Review Reports

Round 1

Reviewer 1 Report

Comments and Suggestions for Authors

1.The study design is substantially confounded by group selection.
The healthy control group is non-diabetic, whereas the DFU and amputation groups differ not only in ulcer severity but also in multiple metabolic and anthropometric variables. Therefore, the present design does not allow the reader to distinguish whether the observed miRNA changes are related to diabetes status, DFU status, disease severity, or associated metabolic comorbidities. The authors should realize this limitation more explicitly and substantially tone down causal or predictive claims.

2.The absence of a diabetic non-DFU comparator group weakens the clinical interpretation.
Without a diabetes-only group, it is difficult to conclude that the identified miRNAs are specifically associated with DFU progression or amputation rather than diabetes itself.

3.Key clinical descriptors of the amputation group are insufficient.
The manuscript should provide detailed clinical characterization, including ulcer severity classification, infection status, ischemia, diabetes duration, HbA1c, medication exposure, and the type/level of amputation. These factors may strongly influence circulating miRNA levels.

4.The statistical analysis requires strengthening.
The manuscript involves multiple miRNAs, several group comparisons, correlation analyses, and subgroup analyses, yet it is unclear whether correction for multiple testing was applied. In addition, the ROC analyses should be complemented by multivariable models adjusting for major clinical confounders. The authors should clarify how odds ratios were calculated and for which comparisons.

5.The biomarker claims are overstated relative to the data.
Given the pilot nature, modest sample size, and only moderate AUC values, statements suggesting diagnostic or prognostic utility should be softened. The conclusions should be reframed as preliminary associations requiring validation in larger independent cohorts.

6.Several inconsistencies suggest that the manuscript requires careful internal revision.
There appear to be discrepancies in reported miRNA values and naming, including inconsistent reporting of miR-191 values, chain annotations, and discussion text that refers to miRNAs not clearly included in the original analysis (eg: section 3.2, miR-191-5p showed median levels of

110.0 (0.43–21.9) in controls). The manuscript should be fully checked for numerical, terminological, and editorial consistency.

Author Response

Thank you very much for taking the time to review this manuscript

Reviewer 1.

1.The study design is substantially confounded by group selection.

The healthy control group is non-diabetic, whereas the DFU and amputation groups differ not only in ulcer severity but also in multiple metabolic and anthropometric variables. Therefore, the present design does not allow the reader to distinguish whether the observed miRNA changes are related to diabetes status, DFU status, disease severity, or associated metabolic comorbidities. The authors should realize this limitation more explicitly and substantially tone down causal or predictive claims.

Answer:  We agree with this comment. As stated in the description of our study population, this work is a pilot study, where we found significant differences between the patients with foot ulcers or lower limb amputations with the control group. Regarding the changes observed in the study groups, the differences shown in Table 1 are notable between patients and controls; however, the only significant difference between the group of patients with ulcers and amputees is age. Nevertheless, it is correct to acknowledge certain limitations; among the most important is the number of patients. A sample size calculation was performed where the number of patients with diabetic foot ulcers was 97 and 12 for amputees, thus specifying that this work is a pilot study to preliminarily understand the behavior of the microRNA expression studied in this group of patients.

According to our population, the calculation was performed assuming a 95% confidence level () and a 5% margin of error ().

Calculation for diabetic foot ulcers:

• Expected proportion (): 6.8% o 0.068 (based on annual incidence of ulcers).

 

Calculation for diabetic limb amputations

• Expected proportion (): 0.74% o 0.0074 (based on annual incidence of ulcers).

 

 

The formula and calculation of the sample are shown based on: Lavery, L. A., Armstrong, D. G., Wunderlich, R. P., Tredwell, J., & Boulton, A. J. M. (2003). Diabetic foot syndrome: Evaluating the prevalence and incidence of foot pathology in Mexican Americans and non-Hispanic whites from a diabetes disease management cohort. Diabetes care, 26(5), 1435-1438. https://doi.org/10.2337/diacare.26.5.1435

Furthermore, it is added to the limitations of the work

2.The absence of a diabetic non-DFU comparator group weakens the clinical interpretation. Without a diabetes-only group, it is difficult to conclude that the identified miRNAs are specifically associated with DFU progression or amputation rather than diabetes itself.

Answer: Thank you for your observation. In this study, we focused on diabetic patients who developed diabetic foot ulcers compared to amputee patients, as there are few studies on this type of diabetic complication. Therefore, we did not include patients with diabetes alone but without complications.

3.Key clinical descriptors of the amputation group are insufficient.

The manuscript should provide detailed clinical characterization, including ulcer severity classification, infection status, ischemia, diabetes duration, HbA1c, medication exposure, and the type/level of amputation. These factors may strongly influence circulating miRNA levels.

Answer: Thank you for your feedback. A new table with the clinical characteristics of amputee patients has been added.

4.The statistical analysis requires strengthening.

The manuscript involves multiple miRNAs, several group comparisons, correlation analyses, and subgroup analyses, yet it is unclear whether correction for multiple testing was applied. In addition, the ROC analyses should be complemented by multivariable models adjusting for major clinical confounders. The authors should clarify how odds ratios were calculated and for which comparisons.

Answer: Thank you for the observation. Multivariate analyses were performed according to the main variables, as you indicated. However, we did not find significant differences between them, so they are not included in the manuscript, but the observation will be added to the results.

5.The biomarker claims are overstated relative to the data.

Given the pilot nature, modest sample size, and only moderate AUC values, statements suggesting diagnostic or prognostic utility should be softened. The conclusions should be reframed as preliminary associations requiring validation in larger independent cohorts.

Answer: We added another conclusion:

In conclusion, our results revealed differences in the expression of the studied miRs. Identifying the mechanisms behind complications at both the molecular and cellular levels is essential for a better understanding of why some people with diabetes develop more severe diabetic foot issues and what factors lead to limb amputation, even when receiving the same treatment and care. The detailed molecular mechanisms by which different genes in the regulatory network contribute to the development of diabetes and its complications remain unclear and require further investigation. These findings are significant, as few studies have explored the relationship between microRNA expression levels in patients with foot ulcers and limb amputations.

 

6.Several inconsistencies suggest that the manuscript requires careful internal revision.

There appear to be discrepancies in reported miRNA values and naming, including inconsistent reporting of miR-191 values, chain annotations, and discussion text that refers to miRNAs not clearly included in the original analysis (eg: section 3.2, miR-191-5p showed median levels of 110.0 (0.43–21.9) in controls). The manuscript should be fully checked for numerical, terminological, and editorial consistency.

Answer. The manuscript was reviewed and corrected.

 

Reviewer 2 Report

Comments and Suggestions for Authors

In the Materials and Methods section, the authors emphasize the inclusion of participants of Mexican origin. It would be helpful to further clarify this point, as the Mexican population is genetically heterogeneous, comprising individuals of diverse ancestries (e.g., Indigenous, European, African, and admixed backgrounds).

In the Results section, the description of participants appears to repeat information already provided in the Materials and Methods section. This redundancy could be reduced. Similarly, the opening sentence of the “MicroRNA expression” section appears repetitive and could be streamlined.

Given the apparent variability in miRNA expression levels, it would strengthen the analysis to include measures of dispersion such as standard deviation (SD), interquartile range (IQR), or confidence intervals (CI). This is particularly relevant for miR-191-5p, where previously reported instability should be considered when interpreting its significance.

In section 3.4, the abbreviation PAS is introduced without definition. For clarity, abbreviations should be defined at first mention.

miR-33-5p has been reported to correlate with cholesterol levels in prior studies. It would be of interest to know whether a similar association was observed in the present cohort.

The manuscript includes patients with obesity, hypoalphalipoproteinemia, and hypertriglyceridemia; however, the criteria used to define these subgroups are not clearly described. Clarification would improve interpretability, particularly in relation to potential outliers influencing correlations.

Previous studies have reported associations between miR-17 and let-7e and metabolic parameters. Inclusion and discussion of these findings would strengthen the manuscript.

Section 3.6 would benefit from inclusion of Figure 3, as its absence limits interpretation.

The sentence “With respect to let-7e, has demonstrated that genes associated with the insulin signaling pathway are common targets.” could be reformulated for clarity.

Similarly, the sentence “These microRNAs hsa-let-7e, miR-33-3p, and miR-191-5p showed significant correlations with clinical parameters, primarily with HDL-C, triglycerides, and glucose, and there was a strong association between patients with obesity who ended up with lower limb amputation and miR-191-5p and let-7e.” would benefit from revision to improve clarity and readability.

On page 2, the sentence “So far, diabetes treatments primarily focus on controlling blood glucose levels, but they cannot completely cure the disease.” may benefit from refinement for precision and tone.

Comments on the Quality of English Language

The language needs quality checking.

Author Response

Thank you very much for taking the time to review this manuscript

1. In the Materials and Methods section, the authors emphasize the inclusion of participants of Mexican origin. It would be helpful to further clarify this point, as the Mexican population is genetically heterogeneous, comprising individuals of diverse ancestries (e.g., Indigenous, European, African, and admixed backgrounds).

Answer: Generally, the Mexican population descends from three major ancestral groups:

1. Indigenous American Ancestry, which is the predominant component. Large cohort studies, such as the Mexico City Prospective Study (MCPS), which includes 140,000 people, and the oriGen project, with over 80,000 participants, have estimated it at between 61% and 66%. 2. European Ancestry is the second most significant component, with an average ranging from 29% to 32%. 3. African Ancestry is present in a small but steady proportion, around 3% to 5%.

Complex relationship between Amerindian ancestry and obesity in the Mexican population. Paulina Baca et al. Gac. Méd. Méx vol.161 no.1 Ciudad de México ene./feb. 2025  Epub 16-Mayo-2025. https://doi.org/10.24875/gmm.24000439.

OriGen cohort: a Mexican population-based epidemiological and genomic research platform. Pablo Kuri-Morales et al. J Epidemiol Community Health. 2026 Jan 9;80(2):97-104.  doi: 10.1136/jech-2025-22456

The following sentence was added to the manuscript: According to previous studies, the Mexican population is composed of indigenous ancestry (61-66%), European ancestry mainly of Spanish origin (29-32%) and African ancestry (3-5%).

2. In the Results section, the description of participants appears to repeat information already provided in the Materials and Methods section. This redundancy could be reduced. Similarly, the opening sentence of the “MicroRNA expression” section appears repetitive and could be streamlined.

Answer. These paragraphs were eliminated

3. Given the apparent variability in miRNA expression levels, it would strengthen the analysis to include measures of dispersion such as standard deviation (SD), interquartile range (IQR), or confidence intervals (CI). This is particularly relevant for miR-191-5p, where previously reported instability should be considered when interpreting its significance.

Answer:  It was added in the tables

4. In section 3.4, the abbreviation PAS is introduced without definition. For clarity, abbreviations should be defined at first mention.

Answer. It was a mistake. It was corrected. “systolic blood pressure“

5. miR-33-5p has been reported to correlate with cholesterol levels in prior studies. It would be of interest to know whether a similar association was observed in the present cohort.

Answer: Your observation is correct; let's expand the discussion on this point. Regarding miR-33-5p, we observed an increase in its expression in both study groups compared to the control group, and an inverse correlation with HDL-C levels and an association with obesity and hypoalphalipoproteinemia among subjects who had limb amputation. Previous studies have shown that increased expression of miR-33a and miR-144 in monocytes is associated with decreased expression of their target membrane cholesterol transporters, ABCA1 and ABCG1; this may be associated with essential arterial hypertension, regardless of an increase in carotid intima media thickness (Huesca-Gomez et al.). On the other hand, Xie et al. demonstrated the crucial role of the miR-33-5p/ABCA1/CS axis, along with citrate synthase and cholesterol efflux, in regulating cholesterol flow, inflammation, apoptosis, and aging in vascular endothelial cells, suggesting this axis could be a target for treating lipid metabolism disorders. These findings may partly explain the link with obesity and hypoalphalipoproteinemia observed in these patients.

Huesca‑Gomez C, Torres‑Paz YE, Martinez‑Alvarado R, Fuentevilla‑Alvarez G, Del Valle‑Mondragon L, Torres‑Tamayo M, Soto ME, Gamboa R. Association between the transporters ABCA1/G1 and the expresión of miR‑33a/144 and the carotid intima media thickness in patients with arterial hypertension. Molecular Biology Reports 2019; https://doi.org/10.1007/s11033-019-05229-0

Qiong Xie, Jianqiang Peng, Ying Guo, Feng Li. MicroRNA-33-5p inhibits cholesterol efflux in vascular endothelial cells by regulating citrate synthase and ATP-binding cassette transporter A1. BMC Cardiovasc Disord. 2021; 13;21(1):433.  doi: 10.1186/s12872-021-02228-7.

6. The manuscript includes patients with obesity, hypoalphalipoproteinemia, and hypertriglyceridemia; however, the criteria used to define these subgroups are not clearly described. Clarification would improve interpretability, particularly in relation to potential outliers influencing correlations.

Answer. The definitions were added to the methodology.

Obesity was defined as a BMI greater than 30 Kg/m2. Dyslipidemia was defined according to the National Cholesterol Education Program (NCEP) Adult Treatment Panel III (ATP III) guidelines: TC ≥ 200 mg/dL, LDL-C ≥ 130 mg/dL, HDL-C < 40 mg/dL for men and <50 mg/dL for women, and TG ≥ 150 mg/dL. Dyslipidemia was diagnosed if any of the following criteria were met [21]. Therefore, the parameters of hypoalphalipoproteinemia and hypertriglyceridemia were considered when these values ​​were within the dyslipidemic ranges mentioned above.

7. Previous studies have reported associations between miR-17 and let-7e and metabolic parameters. Inclusion and discussion of these findings would strengthen the manuscript. Section 3.6 would benefit from inclusion of Figure 3, as its absence limits interpretation.

Answer. It was added in the discussion.

8. The sentence “With respect to let-7e, has demonstrated that genes associated with the insulin signaling pathway are common targets.” could be reformulated for clarity.

Answer: The phrase was changed. Let-7e has shown that genes associated with the insulin signaling pathway are common targets.

9. Similarly, the sentence “These microRNAs hsa-let-7e, miR-33-3p, and miR-191-5p showed significant correlations with clinical parameters, primarily with HDL-C, triglycerides, and glucose, and there was a strong association between patients with obesity who ended up with lower limb amputation and miR-191-5p and let-7e.” would benefit from revision to improve clarity and readability.

Answer: This was changed  in the manuscript

10. On page 2, the sentence “So far, diabetes treatments primarily focus on controlling blood glucose levels, but they cannot completely cure the disease.” may benefit from refinement for precision and tone.

Answer: This was changed in the manuscript

 

Reviewer 3 Report

Comments and Suggestions for Authors

1. A primary concern relates to the overall study design and justification of the selected microRNAs. The manuscript reports the analysis of several circulating microRNAs, including miR-7e, miR-17, miR-33, and miR-191, yet the rationale for selecting these molecules is not sufficiently explained. The introduction briefly mentions the importance of microRNAs in metabolic and inflammatory processes, but it does not clearly explain why these specific microRNAs were chosen for investigation in the context of diabetic foot ulcers and amputation risk. Stronger biological justification supported by previous literature is necessary. The authors should clarify whether these miRNAs were selected based on prior studies linking them to diabetic complications, wound healing pathways, vascular dysfunction, or inflammation. Without this context, the study appears somewhat exploration rather than hypothesis driven.
2. Another important issue concerns the characterization of the patient population and clinical variables. While the manuscript indicates that the study included patients with diabetic foot ulcers, patients with amputations, and a control group, the description of inclusion and exclusion criteria remains insufficient. It is unclear whether patients were matched across groups for age, sex, diabetes duration, glycemic control, medication use, or comorbidities such as peripheral arterial disease or neuropathy. These factors can significantly influence circulating microRNA levels and therefore may confound the observed associations. In particular, the manuscript should clarify whether patients with amputations were analyzed before or after the surgical procedure and how long after the event samples were collected. This information is crucial for interpreting whether the observed microRNA changes reflect disease progression, inflammatory responses, or post-surgical physiological changes.
3. The sample size and statistical power of the study also require careful discussion. The study includes relatively small groups (31 patients with diabetic ulcers, 20 with amputations, and 50 controls), and the manuscript describes the investigation as a pilot study. However, the authors do not provide any justification of statistical power or effect size considerations. Given the variability typically observed in circulating microRNA measurements, it is important to demonstrate that the study has sufficient power to detect biologically meaningful differences. The authors should either provide a post-hoc power analysis or discuss the limitations associated with the sample size more transparently.
4. The methodological description of the RT-qPCR analysis also needs greater detail to ensure reproducibility. The manuscript does not clearly describe critical aspects such as RNA isolation procedures, quality control steps, normalization strategies, or the use of internal controls for miRNA quantification. In circulating miRNA studies, normalization is particularly important because different reference genes or spike-in controls can significantly influence the interpretation of expression data. The authors should clearly indicate which reference miRNA or normalization method was used and justify its suitability for plasma samples. Additionally, information regarding primer sequences, reaction conditions, and quality control measures should be provided.
5. Another major concern relates to the interpretation of the reported correlations and statistical analyses. The manuscript highlights a strong correlation between miR-191 expression and glucose levels, as well as an inverse correlation with HDL cholesterol. However, the authors do not sufficiently discuss whether these correlations remain significant after adjusting for potential confounding variables. For example, hyperglycemia itself may influence multiple metabolic pathways that could indirectly affect circulating microRNA levels. Multivariate regression analysis including relevant covariates (such as age, sex, HbA1c, lipid profile, and diabetes duration) would strengthen the conclusions and help determine whether miR-191 is independently associated with disease severity.
6. The biological interpretation of the findings is also somewhat limited. The manuscript reports elevated levels of several microRNAs in patients with diabetic ulcers and amputations, but the discussion does not adequately connect these findings to known molecular pathways involved in wound healing, angiogenesis, inflammation, or metabolic dysregulation. For instance, miR-191 has been implicated in several cellular processes, including cell proliferation, inflammation, and metabolic regulation, yet these mechanisms are not explored in depth in the discussion. Expanding the biological interpretation would help readers understand how these microRNAs might contribute to the pathophysiology of diabetic foot complications rather than serving merely as statistical associations.
7. Furthermore, the distinction between patients with diabetic foot ulcers and those who underwent amputation requires clearer analysis. Although the manuscript reports differences in microRNA expression between groups, the discussion does not fully address whether these molecules could serve as predictive biomarkers for amputation risk or whether they simply reflect advanced disease severity. If the authors aim to propose miRNAs as potential predictive markers, additional analyses such as receiver operating characteristic (ROC) curves, sensitivity/specificity assessments, or risk modeling would be necessary to support such claims.
8. The presentation of the results and figures also needs improvement. Some of the figures presenting expression levels are difficult to interpret due to limited labeling or insufficient statistical information. The authors should ensure that all graphs clearly display sample sizes, statistical tests used, and measures of variability such as standard deviation or confidence intervals. In addition, it would be helpful to include a summary table describing the clinical characteristics of each study group in detail, including variables such as age, sex distribution, BMI, diabetes duration, HbA1c levels, lipid profiles, and comorbidities.
9. Another issue concerns the discussion of limitations, which is currently brief and insufficient. The authors should explicitly acknowledge the pilot nature of the study, the relatively small cohort size, the cross-sectional design, and the lack of longitudinal data. Without longitudinal analysis, it is difficult to determine whether the observed microRNA changes precede clinical deterioration or occur as a consequence of advanced disease. Addressing these limitations would provide a more balanced interpretation of the findings.
10. The language and writing style also require careful revision. Several sections contain grammatical inconsistencies, awkward phrasing, or overly long sentences that reduce readability. A thorough language editing process is recommended to improve clarity and ensure that the manuscript meets the journal’s standards for scientific communication.
11. The manuscript would benefit from a stronger conclusion and future perspective section. Rather than simply summarizing the results, the authors should discuss how their findings could inform future research directions, such as validation studies in larger cohorts, functional investigations of specific microRNAs, or the development of predictive biomarker panels for diabetic foot complications.

Author Response

Thank you very much for taking the time to review this manuscript

1. A primary concern relates to the overall study design and justification of the selected microRNAs. The manuscript reports the analysis of several circulating microRNAs, including miR-7e, miR-17, miR-33, and miR-191, yet the rationale for selecting these molecules is not sufficiently explained. The introduction briefly mentions the importance of microRNAs in metabolic and inflammatory processes, but it does not clearly explain why these specific microRNAs were chosen for investigation in the context of diabetic foot ulcers and amputation risk. Stronger biological justification supported by previous literature is necessary. The authors should clarify whether these miRNAs were selected based on prior studies linking them to diabetic complications, wound healing pathways, vascular dysfunction, or inflammation. Without this context, the study appears somewhat exploration rather than hypothesis driven.

Answer: Thank you for your comment. The selected microRNAs were initially identified using bioinformatics programs and a search across various programs, as mentioned in the introduction: “In this context, we focused on five circulating miRNAs: miR-let-7e-5p, miR-17-5p, miR-33-5p, miR-144-3p, and miR-191-5p. These were chosen based on DM and DFU results from miRNet and from research databases such as PubMed, Scopus, and Google Scholar [13-17].”

Recent clinical studies have shown that elevated levels of certain circulating microRNAs are not only present in patients with ulcers but also correlate directly with glucose levels, linking poor metabolic control to the development of diabetic ulcers. The microRNAs analyzed range from those involved in angiogenesis and inflammation to those involved in the oxidative stress response. However, very few studies have examined the relationship between these parameters in patients with diabetic foot amputation, which we believe makes our study important.

2. Another important issue concerns the characterization of the patient population and clinical variables. While the manuscript indicates that the study included patients with diabetic foot ulcers, patients with amputations, and a control group, the description of inclusion and exclusion criteria remains insufficient. It is unclear whether patients were matched across groups for age, sex, diabetes duration, glycemic control, medication use, or comorbidities such as peripheral arterial disease or neuropathy. These factors can significantly influence circulating microRNA levels and therefore may confound the observed associations.

Answer: Thank you for your comment. Your question is very pertinent. The patients analyzed in this study were only matched by sex and age between the control group and those with diabetic foot ulcers, but not between those who underwent amputation. Sampling was conducted as patients arrived for consultation and subsequently underwent limb amputation, making it very difficult to match them with the other groups. Furthermore, it is not possible to consider the duration of diabetes, as there is no set timeframe; it is highly variable. We believe this makes the study more interesting, since the lack of an average duration in each case allows the study of microRNAs to be an alternative way to determine if patients are more susceptible to amputation or to reversing this condition. Regarding medication use, glycemic control, and comorbidities, a table was developed that defines the criteria for patients with lower limb amputation (Table XXX).

 

3. In particular, the manuscript should clarify whether patients with amputations were analyzed before or after the surgical procedure and how long after the event samples were collected. This information is crucial for interpreting whether the observed microRNA changes reflect disease progression, inflammatory responses, or post-surgical physiological changes.

Answer: Your question is very valid. This is added to the methodology. “In the case of patients with lower limb amputation, the sample was taken before the surgical amputation procedure”

4. The sample size and statistical power of the study also require careful discussion. The study includes relatively small groups (31 patients with diabetic ulcers, 20 with amputations, and 50 controls), and the manuscript describes the investigation as a pilot study. However, the authors do not provide any justification of statistical power or effect size considerations. Given the variability typically observed in circulating microRNA measurements, it is important to demonstrate that the study has sufficient power to detect biologically meaningful differences. The authors should either provide a post-hoc power analysis or discuss the limitations associated with the sample size more transparently.

Answer: Thank you for your comments. As mentioned in the manuscript, this is a pilot study; however, the sample size calculation was performed, and the required number of patients with ulcers was not reached, but it was not for amputees. Therefore, the future of this work will involve significantly increasing the sample size and continuing with this type of study.

According to our population, the calculation was performed assuming a 95% confidence level () and a 5% margin of error ().

Calculation for diabetic foot ulcers:

• Expected proportion (): 6.8% o 0.068 (based on annual incidence of ulcers).

 

Calculation for diabetic limb amputations

• Expected proportion (): 0.74% o 0.0074 (based on annual incidence of ulcers).

 

 

The formula and calculation of the sample are shown based on: Lavery, L. A., Armstrong, D. G., Wunderlich, R. P., Tredwell, J., & Boulton, A. J. M. (2003). Diabetic foot syndrome: Evaluating the prevalence and incidence of foot pathology in Mexican Americans and non-Hispanic whites from a diabetes disease management cohort. Diabetes care, 26(5), 1435-1438. https://doi.org/10.2337/diacare.26.5.1435

 

5. The methodological description of the RT-qPCR analysis also needs greater detail to ensure reproducibility. The manuscript does not clearly describe critical aspects such as RNA isolation procedures, quality control steps, normalization strategies, or the use of internal controls for miRNA quantification. In circulating miRNA studies, normalization is particularly important because different reference genes or spike-in controls can significantly influence the interpretation of expression data. The authors should clearly indicate which reference miRNA or normalization method was used and justify its suitability for plasma samples. Additionally, information regarding primer sequences, reaction conditions, and quality control measures should be provided.

Answer: The isolation of RNA is described in section 2.4. “Total RNA was purified from plasma samples using the miRNeasy Serum/Plasma Kit (Qiagen) following the manufacturer's instructions. As an internal control, a synthetic miRNA (cel-miR-39 from C. elegans) was added to each sample in equal amounts. Total RNA was stored at −80 °C.”

For each primer pair, a standard curve was constructed using serial (1:10) dilutions of a reference cDNA. The constitutive gene cel-miR-39 was used. For this reaction, 5 μl of the master mix were used, with 1 μl of PCR primer and 4 μl of diluted cDNA. The 2-ΔΔCT relative quantification method was used. The description is given in section 2.5. “miRNAs quantitative real-time”.

 We added the primers as suggested :

miRNA                                   Primer sequence                  Annealing temperature (qPCR)

let-7e-5p               TGAGGTAGGAGGTTGTATAGTT                           60°C

miR-17-5p             CAAAGTGCTTACAGTGCAGGTAG                        60°C

miR-33-5p             GTGCATTGTAGTTGCATTGCA                              60°C

miR-144-3p          TACAGTATAGATGATGTACT                   60°C

miR-191-5p          AACGGAATCCCAAAAGCAG                               60°C

 

6. Another major concern relates to the interpretation of the reported correlations and statistical analyses. The manuscript highlights a strong correlation between miR-191 expression and glucose levels, as well as an inverse correlation with HDL cholesterol. However, the authors do not sufficiently discuss whether these correlations remain significant after adjusting for potential confounding variables. For example, hyperglycemia itself may influence multiple metabolic pathways that could indirectly affect circulating microRNA levels. Multivariate regression analysis including relevant covariates (such as age, sex, HbA1c, lipid profile, and diabetes duration) would strengthen the conclusions and help determine whether miR-191 is independently associated with disease severity.

Answer: Thank you for the observation. Your observation is correct. Multivariate analyses were performed according to the main variables, as you indicated. However, we did not find significant differences between them, so they are not included in the manuscript, but the observation will be added to the results.

 

7. The biological interpretation of the findings is also somewhat limited. The manuscript reports elevated levels of several microRNAs in patients with diabetic ulcers and amputations, but the discussion does not adequately connect these findings to known molecular pathways involved in wound healing, angiogenesis, inflammation, or metabolic dysregulation. For instance, miR-191 has been implicated in several cellular processes, including cell proliferation, inflammation, and metabolic regulation, yet these mechanisms are not explored in depth in the discussion. Expanding the biological interpretation would help readers understand how these microRNAs might contribute to the pathophysiology of diabetic foot complications rather than serving merely as statistical associations.

Answer: We broadened the biological interpretation, as suggested.

Let-7e has been shown to regulate the expression of the IGF-1 (insulin-like growth factor 1) receptor. This receptor is activated by hormones such as insulin-like growth factor 1 (IGF-1) and IGF-2. It mediates the effects of IGF-1, a polypeptide hormone structurally similar to insulin. Both IGF-1 and insulin receptors are essential for regulating metabolic and proliferative processes and are involved in endoplasmic reticulum stress, a key factor in tumor growth, insulin resistance, and obesity (Han,  2014; Lee and Ozcan, 2014). Additionally, there is an interaction between the signaling pathways of the IGF and insulin receptors, occurring at both the receptor level and within downstream signaling mechanisms. This interaction significantly influences IGF/insulin receptor isoforms in various cancer types. The overexpression and formation of hybrid receptor isoforms between the IGF-1 receptor and the insulin receptor—sensitive to the three ligands of the IGF axis—as well as hybrid IGF-1 and insulin receptors with other tyrosine kinases, enhance cell transformation, tumor formation, and tumor vascularization (Kuijjer ML).

Han S, Li Z, Master LM, Master ZW, Wu A. Exogenous IGFBP-2 promotes proliferation, invasion, and chemoresis­tance to temozolomide in glioma cells via the integrin β1-ERK pathway. Br J Cancer 111, 1400–1409, 2014.

Lee J, Ozcan U. Unfolded protein response signaling and metabolic diseases. J Biol Chem 289, 1203–1211, 2014.

Kuijjer ML, Peterse EF, van den Akker BE, Briaire-de Bruijn IH, Serra M, Meza-Zepeda LA, Myklebost O, Hassan AB, Hogendoorn PC, Cleton-Jansen AM. IR/IGF1R signaling as potential target for treatment of high-grade osteosarcoma. BMC Cancer 13, 245, 2013.

The PPP1CB target gene of hsa-miR-191-5p is associated with the transforming growth factor (TGF)-β signaling pathway, which plays a significant role in aneurysm formation [Korrodi-Gregório,  2014; Yu J, 2010]. PPP1C interacts with the SMAD2/3 complex and the TGF-β receptor of this pathway, dephosphorylating both and thus controlling their downstream effects. The TGF-β signaling pathway regulates the activation of various genes [Jones JA, 2009], and its dysregulation or overexpression has been associated with syndromes that cause aneurysms [Jones JA, 2009].

 Korrodi-Gregório L., Silva J.V., Santos-Sousa L., Freitas M.J., Felgueiras J. and Fardilha M. (2014) TGF-β cascade regulation by PPP1 and its interactors -impact on prostate cancer development and therapy. J. Cell. Mol. Med. 18, 555–567

Yu J., Pan L., Qin X., Chen H., Xu Y., Chen Y. et al. (2010) MTMR4 attenuates transforming growth factor beta (TGFbeta) signaling by dephosphorylating R-Smads in endosomes. J. Biol. Chem. 285, 8454–8462

Jones J.A., Spinale F.G. and Ikonomidis J.S. (2009) Transforming growth factor-beta signaling in thoracic aortic aneurysm development: a paradox in pathogenesis. J. Vasc. Res. 46, 119–137

 

8. Furthermore, the distinction between patients with diabetic foot ulcers and those who underwent amputation requires clearer analysis. Although the manuscript reports differences in microRNA expression between groups, the discussion does not fully address whether these molecules could serve as predictive biomarkers for amputation risk or whether they simply reflect advanced disease severity. If the authors aim to propose miRNAs as potential predictive markers, additional analyses such as receiver operating characteristic (ROC) curves, sensitivity/specificity assessments, or risk modeling would be necessary to support such claims.

Answer:  Thank you for your comments. The following sentence was added.

Limitations and Future Work: To further validate these findings, a larger validation study including more ulcer foot and amputation samples should be conducted to identify additional changes in miRNA expression. This will help assess the sensitivity and specificity of the selected miRNAs as biomarkers for early disease detection. Overall, the miRNAs identified in this pilot study may serve as promising biomarkers for this disease, as there are no prior studies in our population to inform a power analysis for a larger, definitive study. Additional research is needed to explore their role in disease development and their potential as clinical biomarkers.

9. The presentation of the results and figures also needs improvement. Some of the figures presenting expression levels are difficult to interpret due to limited labeling or insufficient statistical information. The authors should ensure that all graphs clearly display sample sizes, statistical tests used, and measures of variability such as standard deviation or confidence intervals. In addition, it would be helpful to include a summary table describing the clinical characteristics of each study group in detail, including variables such as age, sex distribution, BMI, diabetes duration, HbA1c levels, lipid profiles, and comorbidities.

Answer: A new table with the clinical characteristics of amputee patients was added. The statistical data was added to the tables

10. Another issue concerns the discussion of limitations, which is currently brief and insufficient. The authors should explicitly acknowledge the pilot nature of the study, the relatively small cohort size, the cross-sectional design, and the lack of longitudinal data. Without longitudinal analysis, it is difficult to determine whether the observed microRNA changes precede clinical deterioration or occur as a consequence of advanced disease. Addressing these limitations would provide a more balanced interpretation of the findings.

Answer: This sentence was added to the manuscript

Limitations and Future Work: To further validate these findings, a larger validation study including more ulcer foot and amputation samples should be conducted to identify additional changes in miRNA expression. This will help assess the sensitivity and specificity of the selected miRNAs as biomarkers for early disease detection. Overall, the miRNAs identified in this pilot study may serve as promising biomarkers for this disease, as there are no prior studies in our population to inform a power analysis for a larger, definitive study. Additional research is needed to explore their role in disease development and their potential as clinical biomarkers.

11. The language and writing style also require careful revision. Several sections contain grammatical inconsistencies, awkward phrasing, or overly long sentences that reduce readability. A thorough language editing process is recommended to improve clarity and ensure that the manuscript meets the journal’s standards for scientific communication.

Answer: It was sent for language and writing review.

12. The manuscript would benefit from a stronger conclusion and future perspective section. Rather than simply summarizing the results, the authors should discuss how their findings could inform future research directions, such as validation studies in larger cohorts, functional investigations of specific microRNAs, or the development of predictive biomarker panels for diabetic foot complications.

Answer: We added another conclusion:

In conclusion, our results revealed differences in the expression of the studied miRs. Identifying the mechanisms behind complications at both the molecular and cellular levels is essential for a better understanding of why some people with diabetes develop more severe diabetic foot issues and what factors lead to limb amputation, even when receiving the same treatment and care. The detailed molecular mechanisms by which different genes in the regulatory network contribute to the development of diabetes and its complications remain unclear and require further investigation. These findings are significant, as few studies have explored the relationship between microRNA expression levels in patients with foot ulcers and limb amputations.

 

Round 2

Reviewer 1 Report

Comments and Suggestions for Authors

The authors’ responses have sufficiently addressed my concerns, and I believe the current manuscript is suitable for publication.

Author Response

The suggested changes were made, and the language, tables, and figures were sent for review.

Reviewer 2 Report

Comments and Suggestions for Authors

Which logarithms in Table 3? In table 3;

HiperTG should be HyperTG, likewise Hipo-a should be Hypo-a

Comments on the Quality of English Language

Non

Author Response

The expression of the miRs was normalized using logarithmic values.

The suggested changes were made, and the language, tables, and figures were sent for review.

Reviewer 3 Report

Comments and Suggestions for Authors

The authors have satisfactorily addressed all major and minor comments, and the revised manuscript can now be recommended for publication.

Author Response

The suggested changes were made, and the language, tables, and figures were sent for review.