Vagus Nerve Mediated Liver-Brain-Axis Is a Major Regulator of the Metabolic Landscape in the Liver
Abstract
1. Introduction
2. Results
2.1. Vagotomy Leads to Hepatic Proteome Remodeling
2.2. Metabolism Is a Major Target of the Vagal Neural Circuit in the Liver
2.3. Liver-Brain Axis Disruption or Cholinergic Signaling Impairment Result in a Metabolic Shift Towards Fatty Acid Biosynthesis in the Liver
2.4. The Alterations in Hepatic Metabolic Machinery Are Independent of Major Changes in GI Tract Physiology
2.5. The Metabolic Shift Induced by Vagotomy Primes the Development and Severity of Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD)
3. Discussion
4. Materials and Methods
4.1. Ethical Approval
4.2. Mouse Models and Surgical Procedure
4.3. Proteomics
4.3.1. Liver Tissue Preparation
4.3.2. Peptide Isotopic Labeling
4.3.3. Mass Spectrometry Analysis
4.4. Proteomics Data Analysis
4.5. Metabolomics
4.6. qRT-PCR
- Mitochondrial ribosomal protein S26 (S26; Gene ID: 99045)
- Forward: CGATTCCTGACAACCTTGCTA
- Reverse: CGTGCTTCCCAAGCTCTATGT
- Fatty Acid Synthase (Fasn; Gene ID: 14104)
- Forward: GGAGGTGGTGATAGCCGGTAT
- Reverse: TGGGTAATCCATAGAGCCCAG
- Glucokinase (Gck; Gene ID: 103988)
- Forward: TGAGCCGGATGCAGAAGGA
- Reverse: GCAACATCTTTACACTGGCCT
4.7. Locomotor Activity
4.8. Intestinal Motility
4.9. Intestinal Absorption
4.10. Dietary Challenges
4.11. Liver Intravital Microscopy
4.12. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Judge, A.; Dodd, M.S. Metabolism. Essays Biochem. 2020, 64, 607–647. [Google Scholar] [CrossRef] [PubMed]
- Kietzmann, T. Metabolic zonation of the liver: The oxygen gradient revisited. Redox Biol. 2017, 11, 622–630. [Google Scholar] [CrossRef]
- Rui, L. Energy metabolism in the liver. Compr. Physiol. 2014, 4, 177–197. [Google Scholar] [CrossRef] [PubMed]
- Jensen, K.J.; Alpini, G.; Glaser, S. Hepatic nervous system and neurobiology of the liver. Compr. Physiol. 2013, 3, 655–666. [Google Scholar] [CrossRef]
- Berthoud, H.-R. Anatomy and function of sensory hepatic nerves. Anat. Rec. 2004, 280A, 827–835. [Google Scholar] [CrossRef]
- Bohórquez, D.V.; Shahid, R.A.; Erdmann, A.; Kreger, A.M.; Wang, Y.; Calakos, N.; Wang, F.; Liddle, R.A. Neuroepithelial circuit formed by innervation of sensory enteroendocrine cells. J. Clin. Investig. 2015, 125, 782–786. [Google Scholar] [CrossRef]
- Kaelberer, M.M.; Buchanan, K.L.; Klein, M.E.; Barth, B.B.; Montoya, M.M.; Shen, X.; Bohórquez, D.V. A gut-brain neural circuit for nutrient sensory transduction. Science 2018, 361, aat5236. [Google Scholar] [CrossRef] [PubMed]
- Niijima, A. Glucose-sensitive afferent nerve fibres in the hepatic branch of the vagus nerve in the guinea-pig. J. Physiol. 1982, 332, 315–323. [Google Scholar] [CrossRef]
- Niijima, A. Reflex effects of oral, gastrointestinal and hepatoportal glutamate sensors on vagal nerve activity. J. Nutr. 2000, 130, 971S–973S. [Google Scholar] [CrossRef]
- Randich, A.; Spraggins, D.S.; Cox, J.E.; Meller, S.T.; Kelm, G.R. Jejunal or portal vein infusions of lipids increase hepatic vagal afferent activity. Neuroreport 2001, 12, 3101–3105. [Google Scholar] [CrossRef] [PubMed]
- Yi, C.X.; la Fleur, S.E.; Fliers, E.; Kalsbeek, A. The role of the autonomic nervous liver innervation in the control of energy metabolism. Biochim. Biophys. Acta-Mol. Basis Dis. 2010, 1802, 416–431. [Google Scholar] [CrossRef]
- Han, W.; Tellez, L.A.; Perkins, M.H.; Perez, I.O.; Qu, T.; Ferreira, J.; Ferreira, T.L.; Quinn, D.; Liu, Z.W.; Gao, X.B.; et al. A Neural Circuit for Gut-Induced Reward. Cell 2018, 175, 665–678.e23. [Google Scholar] [CrossRef]
- Buchanan, K.L.; Rupprecht, L.E.; Kaelberer, M.M.; Sahasrabudhe, A.; Klein, M.E.; Villalobos, J.A.; Liu, W.W.; Yang, A.; Gelman, J.; Park, S.; et al. The preference for sugar over sweetener depends on a gut sensor cell. Nat. Neurosci. 2022, 25, 191–200. [Google Scholar] [CrossRef]
- de Lartigue, G. Role of the vagus nerve in the development and treatment of diet-induced obesity. J. Physiol. 2016, 594, 5791–5815. [Google Scholar] [CrossRef]
- Burneo, J.G.; Faught, E.; Knowlton, R.; Morawetz, R.; Kuzniecky, R. Weight loss associated with vagus nerve stimulation. Neurology 2002, 59, 463–464. [Google Scholar] [CrossRef]
- Pardo, J.V.; Sheikh, S.A.; Kuskowski, M.A.; Surerus-Johnson, C.; Hagen, M.C.; Lee, J.T.; Rittberg, B.R.; Adson, D.E. Weight loss during chronic, cervical vagus nerve stimulation in depressed patients with obesity: An observation. Int. J. Obes. 2007, 31, 1756–1759. [Google Scholar] [CrossRef] [PubMed]
- Vijgen, G.H.E.J.; Bouvy, N.D.; Leenen, L.; Rijkers, K.; Cornips, E.; Majoie, M.; Brans, B.; van Marken Lichtenbelt, W.D. Vagus Nerve Stimulation Increases Energy Expenditure: Relation to Brown Adipose Tissue Activity. PLoS ONE 2013, 8, 0077221. [Google Scholar] [CrossRef]
- Prado, V.F.; Martins-Silva, C.; de Castro, B.M.; Lima, R.F.; Barros, D.M.; Amaral, E.; Ramsey, A.J.; Sotnikova, T.D.; Ramirez, M.R.; Kim, H.-G.; et al. Mice Deficient for the Vesicular Acetylcholine Transporter Are Myasthenic and Have Deficits in Object and Social Recognition. Neuron 2006, 51, 601–612. [Google Scholar] [CrossRef] [PubMed]
- Gardemann, A.; Püschel, G.P.; Jungermann, K. Nervous control of liver metabolism and hemodynamics. Eur. J. Biochem. 1992, 207, 399–411. [Google Scholar] [CrossRef]
- Seicol, B.J.; Bejarano, S.; Behnke, N.; Guo, L. Neuromodulation of metabolic functions: From pharmaceuticals to bioelectronics to biocircuits. J. Biol. Eng. 2019, 13, 67. [Google Scholar] [CrossRef] [PubMed]
- Cabot, L.; Erlenbeck-Dinkelmann, J.; Fenselau, H. Neural gut-to-brain communication for postprandial control of satiation and glucose metabolism. J. Endocrinol. 2023, 258, 320. [Google Scholar] [CrossRef] [PubMed]
- Neuhuber, W.L.; Berthoud, H.R. Functional anatomy of the vagus system—Emphasis on the somato-visceral interface. Auton. Neurosci. Basic Clin. 2021, 236, 102887. [Google Scholar] [CrossRef]
- Masi, E.B.; Valdés-Ferrer, S.I.; Steinberg, B.E. The vagus neurometabolic interface and clinical disease. Int. J. Obes. 2018, 42, 1101–1111. [Google Scholar] [CrossRef]
- Vana, V.; Lærke, M.K.; Rehfeld, J.F.; Arnold, M.; Dmytriyeva, O.; Langhans, W.; Schwartz, T.W.; Hansen, H.S. Vagal afferent cholecystokinin receptor activation is required for glucagon-like peptide-1–induced satiation. Diabetes Obes. Metab. 2022, 24, 268–280. [Google Scholar] [CrossRef] [PubMed]
- Cook, T.M.; Gavini, C.K.; Jesse, J.; Aubert, G.; Gornick, E.; Bonomo, R.; Gautron, L.; Layden, B.T.; Mansuy-Aubert, V. Vagal neuron expression of the microbiota-derived metabolite receptor, free fatty acid receptor (FFAR3), is necessary for normal feeding behavior. Mol. Metab. 2021, 54, 101350. [Google Scholar] [CrossRef]
- Hackl, M.T.; Fürnsinn, C.; Schuh, C.M.; Krssak, M.; Carli, F.; Guerra, S.; Freudenthaler, A.; Baumgartner-Parzer, S.; Helbich, T.H.; Luger, A.; et al. Brain leptin reduces liver lipids by increasing hepatic triglyceride secretion and lowering lipogenesis. Nat. Commun. 2019, 10, 2717. [Google Scholar] [CrossRef] [PubMed]
- Metz, M.; Beghini, M.; Wolf, P.; Pfleger, L.; Hackl, M.; Bastian, M.; Freudenthaler, A.; Harreiter, J.; Zeyda, M.; Baumgartner-Parzer, S.; et al. Leptin increases hepatic triglyceride export via a vagal mechanism in humans. Cell Metab. 2022, 34, 1719–1731.e5. [Google Scholar] [CrossRef]
- Li, D.J.; Liu, J.; Hua, X.; Fu, H.; Huang, F.; Fei, Y.B.; Lu, W.J.; Shen, F.M.; Wang, P. Nicotinic acetylcholine receptor α7 subunit improves energy homeostasis and inhibits inflammation in nonalcoholic fatty liver disease. Metabolism 2018, 79, 52–63. [Google Scholar] [CrossRef]
- Hasan, M.K.; Friedman, T.C.; Sims, C.; Lee, D.L.; Espinoza-Derout, J.; Ume, A.; Chalfant, V.; Lee, M.L.; Sinha-Hikim, I.; Lutfy, K.; et al. a7-nicotinic acetylcholine receptor agonist ameliorates nicotine plus high-fat Diet–Induced hepatic steatosis in male mice by inhibiting oxidative stress and stimulating AMPK signaling. Endocrinology 2018, 159, 931–944. [Google Scholar] [CrossRef]
- Kimura, K.; Inaba, Y.; Watanabe, H.; Matsukawa, T.; Matsumoto, M.; Inoue, H. Nicotinic alpha-7 acetylcholine receptor deficiency exacerbates hepatic inflammation and fibrosis in a mouse model of non-alcoholic steatohepatitis. J. Diabetes Investig. 2019, 10, 659–666. [Google Scholar] [CrossRef]
- Gausserès, B.; Liu, J.; Foppen, E.; Tourrel-Cuzin, C.; Sanchez-Archidona, A.R.; Delangre, E.; Cruciani-Guglielmacci, C.; Pons, S.; Maskos, U.; Thorens, B.; et al. The constitutive lack of α7 nicotinic receptor leads to metabolic disorders in mouse. Biomolecules 2020, 10, 1057. [Google Scholar] [CrossRef] [PubMed]
- Jun, H.; Liu, S.; Knights, A.J.; Zhu, K.; Ma, Y.; Gong, J.; Lenhart, A.E.; Peng, X.; Huang, Y.; Ginder, J.P.; et al. Signaling through the nicotinic acetylcholine receptor in the liver protects against the development of metabolic dysfunction-associated steatohepatitis. PLoS Biol. 2024, 22, e3002728. [Google Scholar] [CrossRef]
- Fonseca, R.C.; Bassi, G.S.; Brito, C.C.; Rosa, L.B.; David, B.A.; Araújo, A.M.; Nóbrega, N.; Diniz, A.B.; Jesus, I.C.G.; Barcelos, L.S.; et al. Vagus nerve regulates the phagocytic and secretory activity of resident macrophages in the liver. Brain. Behav. Immun. 2019, 81, 444–454. [Google Scholar] [CrossRef]
- Al Helaili, A.; Park, S.J.; Beyak, M.J. Chronic high fat diet impairs glucagon like peptide-1 sensitivity in vagal afferents. Biochem. Biophys. Res. Commun. 2020, 533, 110–117. [Google Scholar] [CrossRef]
- Loper, H.; Leinen, M.; Bassoff, L.; Sample, J.; Romero-Ortega, M.; Gustafson, K.J.; Taylor, D.M.; Schiefer, M.A. Both high fat and high carbohydrate diets impair vagus nerve signaling of satiety. Sci. Rep. 2021, 11, 10394. [Google Scholar] [CrossRef]
- de Lartigue, G.; Ronveaux, C.C.; Raybould, H.E. Deletion of leptin signaling in vagal afferent neurons results in hyperphagia and obesity. Mol. Metab. 2014, 3, 595–607. [Google Scholar] [CrossRef]
- Barella, L.F.; Miranda, R.A.; Franco, C.C.S.; Alves, V.S.; Malta, A.; Ribeiro, T.A.S.; Gravena, C.; Mathias, P.C.F.; de Oliveira, J.C. Vagus nerve contributes to metabolic syndrome in high-fat diet-fed young and adult rats. Exp. Physiol. 2015, 100, 57–68. [Google Scholar] [CrossRef]
- Yki-Järvinen, H. Non-alcoholic fatty liver disease as a cause and a consequence of metabolic syndrome. Lancet Diabetes Endocrinol. 2014, 2, 901–910. [Google Scholar] [CrossRef]
- Germani, G.; Laryea, M.; Rubbia-Brandt, L.; Egawa, H.; Burra, P.; O’Grady, J.; Watt, K.D. Management of Recurrent and de Novo NAFLD/NASH after Liver Transplantation. Transplantation 2019, 103, 57–67. [Google Scholar] [CrossRef]
- Seo, S.; Maganti, K.; Khehra, M.; Ramsamooj, R.; Tsodikov, A.; Bowlus, C.; McVicar, J.; Zern, M.; Torok, N. De novo nonalcoholic fatty liver disease after liver transplantation. Liver Transplant. 2007, 13, 844–847. [Google Scholar] [CrossRef] [PubMed]
- Dumortier, J.; Giostra, E.; Belbouab, S.; Morard, I.; Guillaud, O.; Spahr, L.; Boillot, O.; Rubbia-Brandt, L.; Scoazec, J.Y.; Hadengue, A. Non-alcoholic fatty liver disease in liver transplant recipients: Another story of seed and soil. Am. J. Gastroenterol. 2010, 105, 613–620. [Google Scholar] [CrossRef] [PubMed]
- Gitto, S.; De Maria, N.; Di Benedetto, F.; Tarantino, G.; Serra, V.; Maroni, L.; Cescon, M.; Pinna, A.D.; Schepis, F.; Andreone, P.; et al. De-novo nonalcoholic steatohepatitis is associated with long-term increased mortality in liver transplant recipients. Eur. J. Gastroenterol. Hepatol. 2018, 30, 766–773. [Google Scholar] [CrossRef] [PubMed]
- Boon, A.P.; Hubscher, S.G.; Lee, J.A.; Hines, J.E.; Burt, A.D. Hepatic reinnervation following orthotopic liver transplantation in man. J. Pathol. 1992, 167, 217–222. [Google Scholar] [CrossRef]
- Pabst, O.; Hornef, M.W.; Schaap, F.G.; Cerovic, V.; Clavel, T.; Bruns, T. Gut–liver axis: Barriers and functional circuits. Nat. Rev. Gastroenterol. Hepatol. 2023, 20, 447–461. [Google Scholar] [CrossRef] [PubMed]
- Hosoi, T.; Okuma, Y.; Matsuda, T.; Nomura, Y. Novel pathway for LPS-induced afferent vagus nerve activation: Possible role of nodose ganglion. Auton. Neurosci. Basic Clin. 2005, 120, 104–107. [Google Scholar] [CrossRef]
- Goswami, C.; Iwasaki, Y.; Yada, T. Short-chain fatty acids suppress food intake by activating vagal afferent neurons. J. Nutr. Biochem. 2018, 57, 130–135. [Google Scholar] [CrossRef]
- Jameson, K.G.; Kazmi, S.A.; Ohara, T.E.; Son, C.; Yu, K.B.; Mazdeyasnan, D.; Leshan, E.; Vuong, H.E.; Paramo, J.; Lopez-Romero, A.; et al. Select microbial metabolites in the small intestinal lumen regulates vagal activity via receptor-mediated signaling. iScience 2025, 28, 111699. [Google Scholar] [CrossRef]
- Kandalgaonkar, M.R.; Kumar, V.; Vijay-Kumar, M. Digestive dynamics: Unveiling interplay between the gut microbiota and the liver in macronutrient metabolism and hepatic metabolic health. Physiol. Rep. 2024, 12, e16114. [Google Scholar] [CrossRef]
- da Silva Júnior, W.F.; de Oliveira Costa, K.M.; Castro Oliveira, H.M.; Antunes, M.M.; Mafra, K.; Nakagaki, B.N.; Corradi da Silva, P.S.; Megale, J.D.; de Sales, S.C.; Caixeta, D.C.; et al. Physiological accumulation of lipid droplets in the newborn liver during breastfeeding is driven by TLR4 ligands. J. Lipid Res. 2025, 66, 100744. [Google Scholar] [CrossRef]
- David, B.A.; Rezende, R.M.; Antunes, M.M.; Santos, M.M.; Freitas Lopes, M.A.; Diniz, A.B.; Sousa Pereira, R.V.; Marchesi, S.C.; Alvarenga, D.M.; Nakagaki, B.N.; et al. Combination of Mass Cytometry and Imaging Analysis Reveals Origin, Location, and Functional Repopulation of Liver Myeloid Cells in Mice. Gastroenterology 2016, 151, 1176–1191. [Google Scholar] [CrossRef] [PubMed]
- Cretenet, G.; Le Clech, M.; Gachon, F. Circadian Clock-Coordinated 12 Hr Period Rhythmic Activation of the IRE1α Pathway Controls Lipid Metabolism in Mouse Liver. Cell Metab. 2010, 11, 47–57. [Google Scholar] [CrossRef]
- Boersema, P.J.; Raijmakers, R.; Lemeer, S.; Mohammed, S.; Heck, A.J.R. Multiplex peptide stable isotope dimethyl labeling for quantitative proteomics. Nat. Protoc. 2009, 4, 484–494. [Google Scholar] [CrossRef]
- Cox, J.; Neuhauser, N.; Michalski, A.; Scheltema, R.A.; Olsen, J.V.; Mann, M. Andromeda: A peptide search engine integrated into the MaxQuant environment. J. Proteome Res. 2011, 10, 1794–1805. [Google Scholar] [CrossRef]
- Darzi, Y.; Yamate, Y.; Yamada, T. FuncTree2: An interactive radial tree for functional hierarchies and omics data visualization. Bioinformatics 2019, 35, 4519–4521. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. ClusterProfiler: An R package for comparing biological themes among gene clusters. OMICS J. Integr. Biol. 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Bindea, G.; Mlecnik, B.; Hackl, H.; Charoentong, P.; Tosolini, M.; Kirilovsky, A.; Fridman, W.H.; Pagès, F.; Trajanoski, Z.; Galon, J. ClueGO: A Cytoscape plug-in to decipher functionally grouped gene ontology and pathway annotation networks. Bioinformatics 2009, 25, 1091–1093. [Google Scholar] [CrossRef]
- Szklarczyk, D.; Kirsch, R.; Koutrouli, M.; Nastou, K.; Mehryary, F.; Hachilif, R.; Gable, A.L.; Fang, T.; Doncheva, N.T.; Pyysalo, S.; et al. The STRING database in 2023: Protein–protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res. 2023, 51, D638–D646. [Google Scholar] [CrossRef]
- Maciejewski, M.W.; Schuyler, A.D.; Gryk, M.R.; Moraru, I.I.; Romero, P.R.; Ulrich, E.L.; Eghbalnia, H.R.; Livny, M.; Delaglio, F.; Hoch, J.C. NMRbox: A Resource for Biomolecular NMR Computation. Biophys. J. 2017, 112, 1529–1534. [Google Scholar] [CrossRef]
- Pang, Z.; Chong, J.; Li, S.; Xia, J. Metaboanalystr 3.0: Toward an optimized workflow for global metabolomics. Metabolites 2020, 10, 186. [Google Scholar] [CrossRef]
- Bingol, K.; Li, D.W.; Bruschweiler-Li, L.; Cabrera, O.A.; Megraw, T.; Zhang, F.; Brüschweiler, R. Unified and isomer-specific NMR metabolomics database for the accurate analysis of 13C-1H HSQC spectra. ACS Chem. Biol. 2015, 10, 452–459. [Google Scholar] [CrossRef]
- Robinette, S.L.; Zhang, F.; Brüschweiler-Li, L.; Brüschweiler, R. Web server based complex mixture analysis by NMR. Anal. Chem. 2008, 80, 3606–3611. [Google Scholar] [CrossRef]
- Perez-Riverol, Y.; Bai, J.; Bandla, C.; García-Seisdedos, D.; Hewapathirana, S.; Kamatchinathan, S.; Kundu, D.J.; Prakash, A.; Frericks-Zipper, A.; Eisenacher, M.; et al. The PRIDE database resources in 2022: A hub for mass spectrometry-based proteomics evidences. Nucleic Acids Res. 2022, 50, D543–D552. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Brito, C.F.; Fonseca, R.C.; Rodrigues-Ribeiro, L.; Guimarães, J.S.F.; Vaz, B.F.; Tofani, G.S.S.; Batista, A.C.S.; Diniz, A.B.; Fernandes, P.; Nunes, N.A.M.; et al. Vagus Nerve Mediated Liver-Brain-Axis Is a Major Regulator of the Metabolic Landscape in the Liver. Int. J. Mol. Sci. 2025, 26, 2166. https://doi.org/10.3390/ijms26052166
Brito CF, Fonseca RC, Rodrigues-Ribeiro L, Guimarães JSF, Vaz BF, Tofani GSS, Batista ACS, Diniz AB, Fernandes P, Nunes NAM, et al. Vagus Nerve Mediated Liver-Brain-Axis Is a Major Regulator of the Metabolic Landscape in the Liver. International Journal of Molecular Sciences. 2025; 26(5):2166. https://doi.org/10.3390/ijms26052166
Chicago/Turabian StyleBrito, Camila F., Roberta C. Fonseca, Lucas Rodrigues-Ribeiro, João S. F. Guimarães, Bruna F. Vaz, Gabriel S. S. Tofani, Ana C. S. Batista, Ariane B. Diniz, Paola Fernandes, Núbia A. M. Nunes, and et al. 2025. "Vagus Nerve Mediated Liver-Brain-Axis Is a Major Regulator of the Metabolic Landscape in the Liver" International Journal of Molecular Sciences 26, no. 5: 2166. https://doi.org/10.3390/ijms26052166
APA StyleBrito, C. F., Fonseca, R. C., Rodrigues-Ribeiro, L., Guimarães, J. S. F., Vaz, B. F., Tofani, G. S. S., Batista, A. C. S., Diniz, A. B., Fernandes, P., Nunes, N. A. M., Pessoa, R. M., Oliveira, A. C. C., Lula, I. S., Cardoso, V. N., Fernandes, S. O. A., Poletini, M. O., Alvarez-Leite, J. I., Menezes, G. B., Ferreira, A. V. M., ... Oliveira, A. G. (2025). Vagus Nerve Mediated Liver-Brain-Axis Is a Major Regulator of the Metabolic Landscape in the Liver. International Journal of Molecular Sciences, 26(5), 2166. https://doi.org/10.3390/ijms26052166