Review Reports

Round 1

Reviewer 1 Report

Comments and Suggestions for Authors

This is an excellent paper, demonstrating high scientific quality and clarity throughout.

Line 32: The word “Polygonatum” should be replaced in the Keywords because it already appears in the title.

Line 95: What are the three MP species? Please identify them if possible.

Correct errors: appliedn, an high overall genetic diversity, Unkown, . 

 Line 423: Please specify the software used for UPGMA.

Line: 156: Figure 2. Annotation of unigenes containing ...Figure 2 is incorrectly named as Figure 1 in the text.

 

 

Author Response

Please see the attachment.

Author Response File: Author Response.pdf

Reviewer 2 Report

Comments and Suggestions for Authors

This paper established a highly precise classification method that was impossible to achieve with conventional approaches, making its content exceptionally valuable.

However this paper meeds slight revision according below.

Minor comments

1.  The differences or comparisons between the conventional classification and the current classification should be discussed more in detail.
2. The geographic origin of germplasm resources is limited. Can the information presented in this paper be applied to germplasm collected from a broader range of regions?
3. Please provide the labels for the units displayed on the horizontal and vertical axes of the Figure 3 D.

Author Response

Please see the attachment.

Author Response File: Author Response.pdf

Reviewer 3 Report

Comments and Suggestions for Authors

The manuscript is a research article on transcriptome-wide identification and development of SSR markers for Polygonatum species. The manuscript is interesting, well-written, and has an appropriate methodology. The results are concise, but the discussion is shallow, repeating the results and citing other studies. The author needs to link the discussion to the study's objectives.

Other minor suggestions.

Line 37-38: Add authorities for all Polygonatum species and other taxa quoted in the text at first mention throughout the manuscript.

Generally, the figures are not readable and clear enough. Quality figures should be used in the manuscript.

Author Response

Please see the attachment.

Author Response File: Author Response.pdf

Reviewer 4 Report

Comments and Suggestions for Authors

The authors have conducted extensive work to develop SSR markers for the important medicinal plant, Polygonatum. For the first time, they identified three SSR loci capable of distinguishing six Polygonatum species and six loci for determining the three subgroups of P. kingianum var. grandifolium. Based on these loci, primers were developed and tested on a large number of samples. This work has significant implications for modern plant breeding. I have no major criticisms of the study, only a few points that, in my view, would strengthen the article.

There are several publicly available papers related to the development or use of SSR markers for the identification of individual Polygonatum species and variations of these species.

1. Polygonatum odoratum (Mill.) https://doi.org/10.1371/journal.pone.0308316
2. Development of polymorphic simple sequence repeat markers for assessing genetic diversity and cross-species transferability in Polygonatumspecies https://doi.org/10.1016/j.jarmap.2025.100681
3. Polygonatum cyrtonema https://doi.org/10.1371/journal.pone.0290605

The primers used in the cited article differ from those developed by the authors. Nevertheless, it would be appropriate to cite these studies, for example, in the context of previous research on lineage identification or functional analysis in plants of the genus Polygonatum. This would provide a valuable framework for highlighting the advantages of the authors' own work.

The sequences FB‑4, FB‑5, FB‑9, FB‑8, FB‑42, FB‑57, FB‑49, FB‑60, and FB‑98 should be included in the Results section. The practical significance of this work is also due to the fact that the authors, through extensive work, identified loci that will be useful to a wide range of researchers. And in the future, we, your colleagues, will be pleased to find these sequences not in a huge Excel spreadsheet in the supplementary materials, but within the text. For example,

Locus name	SSR	FORWARD PRIMER1 (5'-3')	REVERSE PRIMER1 (5'-3')
Primers for determining species affiliation within a genus Polygonatum. P. sibiricus, P.kingianum, P.cyrtonema, P.kingianum var. grandifolium, P.cirrhifolium and P.zanlanscianense
FB-5	(T)14aatttt(ATA)5	GGAGCTCACAAGACTGCACT	GCAAGTAACCAGCTTGAGCAG
FB-9	(GC)7(AC)14	CCCCCTGTAGGTTGATAGCC	CTTGCAGGTAAGTCCAGCCA
FB-49	(TC)6	ATTGCCAACGAATTGCTGCC	CCTCGTCCCATTCCTCCAAC
Primers for determining the three subgroups of P.kingianum var. grandifolium
FB-4	(AAG)6acagcggaaaactgttgctgctttgtctgct(GGA)9	TCAGTCTCAGGCTGTTTTCCC	ATTGGCCTAGGAACTGCACC
FB-8	(CT)7cg(CT)6	GTGGAATTGTGCAGCTCAGC	TCGAGTGCTCCTCCCACTAA
FB-42	(GA)15	ACAGCGAGAGAGCATCAAGG	TCGCTTGCGAAGAAGAGAGG
FB-57	(TA)10	AGAAGAGCTGAACAAAAATGGCT	GGGGCTTCGCTGATGAGATT
FB-60	(TG)6	GGAGGGAAAATGGTGCATCC	GCTCATCAAGACCTAGCCCC
FB-98	(TCCGCC)6	ACTCCCGACTCCGAAAAACC	ACCGTGAACCCATCAACGAA

 

In Figure 1A, to better illustrate the number of repeats for the TtNR, PNR, and HNR motifs, it would be helpful to provide an additional plot with an x‑axis scaled to 1000. Alternatively, a zoomed‑in view of the existing plot up to 1000 repeats could be added, while keeping the original plot as is.

Please capitalize the labels in Figure 1; for instance, replace "rate" with "Rate."

In the caption of Figure 3, the species abbreviations (PS, PC, PK, etc.) should be spelled out, as the figure should be understandable without referring to the main text.

Overall, this work left a positive impression.

Best wishes,
Reviewer

 

Comments for author File: Comments.pdf

Author Response

Please see the attachment.

Author Response File: Author Response.pdf

Reviewer 5 Report

Comments and Suggestions for Authors

The manuscript can be improved by making several specific changes.

• In the introduction, the specific hypotheses and objectives of the study should be stated more explicitly. Currently, these are only generally inferred, but a clear statement would better guide the reader through the analyses performed.
• In the methodology, it would be helpful to describe in more detail the criteria used to select the 100 pairs of primers from the more than 31,000 designed, indicating whether selection was based on genomic distribution, fragment length, motif type, or randomization.
• In the results section, some tables and figures contain a large amount of information, making them difficult to read. It is recommended to simplify the graphic design or move some material to the supplementary section, prioritizing the most relevant results in the main text.
• In some parts of the discussion, the comparison is limited to percentages from previous studies without sufficiently exploring the underlying mechanisms. It is suggested to expand the analysis of the functional role of SSRs associated with key metabolic pathways, especially regarding the biosynthesis of polysaccharides and other bioactive metabolites.

Overall, the work is solid, relevant, and well executed. The suggestions mainly concern improvements in clarity, methodological justification, and interpretative depth, without affecting the central validity of the study.

Comments on the Quality of English Language

In terms of style, the English is understandable and technical, but there are minor issues with writing, repetitions, inconsistent verb tenses, and some typographical errors. A professional linguistic review is recommended to improve the fluency and accuracy of the text.

Author Response

Please see the attachment.

Author Response File: Author Response.pdf

Reviewer 6 Report

Comments and Suggestions for Authors

This article is devoted to identifying SSR markers based on transcriptome analysis of three Polygonatum species to assess the genetic diversity of Polygonatum resources. The sequences containing SSR loci were annotated against seven databases. Genetic diversity analysis revealed the presence of intraspecific inbreeding alongside pronounced strong interspecific differentiation among the germplasm resources, with a high overall genetic diversity. Based on locus-specific information, three example pairs were identified that can specifically discriminate among six Polygonatum species. The article is clearly written, at a high scientific level, and clearly describes both the methods used and the results obtained. The review is quite comprehensive. A strength of the article is its combination of bioinformatics approaches with original experimental data. There are no serious criticisms. The main criticism is that I was unable to open several tables from the Supplementary Materials.

Below, specific minor criticisms are described.

1. Lines 43-45. It is necessary to clarify the terms used, which are not generally known.
2. Line 67. Extra space.
3. Line 70. Syntax error in the word "appliedn".
4. Line 76. The term DA-SSR needs clarification.
5. Line 81. The terms EST-SSR and ISSR need clarification.
6. Line 104. A list of abbreviations needs to be entered and the meaning of abbreviations such as HNRs needs to be described in them.
7. When attempting to open tables S2, S6, and S8, I received a message that the tables were corrupted and was unable to open them.
8. Table S4. The table structure is corrupted and contains Chinese characters.
9. Line 121. Commas are not displayed correctly.
10. Line 144. Commas are not displayed correctly.
11. Lines 149-151. In which tables or figures are these values presented?
12. Row 156. This is Figure 2, not Figure 1.
13. Row 212. Commas are displayed incorrectly.
14. Row 317. Extra space.
15. Section 3.6. Provide estimates of underprediction and overprediction errors when discriminating six different Polygonatum resources: PS, PK, PC, PKG, PCI, and PZ.
16. Section 4.2. Explain why these specific different minimum repeat thresholds were chosen.
17. Line 380. References to the databases used are required.

18. Row 424. Briefly describe the term "Nei's I."

Author Response

Please see the attachment.

Author Response File: Author Response.pdf