Analysis of Selenoprotein Expression in Response to Dietary Selenium Deficiency During Pregnancy Indicates Tissue Specific Differential Expression in Mothers and Sex Specific Changes in the Fetus and Offspring
Abstract
1. Introduction
2. Results
2.1. Maternal Selenoprotein Expression
2.2. Placental Selenoprotein Expression
2.3. Fetal Selenoprotein Expression
2.4. Selenoprotein Expression in the Offspring
3. Discussion
3.1. Maternal Selenoproteins
3.2. Fetal Selenoproteins
3.3. Offspring Selenoproteins
4. Materials and Methods
4.1. Animal Model
4.2. Fetal Genotyping
4.3. Quantitative PCR
4.4. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Moghadaszadeh, B.; Beggs, A.H. Selenoproteins and their impact on human health through diverse physiological pathways. Physiology 2006, 21, 307–315. [Google Scholar] [CrossRef]
- Labunskyy, V.M.; Hatfield, D.L.; Gladyshev, V.N. Selenoproteins: Molecular pathways and physiological roles. Physiol. Rev. 2014, 94, 739–777. [Google Scholar] [CrossRef]
- Bellinger, F.P.; Raman, A.V.; Reeves, M.A.; Berry, M.J. Regulation and function of selenoproteins in human disease. Biochem. J. 2009, 422, 11–22. [Google Scholar] [CrossRef]
- Shreenath, A.P.; Dooley, J. Selenium deficiency. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2018. [Google Scholar]
- Chen, J. An original discovery: Selenium deficiency and Keshan disease (an endemic heart disease). Asia Pac. J. Clin. Nutr. 2012, 21, 320–326. [Google Scholar]
- Ventura, M.; Melo, M.; Carrilho, F. Selenium and thyroid disease: From pathophysiology to treatment. Int. J. Endocrinol. 2017, 2017, 1297658. [Google Scholar] [CrossRef] [PubMed]
- Sheehan, H.B.; Benetucci, J.; Muzzio, E.; Redini, L.; Naveira, J.; Segura, M.; Weissenbacher, M.; Tang, A.M. High rates of serum selenium deficiency among HIV-and HCV-infected and uninfected drug users in Buenos Aires, Argentina. Public Health Nutr. 2012, 15, 538–545. [Google Scholar] [CrossRef] [PubMed]
- Jin, J.; Mulesa, L.; Carrilero Rouillet, M. Trace Elements in Parenteral Nutrition: Considerations for the Prescribing Clinician. Nutrients 2017, 9, 440. [Google Scholar] [CrossRef] [PubMed]
- Moslemi, M.K.; Tavanbakhsh, S. Selenium–vitamin E supplementation in infertile men: Effects on semen parameters and pregnancy rate. Int. J. Gen. Med. 2011, 4, 99. [Google Scholar] [CrossRef] [PubMed]
- Moriarty, P.M.; Reddy, C.C.; Maquat, L.E. Selenium deficiency reduces the abundance of mRNA for Se-dependent glutathione peroxidase 1 by a UGA-dependent mechanism likely to be nonsense codon-mediated decay of cytoplasmic mRNA. Mol. Cell. Biol. 1998, 18, 2932–2939. [Google Scholar] [CrossRef]
- Howard, M.T.; Carlson, B.A.; Anderson, C.B.; Hatfield, D.L. Translational redefinition of UGA codons is regulated by selenium availability. J. Biol. Chem. 2013, 288, 19401–19413. [Google Scholar] [CrossRef]
- Pitts, M.W.; Byrns, C.N.; Ogawa-Wong, A.N.; Kremer, P.; Berry, M.J. Selenoproteins in nervous system development and function. Biol. Trace Elem. Res. 2014, 161, 231–245. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Wang, L.; Tang, J.; Jia, G.; Liu, G.; Chen, X.; Cai, J.; Shang, H.; Zhao, H. Pancreatic atrophy caused by dietary selenium deficiency induces hypoinsulinemic hyperglycemia via global down-regulation of selenoprotein encoding genes in broilers. PLoS ONE 2017, 12, e0182079. [Google Scholar] [CrossRef] [PubMed]
- Pieczynska, J.; Grajeta, H. The role of selenium in human conception and pregnancy. J. Trace Elem. Med. Biol. 2015, 29, 31–38. [Google Scholar] [CrossRef] [PubMed]
- Ren, X.; Zou, L.; Zhang, X.; Branco, V.; Wang, J.; Carvalho, C.; Holmgren, A.; Lu, J. Redox Signaling Mediated by Thioredoxin and Glutathione Systems in the Central Nervous System. Antioxid. Redox Signal. 2017, 27, 989–1010. [Google Scholar] [CrossRef]
- Gromer, S.; Eubel, J.K.; Lee, B.L.; Jacob, J. Human selenoproteins at a glance. Cell. Mol. Life Sci. 2005, 62, 2414–2437. [Google Scholar] [CrossRef]
- Khera, A.; Dong, L.F.; Holland, O.; Vanderlelie, J.; Pasdar, E.A.; Neuzil, J.; Perkins, A.V. Selenium supplementation induces mitochondrial biogenesis in trophoblasts. Placenta 2015, 36, 863–869. [Google Scholar] [CrossRef]
- Addinsall, A.B.; Wright, C.R.; Andrikopoulos, S.; van der Poel, C.; Stupka, N. Emerging roles of endoplasmic reticulum-resident selenoproteins in the regulation of cellular stress responses and the implications for metabolic disease. Biochem. J. 2018, 475, 1037–1057. [Google Scholar] [CrossRef]
- Shchedrina, V.A.; Zhang, Y.; Labunskyy, V.M.; Hatfield, D.L.; Gladyshev, V.N. Structure–function relations, physiological roles, and evolution of mammalian ER-resident selenoproteins. Antioxid. Redox Signal. 2010, 12, 839–849. [Google Scholar] [CrossRef]
- Hofstee, P.; Bartho, L.A.; McKeating, D.R.; Radenkovic, F.; McEnroe, G.; Fisher, J.J.; Holland, O.J.; Vanderlelie, J.J.; Perkins, A.V.; Cuffe, J.S.M. Maternal selenium deficiency during pregnancy in mice increases thyroid hormone concentrations, alters placental function and reduces fetal growth. J. Physiol. 2019, 597, 5597–5617. [Google Scholar] [CrossRef]
- Hofstee, P.; McKeating, D.R.; Bartho, L.A.; Anderson, S.T.; Perkins, A.V.; Cuffe, J.S.M. Maternal selenium deficiency in mice alters offspring glucose metabolism and thyroid status in a sexually dimorphic manner. Nutrients 2020, 12, 267. [Google Scholar] [CrossRef]
- Behne, D.; Hofer-Bosse, T. Effects of a low selenium status on the distribution and retention of selenium in the rat. J. Nutr. 1984, 114, 1289–1296. [Google Scholar] [CrossRef] [PubMed]
- Hopkins, L., Jr.; Pope, A.; Baumann, C. Distribution of microgram quantities of selenium in the tissues of the rat, and effects of previous selenium intake. J. Nutr. 1966, 88, 61–65. [Google Scholar] [CrossRef] [PubMed]
- Schomburg, L.; Schweizer, U. Hierarchical regulation of selenoprotein expression and sex-specific effects of selenium. Biochim. Biophys. Acta 2009, 1790, 1453–1462. [Google Scholar] [CrossRef] [PubMed]
- Müller, C.; Wingler, K.; Brigelius-Flohé, R. 3’UTRs of glutathione peroxidases differentially affect selenium-dependent mRNA stability and selenocysteine incorporation efficiency. Biolog. Chem. 2003, 384, 11–18. [Google Scholar] [CrossRef]
- Budiman, M.E.; Bubenik, J.L.; Miniard, A.C.; Middleton, L.M.; Gerber, C.A.; Cash, A.; Driscoll, D.M. Eukaryotic Initiation Factor 4a3 Is a Selenium-Regulated RNA-Binding Protein that Selectively Inhibits Selenocysteine Incorporation. Mol. Cell 2009, 35, 479–489. [Google Scholar] [CrossRef]
- Brigelius-Flohe, R.; Maiorino, M. Glutathione peroxidases. Biochim. Biophys. Acta 2013, 1830, 3289–3303. [Google Scholar] [CrossRef]
- Pitts, M.W.; Reeves, M.A.; Hashimoto, A.C.; Ogawa, A.; Kremer, P.; Seale, L.A.; Berry, M.J. Deletion of selenoprotein M leads to obesity without cognitive deficits. J. Biol. Chem. 2013, 288, 26121–26134. [Google Scholar] [CrossRef]
- Dumitrescu, A.M.; Liao, X.H.; Abdullah, M.S.; Lado-Abeal, J.; Majed, F.A.; Moeller, L.C.; Boran, G.; Schomburg, L.; Weiss, R.E.; Refetoff, S. Mutations in SECISBP2 result in abnormal thyroid hormone metabolism. Nat. Genet. 2005, 37, 1247–1252. [Google Scholar] [CrossRef]
- Marsili, A.; Zavacki, A.M.; Harney, J.W.; Larsen, P.R. Physiological role and regulation of iodothyronine deiodinases: A 2011 update. J. Endocrinol. Investig. 2011, 34, 395–407. [Google Scholar] [CrossRef]
- Schoenmakers, E.; Agostini, M.; Mitchell, C.; Schoenmakers, N.; Papp, L.; Rajanayagam, O.; Padidela, R.; Ceron-Gutierrez, L.; Doffinger, R.; Prevosto, C. Mutations in the selenocysteine insertion sequence–binding protein 2 gene lead to a multisystem selenoprotein deficiency disorder in humans. J. Clin. Investig. 2010, 120, 4220–4235. [Google Scholar] [CrossRef]
- Venardos, K.; Ashton, K.; Headrick, J.; Perkins, A. Effects of dietary selenium on post-ischemic expression of antioxidant mRNA. Mol. Cell. Biochem. 2005, 270, 131–138. [Google Scholar] [CrossRef] [PubMed]
- Kiermayer, C.; Northrup, E.; Schrewe, A.; Walch, A.; de Angelis, M.H.; Schoensiegel, F.; Zischka, H.; Prehn, C.; Adamski, J.; Bekeredjian, R.; et al. Heart-specific knockout of the mitochondrial thioredoxin reductase (Txnrd2) induces metabolic and contractile dysfunction in the aging myocardium. J. Am. Heart Assoc. 2015, 4, e002153. [Google Scholar] [CrossRef] [PubMed]
- Burk, R.F.; Hill, K.E. Selenoprotein P—Expression, functions, and roles in mammals. Biochim. Biophys. Acta BBA Gen. Subj. 2009, 1790, 1441–1447. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.G.; Hill, K.E.; Burk, R.F. Dietary selenium intake controls rat plasma selenoprotein P concentration. J. Nutr. 1989, 119, 1010–1012. [Google Scholar] [CrossRef]
- Kasik, J.W.; Rice, E.J. Selenoprotein P expression in liver, uterus and placenta during late pregnancy. Placenta 1995, 16, 67–74. [Google Scholar] [CrossRef]
- Burk, R.F.; Olson, G.E.; Hill, K.E.; Winfrey, V.P.; Motley, A.K.; Kurokawa, S. Maternal-fetal transfer of selenium in the mouse. FASEB J. 2013, 27, 3249–3256. [Google Scholar] [CrossRef]
- Hofstee, P.; McKeating, D.R.; Perkins, A.V.; Cuffe, J.S. Placental adaptations to micronutrient dysregulation in the programming of chronic disease. Clin. Exp. Pharmacol. Physiol. 2018, 45, 871–884. [Google Scholar] [CrossRef]
- Tobe, R.; Mihara, H.; Kurihara, T.; Esaki, N. Identification of proteins interacting with selenocysteine lyase. Biosci. Biotechnol. Biochem. 2009, 73, 1230–1232. [Google Scholar] [CrossRef]
- Wingler, K.; Bocher, M.; Flohe, L.; Kollmus, H.; Brigelius-Flohe, R. mRNA stability and selenocysteine insertion sequence efficiency rank gastrointestinal glutathione peroxidase high in the hierarchy of selenoproteins. Eur. J. Biochem. 1999, 259, 149–157. [Google Scholar] [CrossRef]
- Cao, L.; Zhang, L.; Zeng, H.; Wu, R.T.; Wu, T.L.; Cheng, W.H. Analyses of selenotranscriptomes and selenium concentrations in response to dietary selenium deficiency and age reveal common and distinct patterns by tissue and sex in telomere-dysfunctional mice. J. Nutr. 2017, 147, 1858–1866. [Google Scholar] [CrossRef]
- Stoytcheva, Z.R.; Berry, M.J. Transcriptional regulation of mammalian selenoprotein expression. Biochim. Biophys. Acta 2009, 1790, 1429–1440. [Google Scholar] [CrossRef] [PubMed]
- Shetty, S.P.; Shah, R.; Copeland, P.R. Regulation of selenocysteine incorporation into the selenium transport protein, selenoprotein P. J. Biol. Chem. 2014, 289, 25317–25326. [Google Scholar] [CrossRef] [PubMed]
- Squires, J.E.; Stoytchev, I.; Forry, E.P.; Berry, M.J. SBP2 binding affinity is a major determinant in differential selenoprotein mRNA translation and sensitivity to nonsense-mediated decay. Mol. Cell. Biol. 2007, 27, 7848–7855. [Google Scholar] [CrossRef] [PubMed]
- Brown, D.G.; Burk, R.F. Selenium retention in tissues and sperm of rats fed a Torula yeast diet. J. Nutr. 1973, 103, 102–108. [Google Scholar] [CrossRef] [PubMed]
- Riese, C.; Michaelis, M.; Mentrup, B.; Gotz, F.; Kohrle, J.; Schweizer, U.; Schomburg, L. Selenium-dependent pre- and posttranscriptional mechanisms are responsible for sexual dimorphic expression of selenoproteins in murine tissues. Endocrinology 2006, 147, 5883–5892. [Google Scholar] [CrossRef] [PubMed]
- Igarashi, T.; Satoh, T.; Ono, S.; Iwashita, K.; Hosokawa, M.; Ueno, K.; Kitagawa, H. Effect of steroidal sex hormones on the sex-related differences in the hepatic activities of gamma-glutamyltranspeptidase, glutathione S-transferase and glutathione peroxidase in rats. Res. Commun. Chem. Pathol. Pharmacol. 1984, 45, 225–232. [Google Scholar]
- Furman, C.; Rundlof, A.K.; Larigauderie, G.; Jaye, M.; Bricca, G.; Copin, C.; Kandoussi, A.M.; Fruchart, J.C.; Arner, E.S.J.; Rouis, M. Thioredoxin reductase 1 is upregulated in atherosclerotic plaques: Specific induction of the promoter in human macrophages by oxidized low-density lipoproteins. Free Radic. Biol. Med. 2004, 37, 71–85. [Google Scholar] [CrossRef]
- Tanito, M.; Nakamura, H.; Kwon, Y.W.; Teratani, A.; Masutani, H.; Shioji, K.; Kishimoto, C.; Ohira, A.; Horie, R.; Yodoi, J. Enhanced oxidative stress and impaired thioredoxin expression in spontaneously hypertensive rats. Antioxid. Redox Signal. 2004, 6, 89–97. [Google Scholar] [CrossRef]
- Pang, P.; Abbott, M.; Abdi, M.; Fucci, Q.-A.; Chauhan, N.; Mistri, M.; Proctor, B.; Chin, M.; Wang, B.; Yin, W. Pre-clinical model of severe glutathione peroxidase-3 deficiency and chronic kidney disease results in coronary artery thrombosis and depressed left ventricular function. Nephrol. Dial. Transplant. 2017, 33, 923–934. [Google Scholar] [CrossRef]
- Speckmann, B.; Walter, P.L.; Alili, L.; Reinehr, R.; Sies, H.; Klotz, L.O.; Steinbrenner, H. Selenoprotein P expression is controlled through interaction of the coactivator PGC-1α with FoxO1a and hepatocyte nuclear factor 4α transcription factors. Hepatology 2008, 48, 1998–2006. [Google Scholar] [CrossRef]
- Dickinson, H.; Moss, T.J.; Gatford, K.L.; Moritz, K.M.; Akison, L.; Fullston, T.; Hryciw, D.H.; Maloney, C.A.; Morris, M.J.; Wooldridge, A.L.; et al. A review of fundamental principles for animal models of DOHaD research: An Australian perspective. J. Dev. Orig. Health Dis. 2016, 7, 449–472. [Google Scholar] [CrossRef] [PubMed]
Treatment | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Gene | Maternal | Placenta | E18.5 | PN180 | ||||||
Liver | Kidney | Heart | Liver | Kidney | Heart | Liver | Kidney | Heart | ||
Txnrd1 | - | - | ↓ | - | ↑ | ↑ | ↑ | - | ↑ | - |
Txnrd2 | - | - | ↓ | - | ↑ | ↑ | ↑ | - | ↑ | - |
GPx1 | ↓ | ↓ | ↓ | - | - | ↑ | - | - | - | - |
GPx3 | ↓ | ↓ | ↓ | - | - | ↑ | - | - | - | ↓ |
DIO1 | ↓ | - | N/A | - | - | ↑ | N/A | - | N/A | N/A |
DIO2 | N/A | - | - | ↓ | N/A | ↑ | - | N/A | N/A | - |
DIO3 | N/A | N/A | N/A | ↓ | - | ↑ | - | N/A | N/A | N/A |
SelenoF | ↓ | - | - | - | ↑ | ↑ | ↑ | - | - | - |
SelenoS | ↓ | - | - | - | ↑ | ↑ | ↑ | - | - | - |
SelenoK | - | - | - | - | - | ↑ | ↑ | - | - | - |
SelenoM | ↓ | ↓ | ↓ | - | - | ↑ | - | - | - | - |
SelenoT | - | - | ↓ | - | ↑ | ↑ | ↑ | - | - | - |
SelenoN | N/A | ↓ | - | ↓ | ↑ | ↑ | - | - | - | - |
SelenoP | - | ↓ | ↓ | ↓ | ↑ | ↑ | - | ↓ | - | ↓ |
Sex | |||||||
---|---|---|---|---|---|---|---|
Gene | Placenta | E18.5 | PN180 | ||||
Liver | Kidney | Heart | Liver | Kidney | Heart | ||
Txnrd1 | - | ↓ | - | - | - | ↓ | - |
Txnrd2 | - | - | - | - | ↑ | - | ↑ |
GPx1 | - | - | - | - | ↑ | ↓ | ↑ |
GPx3 | - | - | - | - | ↑ | - | ↑ |
DIO1 | - | - | - | N/A | ↑ | N/A | N/A |
DIO2 | - | N/A | - | - | N/A | N/A | ↑ |
DIO3 | - | - | - | - | N/A | N/A | N/A |
SelenoF | - | - | - | - | ↑ | - | ↑ |
SelenoS | - | - | - | - | ↓ | - | ↑ |
SelenoK | - | - | - | - | - | ↑ | - |
SelenoM | - | - | - | - | ↑ | - | - |
SelenoT | - | - | - | - | ↑ | - | ↑ |
SelenoN | - | - | - | ↑ | ↑ | - | - |
SelenoP | - | - | - | - | ↑ | - | ↑ |
Maternal | |||||||||
---|---|---|---|---|---|---|---|---|---|
Liver | Kidney | Heart | |||||||
Gene | Normal | Low | P | Normal | Low | P | Normal | Low | P |
Txnrd1 | 1.01 ± 0.06 | 1.16 ± 0.23 | NS | 1.05 ± 0.12 | 1.21 ± 0.18 | NS | 1.17 ± 0.24 | 0.63 ± 0.06 | 0.0497 |
Txnrd2 | 1.05 ± 0.13 | 0.91 ± 0.32 | NS | 1.21 ± 0.27 | 1.31 ± 0.45 | NS | 1.22 ± 0.28 | 0.56 ± 0.10 | 0.0477 |
Gpx1 | 1.00 ± 0.17 | 0.44 ± 0.15 | 0.0271 | 1.24 ± 0.14 | 0.79 ± 0.13 | 0.0369 | 1.03 ± 0.10 | 0.51 ± 0.12 | 0.0051 |
Gpx3 | 1.12 ± 0.18 | 0.60 ± 0.16 | 0.0473 | 1.12 ± 0.21 | 0.56 ± 0.11 | 0.0393 | 1.23 ± 0.30 | 0.34 ± 0.05 | 0.0088 |
DIO1 | 1.08 ± 0.16 | 0.54 ± 0.19 | 0.0458 | 1.26 ± 0.27 | 1.64 ± 0.42 | NS | - | - | - |
DIO2 | - | - | - | 1.11 ± 0.16 | 0.95 ± 0.16 | NS | 1.19 ± 0.26 | 1.17 ± 0.29 | NS |
DIO3 | - | - | - | - | - | - | - | - | - |
SelenoF | 1.18 ± 0.21 | 0.64 ± 0.10 | 0.0463 | 1.05 ± 0.12 | 1.01 ± 0.14 | NS | 1.03 ± 0.11 | 0.78 ± 0.17 | NS |
SelenoS | 1.18 ± 0.20 | 0.66 ± 0.08 | 0.0370 | 1.06 ± 0.12 | 1.17 ± 0.17 | NS | 1.03 ± 0.12 | 0.87 ± 0.16 | NS |
SelenoK | 1.06 ± 0.14 | 0.73 ± 0.20 | NS | 1.03 ± 0.10 | 1.08 ± 0.08 | NS | 1.03 ± 0.11 | 0.70 ± 0.11 | NS |
SelenoM | 1.01 ± 0.06 | 0.61 ± 0.18 | 0.0353 | 1.02 ± 0.08 | 0.68 ± 0.10 | 0.0169 | 1.11 ± 0.20 | 0.39 ± 0.10 | 0.0157 |
SelenoT | 1.09 ± 0.18 | 0.66 ± 0.13 | NS | 1.03 ± 0.08 | 0.89 ± 0.10 | NS | 1.08 ± 0.17 | 0.61 ± 0.11 | 0.0297 |
SelenoN | - | - | - | 1.01 ± 0.05 | 0.64 ± 0.10 | 0.0055 | 1.36 ± 0.38 | 0.76 ± 0.12 | NS |
SelenoP | 1.05 ± 0.11 | 0.78 ± 0.21 | NS | 1.05 ± 0.15 | 0.63 ± 0.05 | 0.0183 | 1.05 ± 0.14 | 0.59 ± 0.08 | 0.0130 |
E18.5 Placenta | |||||||
---|---|---|---|---|---|---|---|
Gene | Male | Female | Ptrt | Psex | Pint | ||
Normal | Low | Normal | Low | ||||
Txnrd1 | 1.27 ± 0.13 | 1.33 ± 0.12 | 1.15 ± 0.18 | 1.47 ± 0.23 | NS | NS | NS |
Txnrd2 | 1.38 ± 0.18 | 2.12 ± 0.29 | 1.37 ± 0.48 | 1.62 ± 0.28 | NS | NS | NS |
Gpx1 | 1.12 ± 0.03 | 1.07 ± 0.05 | 1.00 ± 0.18 | 1.12 ± 0.04 | NS | NS | NS |
Gpx3 | 1.71 ± 0.45 | 1.33 ± 0.47 | 1.46 ± 0.44 | 1.64 ± 0.24 | NS | NS | NS |
DIO1 | 0.85 ± 0.28 | 2.55 ± 0.36 | 0.88 ± 0.18 | 3.53 ± 0.95 | NS | NS | NS |
DIO2 | 2.13 ± 0.91 | 1.39 ± 0.52 | 3.10 ± 1.00 | 1.08 ± 0.23 a | 0.0422 | NS | NS |
DIO3 | 1.03 ± 0.42 | 0.77 ± 0.20 | 0.76 ± 0.18 | 0.58 ± 0.13 | 0.0491 | NS | NS |
SelenoF | 0.91 ± 0.07 | 1.39 ± 0.19 | 1.29 ± 0.29 | 1.50 ± 0.12 | NS | NS | NS |
SelenoS | 0.95 ± 0.12 | 1.21 ± 0.17 | 1.13 ± 0.24 | 1.11 ± 0.04 | NS | NS | NS |
SelenoK | 1.02 ± 0.04 | 1.09 ± 0.06 | 1.23 ± 0.21 | 1.68 ± 0.25 | NS | NS | NS |
SelenoM | 0.96 ± 0.11 | 1.32 ± 0.12 | 1.53 ± 0.26 | 1.46 ± 0.13 | NS | NS | NS |
SelenoT | 0.91 ± 0.11 | 0.99 ± 0.11 | 0.96 ± 0.10 | 1.19 ± 0.10 | NS | NS | NS |
SelenoN | 0.90 ± 0.12 | 0.62 ± 0.11 | 1.03 ± 0.06 | 0.60 ± 0.03 c | 0.0002 | NS | NS |
SelenoP | 1.11 ± 0.29 | 0.66 ± 0.28 | 0.64 ± 0.22 | 0.72 ± 0.14 | 0.0491 | NS | NS |
Group | Gene Name | Gene Acronym | Accession Number | Primer Sequence |
---|---|---|---|---|
Selenoproteins | Thioredoxin Reductase 1 | Txnrd1 | NM_001042513 | F’ TCCCAACGAAAATTGAACAGR’ TGTTAAATTCGCCCTCTATG |
Thioredoxin Reductase 2 | Txnrd2 | NM_013711 | F’ GAATCACAAGTGACGACATCR’ AAAGATGACATTTGCTGGTC | |
Glutathione Peroxidase 1 | Gpx1 | NM_008160 | F’ GGAGAATGGCAAGAATGAAGR’ TTCGCACTTCTCAAACAATG | |
Glutathione Peroxidase 3 | Gpx3 | NM_008161 | F’ ACAAGAGAAGTCTAAGACAGACR’ TGTAGTGCATTCAGTTCAAG | |
Iodothyronine Deiodinase Type 1 | DIO1 | NM_007860 | F’ GATCTGCTACAAGGGTAAAGR’ TAGTACTTCATCTGGGAACAC | |
Iodothyronine Deiodinase Type 2 | DIO2 | NM_010050 | F’ CAGTCTTTTTCTCCAACTGCR’ CCAGTTTAACCTGTTTGTAGG | |
Iodothyronine Deiodinase Type 3 | DIO3 | NM_172119 | F’ AAGAAAGTCAAAGGTTGTGGR’ AAAACGTACAAAAGGGAGTC | |
Selenoprotein F | SelenoF | NM_053102 | F’ CTACAGATCAAGTATGTTCGAGR’ TATATGCGTTCCAACTTCTC | |
Selenoprotein S | SelenoS | NM_024439 | F’ ACCTGATGTTGTTGTTAGCR’ CTCTTCTTCAAGCTGTCTTAG | |
Selenoprotein K | SelenoK | NM_019979 | F’ TGATTCCAGATACGACGATGR’ CATTTACCTTCCTCATCCAC | |
Selenoprotein M | SelenoM | NM_053267 | F’ GACAGTTGAATCGCCTAAAGR’ TGGTAATTTCGGCTTAACAG | |
Selenoprotein T | SelenoT | NM_001040396 | F’ GTTCCAGATTTGTGTATCCTGR’ GTGTCTATAAATTGGTTGAGGG | |
Selenoprotein N | SelenoN | NM_029100 | F’ CTTCAAGAAGGTCAACTACCR’ AGCAAGATGGAATGAACAAG | |
Selenoprotein P | SelenoP | NM_001042613 | F’ ATGACTTCCTCATCTATGACAGR’ GAGGTCACAGTTTACAGAAG | |
House Keepers | Beta-Actin | Actb | NM_007393 | F’ GATGTATGAAGGCTTTGGTCR’ TGTGCACTTTTATTGGTCTC |
Ubiquitin C | Ubc | NM_019639 | F’ GAGACGATGCAGATCTTTGR’ ATGTTGTAGTCTGACAGGG | |
Hypoxanthine Phosphoribosyltransferase 1 | Hprt1 | NM_013556 | F’ AGGGATTTGAATCACGTTTGR’ TTTACTGGCAACATCAACAG | |
Topoisomerase 1 | Top1 | NM_009408 | F’ GAAATTCCTAGAGCATAAAGGGR’ GGACTCAGCTTCATAACTTTAC | |
18S Ribosomal RNA | Rn18s | NM_003278 | F’ CAGTTATGGTTCCTTTGGTCR’ TTATCTAGAGTCACCAAGCC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hofstee, P.; Cuffe, J.S.M.; Perkins, A.V. Analysis of Selenoprotein Expression in Response to Dietary Selenium Deficiency During Pregnancy Indicates Tissue Specific Differential Expression in Mothers and Sex Specific Changes in the Fetus and Offspring. Int. J. Mol. Sci. 2020, 21, 2210. https://doi.org/10.3390/ijms21062210
Hofstee P, Cuffe JSM, Perkins AV. Analysis of Selenoprotein Expression in Response to Dietary Selenium Deficiency During Pregnancy Indicates Tissue Specific Differential Expression in Mothers and Sex Specific Changes in the Fetus and Offspring. International Journal of Molecular Sciences. 2020; 21(6):2210. https://doi.org/10.3390/ijms21062210
Chicago/Turabian StyleHofstee, Pierre, James S.M. Cuffe, and Anthony V. Perkins. 2020. "Analysis of Selenoprotein Expression in Response to Dietary Selenium Deficiency During Pregnancy Indicates Tissue Specific Differential Expression in Mothers and Sex Specific Changes in the Fetus and Offspring" International Journal of Molecular Sciences 21, no. 6: 2210. https://doi.org/10.3390/ijms21062210
APA StyleHofstee, P., Cuffe, J. S. M., & Perkins, A. V. (2020). Analysis of Selenoprotein Expression in Response to Dietary Selenium Deficiency During Pregnancy Indicates Tissue Specific Differential Expression in Mothers and Sex Specific Changes in the Fetus and Offspring. International Journal of Molecular Sciences, 21(6), 2210. https://doi.org/10.3390/ijms21062210