTTATTATT |
28S Rv Human | CAGTAATACGACTCACTATAGGGAGAAGGCTAAAAAAAACTAACCAAAATTCCC |
RiboPromoter Fw Rat | AGGAAGAGAGTTTGTGAGTATTTAGGGTTTTAAGG |
RiboPromoter Rv Rat | CAGTAATACGACTCACTATAGGGAGAAGGCTCAACCTTAATACAAACCTCTTCCA |
18S Fw Rat | AGGAAGAGAGTTTGTTGTTTTTTTTGGATGTG |
18S Rv Rat | CAGTAATACGACTCACTATAGGGAGAAGGCTCTCCTTACCTAATTAATCCTACCAA |
28S Fw Rat | AGGAAGAGAGGGGGGTTTAAGTTTTTTTGAT |
28S Rv Rat | CAGTAATACGACTCACTATAGGGAGAAGGCTAACTACATTCCCAAACAACCC |
References
- Salazar-Roa, M.; Malumbres, M. Fueling the Cell Division Cycle. Trends Cell Biol. 2017, 27, 69–81. [Google Scholar] [CrossRef]
- Wang, Z.; Ying, Z.; Bosy-Westphal, A.; Zhang, J.; Schautz, B.; Later, W.; Heymsfield, S.B.; Müller, M.J. Specific metabolic rates of major organs and tissues across adulthood: Evaluation by mechanistic model of resting energy expenditure1234. Am. J. Clin. Nutr. 2010, 92, 1369–1377. [Google Scholar] [CrossRef]
- Boirie, Y.; Morio, B.; Caumon, E.; Cano, N.J. Nutrition and protein energy homeostasis in elderly. Mech. Ageing Dev. 2014, 136, 76–84. [Google Scholar] [CrossRef]
- Cevenini, E.; Caruso, C.; Candore, G.; Capri, M.; Nuzzo, D.; Duro, G.; Rizzo, C.; Colonna-Romano, G.; Lio, D.; Di Carlo, D.; et al. Age-related inflammation: The contribution of different organs, tissues and systems. How to face it for therapeutic approaches. Curr. Pharm. Des. 2010, 16, 609–618. [Google Scholar] [CrossRef]
- Gladyshev, V.N. Aging: Progressive decline in fitness due to the rising deleteriome adjusted by genetic, environmental, and stochastic processes. Aging Cell 2016, 15, 594–602. [Google Scholar] [CrossRef]
- Franceschi, C.; Valensin, S.; Bonafè, M.; Paolisso, G.; Yashin, A.I.; Monti, D.; De Benedictis, G. The network and the remodeling theories of aging: Historical background and new perspectives. Exp. Gerontol. 2000, 35, 879–896. [Google Scholar] [CrossRef]
- Bacalini, M.G.; D’Aquila, P.; Marasco, E.; Nardini, C.; Montesanto, A.; Franceschi, C.; Passarino, G.; Garagnani, P.; Bellizzi, D. The methylation of nuclear and mitochondrial DNA in ageing phenotypes and longevity. Mech. Ageing Dev. 2017, 165, 156–161. [Google Scholar] [CrossRef]
- Sen, P.; Shah, P.P.; Nativio, R.; Berger, S.L. Epigenetic Mechanisms of Longevity and Aging. Cell 2016, 166, 822–839. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stegeman, R.; Weake, V.M. Transcriptional Signatures of Aging. J. Mol. Biol. 2017, 429, 2427–2437. [Google Scholar] [CrossRef] [PubMed]
- Lai, R.W.; Lu, R.; Danthi, P.S.; Bravo, J.I.; Goumba, A.; Sampathkumar, N.K.; Benayoun, B.A. Multi-level remodeling of transcriptional landscapes in aging and longevity. BMB Rep. 2019, 52, 86–108. [Google Scholar] [CrossRef] [PubMed]
- Lehallier, B.; Gate, D.; Schaum, N.; Nanasi, T.; Lee, S.E.; Yousef, H.; Moran Losada, P.; Berdnik, D.; Keller, A.; Verghese, J.; et al. Undulating changes in human plasma proteome profiles across the lifespan. Nat. Med. 2019, 25, 1843–1850. [Google Scholar] [CrossRef] [PubMed]
- Conte, M.; Ostan, R.; Fabbri, C.; Santoro, A.; Guidarelli, G.; Vitale, G.; Mari, D.; Sevini, F.; Capri, M.; Sandri, M.; et al. Human Aging and Longevity Are Characterized by High Levels of Mitokines. J. Gerontol. Ser. A 2018, 74, 600–607. [Google Scholar] [CrossRef] [PubMed]
- Hamon, M.-P.; Ahmed, E.K.; Baraibar, M.A.; Friguet, B. Proteome Oxidative Modifications and Impairment of Specific Metabolic Pathways during Cellular Senescence and Aging. Proteomics 2019, e1800421. [Google Scholar] [CrossRef] [PubMed]
- Kaushik, S.; Cuervo, A.M. Proteostasis and aging. Nat. Med. 2015, 21, 1406–1415. [Google Scholar] [CrossRef]
- Swovick, K.; Welle, K.A.; Hryhorenko, J.R.; Seluanov, A.; Gorbunova, V.; Ghaemmaghami, S. Cross-species Comparison of Proteome Turnover Kinetics. Mol. Cell. Proteom. 2018, 17, 580–591. [Google Scholar] [CrossRef] [Green Version]
- Anisimova, A.S.; Alexandrov, A.I.; Makarova, N.E.; Gladyshev, V.N.; Dmitriev, S.E. Protein synthesis and quality control in aging. Aging 2018, 10, 4269–4288. [Google Scholar] [CrossRef]
- Gonskikh, Y.; Polacek, N. Alterations of the translation apparatus during aging and stress response. Mech. Ageing Dev. 2017, 168, 30–36. [Google Scholar] [CrossRef]
- Steffen, K.K.; Dillin, A. A Ribosomal Perspective on Proteostasis and Aging. Cell Metab. 2016, 23, 1004–1012. [Google Scholar] [CrossRef] [Green Version]
- Li, G.-W.; Burkhardt, D.; Gross, C.; Weissman, J.S. Quantifying absolute protein synthesis rates reveals principles underlying allocation of cellular resources. Cell 2014, 157, 624–635. [Google Scholar] [CrossRef] [Green Version]
- Henderson, A.S.; Warburton, D.; Atwood, K.C. Location of ribosomal DNA in the human chromosome complement. Proc. Natl. Acad. Sci. USA 1972, 69, 3394–3398. [Google Scholar] [CrossRef] [Green Version]
- Birch, J.L.; Zomerdijk, J.C.B.M. Structure and function of ribosomal RNA gene chromatin. Biochem. Soc. Trans. 2008, 36, 619–624. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Henras, A.K.; Plisson-Chastang, C.; O’Donohue, M.-F.; Chakraborty, A.; Gleizes, P.-E. An overview of pre-ribosomal RNA processing in eukaryotes. Wiley Interdiscip. Rev. RNA 2015, 6, 225–242. [Google Scholar] [CrossRef] [PubMed]
- McStay, B.; Grummt, I. The epigenetics of rRNA genes: From molecular to chromosome biology. Annu. Rev. Cell Dev. Biol. 2008, 24, 131–157. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Santoro, R.; Grummt, I. Epigenetic mechanism of rRNA gene silencing: Temporal order of NoRC-mediated histone modification, chromatin remodeling, and DNA methylation. Mol. Cell. Biol. 2005, 25, 2539–2546. [Google Scholar] [CrossRef] [Green Version]
- Santoro, R.; Li, J.; Grummt, I. The nucleolar remodeling complex NoRC mediates heterochromatin formation and silencing of ribosomal gene transcription. Nat. Genet. 2002, 32, 393–396. [Google Scholar] [CrossRef]
- Tanaka, Y.; Tsuneoka, M. Control of Ribosomal RNA Transcription by Nutrients. In Gene Expression and Regulation in Mammalian Cells—Transcription Toward the Establishment of Novel Therapeutics; BOD: Norderstedt, Germany, 2018. [Google Scholar] [CrossRef] [Green Version]
- James, M.J.; Zomerdijk, J.C.B.M. Phosphatidylinositol 3-kinase and mTOR signaling pathways regulate RNA polymerase I transcription in response to IGF-1 and nutrients. J. Biol. Chem. 2004, 279, 8911–8918. [Google Scholar] [CrossRef] [Green Version]
- Hoppe, S.; Bierhoff, H.; Cado, I.; Weber, A.; Tiebe, M.; Grummt, I.; Voit, R. AMP-activated protein kinase adapts rRNA synthesis to cellular energy supply. Proc. Natl. Acad. Sci. USA 2009, 106, 17781–17786. [Google Scholar] [CrossRef] [Green Version]
- Schiza, V.; Molina-Serrano, D.; Kyriakou, D.; Hadjiantoniou, A.; Kirmizis, A. N-alpha-terminal Acetylation of Histone H4 Regulates Arginine Methylation and Ribosomal DNA Silencing. PLoS Genet. 2013, 9, e1003805. [Google Scholar] [CrossRef] [Green Version]
- Matos-Perdomo, E.; Machín, F. Nucleolar and Ribosomal DNA Structure under Stress: Yeast Lessons for Aging and Cancer. Cells 2019, 8, 779. [Google Scholar] [CrossRef] [Green Version]
- Ghoshal, K.; Majumder, S.; Datta, J.; Motiwala, T.; Bai, S.; Sharma, S.M.; Frankel, W.; Jacob, S.T. Role of human ribosomal RNA (rRNA) promoter methylation and of methyl-CpG-binding protein MBD2 in the suppression of rRNA gene expression. J. Biol. Chem. 2004, 279, 6783–6793. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bacalini, M.G.; Pacilli, A.; Giuliani, C.; Penzo, M.; Treré, D.; Pirazzini, C.; Salvioli, S.; Franceschi, C.; Montanaro, L.; Garagnani, P. The nucleolar size is associated to the methylation status of ribosomal DNA in breast carcinomas. BMC Cancer 2014, 14, 361. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yan, P.S.; Rodriguez, F.J.; Laux, D.E.; Perry, M.R.; Standiford, S.B.; Huang, T.H. Hypermethylation of ribosomal DNA in human breast carcinoma. Br. J. Cancer 2000, 82, 514–517. [Google Scholar] [CrossRef] [PubMed]
- Powell, M.A.; Mutch, D.G.; Rader, J.S.; Herzog, T.J.; Huang, T.H.-M.; Goodfellow, P.J. Ribosomal DNA methylation in patients with endometrial carcinoma: An independent prognostic marker. Cancer 2002, 94, 2941–2952. [Google Scholar] [CrossRef]
- Swisshelm, K.; Disteche, C.M.; Thorvaldsen, J.; Nelson, A.; Salk, D. Age-related increase in methylation of ribosomal genes and inactivation of chromosome-specific rRNA gene clusters in mouse. Mutat. Res. 1990, 237, 131–146. [Google Scholar] [CrossRef]
- Oakes, C.C.; Smiraglia, D.J.; Plass, C.; Trasler, J.M.; Robaire, B. Aging results in hypermethylation of ribosomal DNA in sperm and liver of male rats. Proc. Natl. Acad. Sci. USA 2003, 100, 1775–1780. [Google Scholar] [CrossRef] [Green Version]
- D’Aquila, P.; Montesanto, A.; Mandalà, M.; Garasto, S.; Mari, V.; Corsonello, A.; Bellizzi, D.; Passarino, G. Methylation of the ribosomal RNA gene promoter is associated with aging and age-related decline. Aging Cell 2017, 16, 966–975. [Google Scholar] [CrossRef] [Green Version]
- Wang, M.; Lemos, B. Ribosomal DNA harbors an evolutionarily conserved clock of biological aging. Genome Res. 2019, 29, 325–333. [Google Scholar] [CrossRef]
- Gramignoli, R.; Green, M.L.; Tahan, V.; Dorko, K.; Skvorak, K.J.; Marongiu, F.; Zao, W.; Venkataramanan, R.; Ellis, E.C.S.; Geller, D.; et al. Development and application of purified tissue dissociation enzyme mixtures for human hepatocyte isolation. Cell Transpl. 2012, 21, 1245–1260. [Google Scholar] [CrossRef]
- Pasciu, D.; Montisci, S.; Greco, M.; Doratiotto, S.; Pitzalis, S.; Pani, P.; Laconi, S.; Laconi, E. Aging is associated with increased clonogenic potential in rat liver in vivo. Aging Cell 2006, 5, 373–377. [Google Scholar] [CrossRef]
- Denisenko, O.; Lucas, E.S.; Sun, C.; Watkins, A.J.; Mar, D.; Bomsztyk, K.; Fleming, T.P. Regulation of ribosomal RNA expression across the lifespan is fine-tuned by maternal diet before implantation. Biochim. Biophys. Acta 2016, 1859, 906–913. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liang, Y.; Liu, C.; Lu, M.; Dong, Q.; Wang, Z.; Wang, Z.; Xiong, W.; Zhang, N.; Zhou, J.; Liu, Q.; et al. Calorie restriction is the most reasonable anti-ageing intervention: A meta-analysis of survival curves. Sci. Rep. 2018, 8, 5779. [Google Scholar] [CrossRef] [PubMed]
- Vermeij, W.P.; Dollé, M.E.T.; Reiling, E.; Jaarsma, D.; Payan-Gomez, C.; Bombardieri, C.R.; Wu, H.; Roks, A.J.M.; Botter, S.M.; van der Eerden, B.C.; et al. Restricted diet delays accelerated ageing and genomic stress in DNA-repair-deficient mice. Nature 2016, 537, 427–431. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gensous, N.; Franceschi, C.; Santoro, A.; Milazzo, M.; Garagnani, P.; Bacalini, M.G. The Impact of Caloric Restriction on the Epigenetic Signatures of Aging. Int. J. Mol. Sci. 2019, 20, 2022. [Google Scholar] [CrossRef] [Green Version]
- Escobar, K.A.; Cole, N.H.; Mermier, C.M.; VanDusseldorp, T.A. Autophagy and aging: Maintaining the proteome through exercise and caloric restriction. Aging Cell 2019, 18, e12876. [Google Scholar] [CrossRef] [Green Version]
- Maharajan, N.; Vijayakumar, K.; Jang, C.H.; Cho, G.-W. Caloric restriction maintains stem cells through niche and regulates stem cell aging. J. Mol. Med. 2019, 98, 25–37. [Google Scholar] [CrossRef]
- Cadoni, E.; Marongiu, F.; Fanti, M.; Serra, M.; Laconi, E. Caloric restriction delays early phases of carcinogenesis via effects on the tissue microenvironment. Oncotarget 2017, 8, 36020–36032. [Google Scholar] [CrossRef] [Green Version]
- Tanca, A.; Abbondio, M.; Palomba, A.; Fraumene, C.; Marongiu, F.; Serra, M.; Pagnozzi, D.; Laconi, E.; Uzzau, S. Caloric restriction promotes functional changes involving short-chain fatty acid biosynthesis in the rat gut microbiota. Sci. Rep. 2018, 8, 14778. [Google Scholar] [CrossRef]
- Frenk, S.; Houseley, J. Gene expression hallmarks of cellular ageing. Biogerontology 2018, 19, 547–566. [Google Scholar] [CrossRef] [Green Version]
- Tiku, V.; Jain, C.; Raz, Y.; Nakamura, S.; Heestand, B.; Liu, W.; Späth, M.; Suchiman, H.E.D.; Müller, R.-U.; Slagboom, P.E.; et al. Small nucleoli are a cellular hallmark of longevity. Nat. Commun. 2017, 8, 16083. [Google Scholar] [CrossRef]
- Morsiani, C.; Bacalini, M.G.; Santoro, A.; Garagnani, P.; Collura, S.; D’Errico, A.; de Eguileor, M.; Grazi, G.L.; Cescon, M.; Franceschi, C.; et al. The peculiar aging of human liver: A geroscience perspective within transplant context. Ageing Res. Rev. 2019, 51, 24–34. [Google Scholar] [CrossRef] [PubMed]
- Bacalini, M.G.; Franceschi, C.; Gentilini, D.; Ravaioli, F.; Zhou, X.; Remondini, D.; Pirazzini, C.; Giuliani, C.; Marasco, E.; Gensous, N.; et al. Molecular Aging of Human Liver: An Epigenetic/Transcriptomic Signature. J. Gerontol. Ser. A 2019, 74, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Machwe, A.; Orren, D.K.; Bohr, V.A. Accelerated methylation of ribosomal RNA genes during the cellular senescence of Werner syndrome fibroblasts. FASEB J. 2000, 14, 1715–1724. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- D’Aquila, P.; Bellizzi, D.; Passarino, G. rRNA-gene methylation and biological aging. Aging 2018, 10, 7–8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pietrzak, M.; Rempala, G.; Nelson, P.T.; Zheng, J.-J.; Hetman, M. Epigenetic silencing of nucleolar rRNA genes in Alzheimer’s disease. PLoS ONE 2011, 6, e22585. [Google Scholar] [CrossRef]
- Stoykova, A.S.; Dudov, K.P.; Dabeva, M.D.; Hadjiolov, A.A. Different rates of synthesis and turnover of ribosomal RNA in rat brain and liver. J. Neurochem. 1983, 41, 942–949. [Google Scholar] [CrossRef]
- Ori, A.; Toyama, B.H.; Harris, M.S.; Bock, T.; Iskar, M.; Bork, P.; Ingolia, N.T.; Hetzer, M.W.; Beck, M. Integrated Transcriptome and Proteome Analyses Reveal Organ-Specific Proteome Deterioration in Old Rats. Cell Syst. 2015, 1, 224–237. [Google Scholar] [CrossRef] [Green Version]
- Torreira, E.; Louro, J.A.; Pazos, I.; González-Polo, N.; Gil-Carton, D.; Duran, A.G.; Tosi, S.; Gallego, O.; Calvo, O.; Fernández-Tornero, C. The dynamic assembly of distinct RNA polymerase I complexes modulates rDNA transcription. eLife 2017, 6, e20832. [Google Scholar] [CrossRef] [Green Version]
- Grummt, I.; Voit, R. Linking rDNA transcription to the cellular energy supply. Cell Cycle 2010, 9, 225–226. [Google Scholar] [CrossRef]
- Drygin, D.; Rice, W.G.; Grummt, I. The RNA polymerase I transcription machinery: An emerging target for the treatment of cancer. Annu. Rev. Pharmacol. Toxicol. 2010, 50, 131–156. [Google Scholar] [CrossRef]
- Grummt, I. The nucleolus—Guardian of cellular homeostasis and genome integrity. Chromosoma 2013, 122, 487–497. [Google Scholar] [CrossRef] [PubMed]
- Espada, J.; Ballestar, E.; Santoro, R.; Fraga, M.F.; Villar-Garea, A.; Németh, A.; Lopez-Serra, L.; Ropero, S.; Aranda, A.; Orozco, H.; et al. Epigenetic disruption of ribosomal RNA genes and nucleolar architecture in DNA methyltransferase 1 (Dnmt1) deficient cells. Nucleic Acids Res. 2007, 35, 2191–2198. [Google Scholar] [CrossRef] [PubMed]
- Holmberg Olausson, K.; Nistér, M.; Lindström, M.S. Loss of nucleolar histone chaperone NPM1 triggers rearrangement of heterochromatin and synergizes with a deficiency in DNA methyltransferase DNMT3A to drive ribosomal DNA transcription. J. Biol. Chem. 2014, 289, 34601–34619. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.; Yuan, Q.; Xie, L. Histone Modifications in Aging: The Underlying Mechanisms and Implications. Curr. Stem Cell Res. Ther. 2018, 13, 125–135. [Google Scholar] [CrossRef] [PubMed]
- Benayoun, B.A.; Pollina, E.A.; Singh, P.P.; Mahmoudi, S.; Harel, I.; Casey, K.M.; Dulken, B.W.; Kundaje, A.; Brunet, A. Remodeling of epigenome and transcriptome landscapes with aging in mice reveals widespread induction of inflammatory responses. Genome Res. 2019, 29, 697–709. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kawakami, K.; Nakamura, A.; Goto, S. Dietary restriction increases site-specific histone H3 acetylation in rat liver: Possible modulation by sirtuins. Biochem. Biophys. Res. Commun. 2012, 418, 836–840. [Google Scholar] [CrossRef]
- Molina-Serrano, D.; Kyriakou, D.; Kirmizis, A. Histone Modifications as an Intersection between Diet and Longevity. Front. Genet. 2019, 10, 192. [Google Scholar] [CrossRef]
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gensous, N.; Ravaioli, F.; Pirazzini, C.; Gramignoli, R.; Ellis, E.; Storci, G.; Capri, M.; Strom, S.; Laconi, E.; Franceschi, C.; et al. Aging and Caloric Restriction Modulate the DNA Methylation Profile of the Ribosomal RNA Locus in Human and Rat Liver. Nutrients 2020, 12, 277. https://doi.org/10.3390/nu12020277
Gensous N, Ravaioli F, Pirazzini C, Gramignoli R, Ellis E, Storci G, Capri M, Strom S, Laconi E, Franceschi C, et al. Aging and Caloric Restriction Modulate the DNA Methylation Profile of the Ribosomal RNA Locus in Human and Rat Liver. Nutrients. 2020; 12(2):277. https://doi.org/10.3390/nu12020277
Chicago/Turabian StyleGensous, Noémie, Francesco Ravaioli, Chiara Pirazzini, Roberto Gramignoli, Ewa Ellis, Gianluca Storci, Miriam Capri, Stephen Strom, Ezio Laconi, Claudio Franceschi, and et al. 2020. "Aging and Caloric Restriction Modulate the DNA Methylation Profile of the Ribosomal RNA Locus in Human and Rat Liver" Nutrients 12, no. 2: 277. https://doi.org/10.3390/nu12020277