Calcium Modulation, Anti-Oxidant and Anti-Inflammatory Effect of Skin Allergens Targeting the Nrf2 Signaling Pathway in Alzheimer’s Disease Cellular Models
Abstract
1. Introduction
2. Results
2.1. Selection of Skin Allergens
2.2. Effect of Skin Allergens on N2a and BV-2 Cell Metabolism and Viability
2.3. Antioxidant Response Evoked by Skin Allergens in N2a Neuronal Cells
2.3.1. Skin Allergens Activate Nrf2 Transcription Factor in APP-Overexpressing Neuronal Cells
2.3.2. Skin Allergens Increased Hmox1 Gene Expression in APP-Overexpressing Neuronal Cells
2.3.3. Skin Allergens Increased HMOX1 Protein Levels in APP-Overexpressing Neuronal Cells
2.4. Skin Allergen Modulation of Mitochondrial Membrane Potential and Calcium Basal Levels in N2a Neuronal Cells—Positive Effect of PA and MHC
2.5. Anti-Inflammatory Profile Evoked by Skin Allergens in BV-2 Microglia Cells
2.5.1. iNos mRNA Levels Decrease Induced by DMF and MHC in LPS-Exposed Microglia
2.5.2. Electrophilic Compounds Reduced iNOS Protein Levels in LPS-Exposed Microglia
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Methods
4.2.1. In Silico Analysis
4.2.2. Cell Culture
4.2.3. Cell Treatment
4.2.4. Cell Metabolism (Alamar Blue Assay)
4.2.5. Cell Viability (Flow Cytometry)
4.2.6. Aβ40 and Aβ42 Peptide Levels Quantification
4.2.7. Nrf2 Activation
4.2.8. Analysis of Gene Expression by Real-Time RT-PCR
4.2.9. Cell Lysates and Western Blotting
4.2.10. Intracellular Calcium Levels Measurement
4.2.11. Mitochondrial Calcium Levels Measurement
4.2.12. Mitochondrial Membrane Potential Integrity
4.2.13. Il-1β Secretion
4.2.14. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
| AD | Alzheimer disease |
| AKT | Protein kinase B |
| ARE | antioxidant response element |
| DMF | Dimethyl fumarate |
| EMA | European Medicines Agency |
| FDA | Food and Drug Administration |
| GSK3β | Glycogen synthase kinase 3 beta |
| HMOX1 | Heme oxygenase 1 |
| iNOS | Inducible nitric oxide synthase |
| IL-1β | Interleukin 1β |
| Keap1 | kelch-like erythroid cell-derived protein with cap‘n’collar homology-associated protein 1 |
| MHC | Methyl heptine carbonate |
| Nrf2 | Nuclear factor (erythroid-derived 2)-like 2 |
| PA | Phthalic anhydride |
| PPD | 1,4-phenylenediamine |
| TNF-α | Tumor necrosis factor-α |
References
- Seifan, A.; Schelke, M.; Obeng-Aduasare, Y.; Isaacson, R. Early Life Epidemiology of Alzheimer’s Disease—A Critical Review. Neuroepidemiology 2015, 45, 237–254. [Google Scholar] [CrossRef]
- Marešová, P.; Mohelská, H.; Dolejš, J.; Kuča, K. Socio-economic Aspects of Alzheimer’s Disease. Curr. Alzheimer Res. 2015, 12, 903–911. [Google Scholar]
- Dong, Y.; Li, X.; Cheng, J.; Hou, L. Drug Development for Alzheimer’s Disease: Microglia Induced Neuroinflammation as a Target? Int. J. Mol. Sci. 2019, 20, 558. [Google Scholar] [CrossRef]
- Ramsey, C.P.; Glass, C.A.; Montgomery, M.B.; Lindl, K.A.; Ritson, G.P.; Chia, L.A.; Hamilton, R.L.; Chu, C.T.; Jordan-Sciutto, K.L. Expression of Nrf2 in Neurodegenerative Diseases. J. Neuropathol. Exp. Neurol. 2007, 66, 75–85. [Google Scholar] [CrossRef]
- De Vries, H.E.; Witte, M.; Hondius, D.; Rozemuller, A.J.; Drukarch, B.; Hoozemans, J.; Van Horssen, J. Nrf2-induced antioxidant protection: A promising target to counteract ROS-mediated damage in neurodegenerative disease? Free Radic. Biol. Med. 2008, 45, 1375–1383. [Google Scholar] [CrossRef]
- Kanninen, K.M.; Pomeshchik, Y.; Leinonen, H.; Malm, T.; Koistinaho, J.; Levonen, A.-L. Applications of the Keap1–Nrf2 system for gene and cell therapy. Free Radic. Biol. Med. 2015, 88, 350–361. [Google Scholar] [CrossRef]
- Mota, S.I.; Costa, R.O.; Ferreira, I.L.; Santana, I.; Caldeira, G.L.; Padovano, C.; Fonseca, A.C.; Baldeiras, I.; Cunha, C.; Letra, L.; et al. Oxidative stress involving changes in Nrf2 and ER stress in early stages of Alzheimer’s disease. Biochim. Biophys. Acta 2015, 1852, 1428–1441. [Google Scholar] [CrossRef]
- Natsch, A. The Nrf2-Keap1-ARE Toxicity Pathway as a Cellular Sensor for Skin Sensitizers—Functional Relevance and a Hypothesis on Innate Reactions to Skin Sensitizers. Toxicol. Sci. 2010, 113, 284–292. [Google Scholar] [CrossRef]
- Rushmore, T.H.; Morton, M.R.; Pickett, C.B. The Antioxidant Responsive Element. Activation by oxidative stress and identification of the DNA consensus sequence required for funtional activity. J. Biol. Chem. 1991, 266, 11632–11639. [Google Scholar]
- Hayes, J.D.; Dinkova-Kostova, A.T. The Nrf2 regulatory network provides an interface between redox and intermediary metabolism. Trends Biochem. Sci. 2014, 39, 199–218. [Google Scholar] [CrossRef]
- Sihvola, V.; Levonen, A.-L. Keap1 as the redox sensor of the antioxidant response. Arch. Biochem. Biophys. 2017, 617, 94–100. [Google Scholar] [CrossRef]
- Xu, Z.; Zhang, F.; Sun, F.; Gu, K.; Dong, S.; He, D. Dimethyl fumarate for multiple sclerosis. Cochrane Database Syst. Rev. 2015, CD011076. [Google Scholar] [CrossRef]
- Mills, E.A.; Ogrodnik, M.A.; Plave, A.; Mao-Draayer, Y. Emerging Understanding of the Mechanism of Action for Dimethyl Fumarate in the Treatment of Multiple Sclerosis. Front. Neurol. 2018, 9, 5. [Google Scholar] [CrossRef]
- Linker, R.A.; Lee, D.-H.; Ryan, S.; Van Dam, A.M.; Conrad, R.; Bista, P.; Zeng, W.; Hronowsky, X.; Buko, A.; Chollate, S.; et al. Fumaric acid esters exert neuroprotective effects in neuroinflammation via activation of the Nrf2 antioxidant pathway. Brain 2011, 134, 678–692. [Google Scholar] [CrossRef]
- Majkutewicz, I.; Kurowska, E.; Podlacha, M.; Myślińska, D.; Grembecka, B.; Ruciński, J.; Plucińska, K.; Jerzemowska, G.; Wrona, D. Dimethyl fumarate attenuates intracerebroventricular streptozotocin-induced spatial memory impairment and hippocampal neurodegeneration in rats. Behav. Brain Res. 2016, 308, 24–37. [Google Scholar] [CrossRef]
- Zyla, K.; Larabee, C.M.; Georgescu, C.; Berkley, C.; Reyna, T.; Plafker, S.M. Dimethyl fumarate mitigates optic neuritis. Mol. Vis. 2019, 25, 446–461. [Google Scholar]
- Jaiswal, A.K.; Sandey, M.; Suryawanshi, A.; Cattley, R.C.; Mishra, A. Dimethyl fumarate abrogates dust mite-induced allergic asthma by altering dendritic cell function. Immun. Inflamm. Dis. 2019, 7, 201–213. [Google Scholar] [CrossRef]
- Natsch, A.; Ryan, C.A.; Foertsch, L.; Emter, R.; Jaworska, J.; Gerberick, F.; Kern, P. A dataset on 145 chemicals tested in alternative assays for skin sensitization undergoing prevalidation. J. Appl. Toxicol. 2013, 33, 1337–1352. [Google Scholar] [CrossRef]
- Natsch, A.; Emter, R.; Ellis, G. Filling the concept with data: Integrating data from different in vitro and in silico assays on skin sensitizers to explore the battery approach for animal-free skin sensitization testing. Toxicol. Sci. 2009, 107, 106–121. [Google Scholar]
- Jaworska, J.; Harol, A.; Kern, P.S.; Gerberick, G.F. Integrating non-animal test information into an adaptive testing strategy—skin sensitization proof of concept case. ALTEX-Altern. Anim. Exp. 2011, 28, 211–225. [Google Scholar]
- Basketter, D.A.; Alépée, N.; Ashikaga, T.; Barroso, J.; Gilmour, N.; Goebel, C.; Hibatallah, J.; Hoffmann, S.; Kern, P.; Martinozzi-Teissier, S.; et al. Categorization of Chemicals According to Their Relative Human Skin Sensitizing Potency. Dermatitis 2014, 25, 11–21. [Google Scholar] [CrossRef]
- Lastres-Becker, I.; García-Yagüe, A.J.; Scannevin, R.H.; Casarejos, M.J.; Kügler, S.; Rábano, A.; Cuadrado, A. Repurposing the NRF2 Activator Dimethyl Fumarate as Therapy Against Synucleinopathy in Parkinson’s Disease. Antioxid. Redox Signal. 2016, 25, 61–77. [Google Scholar] [CrossRef]
- Cuadrado, A.; Kügler, S.; Lastres-Becker, I. Pharmacological targeting of GSK-3 and NRF2 provides neuroprotection in a preclinical model of tauopathy. Redox Biol. 2018, 14, 522–534. [Google Scholar] [CrossRef]
- Nitti, M.; Piras, S.; Brondolo, L.; Marinari, U.M.; Pronzato, M.A.; Furfaro, A.L. Heme Oxygenase 1 in the Nervous System: Does It Favor Neuronal Cell Survival or Induce Neurodegeneration? Int. J. Mol. Sci. 2018, 19, 2260. [Google Scholar] [CrossRef]
- Schipper, H.M.; Song, W.; Tavitian, A.; Cressatti, M. The sinister face of heme oxygenase-1 in brain aging and disease. Prog. Neurobiol. 2019, 172, 40–70. [Google Scholar] [CrossRef]
- Maier, T.; Güell, M.; Serrano, L. Correlation of mRNA and protein in complex biological samples. FEBS Lett. 2009, 583, 3966–3973. [Google Scholar] [CrossRef]
- Rojo, A.I.; Rada, P.; Egea, J.; Rosa, A.O.; López, M.G.; Cuadrado, A. Functional interference between glycogen synthase kinase-3 beta and the transcription factor Nrf2 in protection against kainate-induced hippocampal celldeath. Mol. Cell. Neurosci. 2008, 39, 125–132. [Google Scholar] [CrossRef]
- Salazar, M.; Rojo, A.I.; Velasco, D.; De Sagarra, R.M.; Cuadrado, A. Glycogen Synthase Kinase-3β Inhibits the Xenobiotic and Antioxidant Cell Response by Direct Phosphorylation and Nuclear Exclusion of the Transcription Factor Nrf2. J. Biol. Chem. 2006, 281, 14841–14851. [Google Scholar] [CrossRef]
- Sawle, P.; Moulton, B.E.; Jarzykowska, M.; Green, C.J.; Foresti, R.; Fairlamb, I.J.S.; Motterlini, R. Structure−Activity Relationships of Methoxychalcones as Inducers of Heme Oxygenase-1. Chem. Res. Toxicol. 2008, 21, 1484–1494. [Google Scholar] [CrossRef]
- Baldwin, A.G.; Brough, D.; Freeman, S. Inhibiting the Inflammasome: A Chemical Perspective. J. Med. Chem. 2016, 59, 1691–1710. [Google Scholar] [CrossRef]
- Cuadrado, A. NRF2 in neurodegenerative diseases. Curr. Opin. Toxicol. 2016, 1, 46–53. [Google Scholar] [CrossRef]
- Begley, J.G.; Duan, W.; Chan, S.; Duff, K.; Mattson, M.P. Altered Calcium Homeostasis and Mitochondrial Dysfunction in Cortical Synaptic Compartments of Presenilin-1 Mutant Mice. J. Neurochem. 1999, 72, 1030–1039. [Google Scholar] [CrossRef]
- Mattson, M.; Cheng, B.; Davis, D.; Bryant, K.; Lieberburg, I.; Rydel, R. Beta-Amyloid peptides destabilize calcium homeostasis and render human cortical neurons vulnerable to excitotoxicity. J. Neurosci. 1992, 12, 376–389. [Google Scholar] [CrossRef]
- Paula-Lima, A.C.; Adasme, T.; SanMartín, C.; Sebollela, A.; Hetz, C.; Carrasco, M.A.; Ferreira, S.T.; Hidalgo, C. Amyloid beta-peptide oligomers stimulate RyRmediated Ca2+ release inducing mitochondrial fragmentation in hippocampal neurons and prevent RyR-mediated dendritic spine remodeling produced by BDNF. Antioxid. Redox Signal. 2011, 14, 1209–1223. [Google Scholar] [CrossRef]
- Ferreira, I.L.; Ferreiro, E.; Schmidt, J.; Cardoso, J.M.; Pereira, C.M.; Carvalho, A.L.; Oliveira, C.R.; Rego, A.C. Abeta and NMDAR activation cause mitochondrial dysfunction involving ER calcium release. Neurobiol. Aging 2015, 36, 680–692. [Google Scholar] [CrossRef]
- Dreses-Werringloer, U.; Lambert, J.C.; Vingtdeux, V.; Zhao, H.; Vais, H.; Siebert, A.; Jain, A.; Koppel, J.; Rovelet-Lecrux, A.; Hannequin, D.; et al. A polymorphism in CALHM1 influences Ca2+ homeostasis, Abeta levels, and Alzheimer’s disease risk. Cell 2008, 133, 1149–1161. [Google Scholar] [CrossRef]
- Chang, E.H.; Savage, M.J.; Flood, D.G.; Thomas, J.M.; Levy, R.B.; Mahadomrongkul, V.; Shirao, T.; Aoki, C.; Huerta, P.T. AMPA receptor downscaling at the onset of Alzheimer’s disease pathology in double knockin mice. Proc. Natl. Acad. Sci. USA 2006, 103, 3410–3415. [Google Scholar] [CrossRef]
- Tong, B.C.; Lee, C.S.; Cheng, W.H.; Lai, K.O.; Foskett, J.K.; Cheung, K.H. Familial Alzheimer’s disease-associated presenilin 1 mutants promote gamma-secretase cleavage of STIM1 to impair store-operated Ca2+ entry. Sci. Signal. 2016, 9, ra89. [Google Scholar] [CrossRef]
- Sarasija, S.; Laboy, J.T.; Ashkavand, Z.; Bonner, J.; Tang, Y.; Norman, K.R. Presenilin mutations deregulate mitochondrial Ca2+ homeostasis and metabolic activity causing neurodegeneration in Caenorhabditis elegans. eLife 2018, 7, e33052. [Google Scholar] [CrossRef]
- Sepulveda-Falla, D.; Barrera-Ocampo, A.; Hagel, C.; Korwitz, A.; Vinueza-Veloz, M.F.; Zhou, K.; Schonewille, M.; Zhou, H.; Velazquez-Perez, L.; Rodriguez-Labrada, R.; et al. Familial Alzheimer’s disease–associated presenilin-1 alters cerebellar activity and calcium homeostasis. J. Clin. Investig. 2014, 124, 1552–1567. [Google Scholar] [CrossRef]
- Area-Gomez, E.; De Groof, A.; Bonilla, E.; Montesinos, J.; Tanji, K.; Boldogh, I.; Pon, L.; Schon, E.A. A key role for MAM in mediating mitochondrial dysfunction in Alzheimer disease. Cell Death Dis. 2018, 9, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Area-Gomez, E.; Castillo, M.D.C.L.; Tambini, M.D.; Guardia-Laguarta, C.; De Groof, A.J.C.; Madra, M.; Ikenouchi, J.; Umeda, M.; Bird, T.D.; Sturley, S.L.; et al. Upregulated function of mitochondria-associated ER membranes in Alzheimer disease. EMBO J. 2012, 31, 4106–4123. [Google Scholar] [CrossRef] [PubMed]
- Jadiya, P.; Kolmetzky, D.W.; Tomar, D.; Di Meco, A.; Lombardi, A.A.; Lambert, J.P.; Luongo, T.S.; Ludtmann, M.H.; Praticò, D.; Elrod, J.W. Impaired mitochondrial calcium efflux contributes to disease progression in models of Alzheimer’s disease. Nat. Commun. 2019, 10, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Bernhardi, R.; Eugenín, J. Microglial reactivity to beta-amyloid is modulated by astrocytes and proinflammatory factors. Brain Res. 2004, 1025, 186–193. [Google Scholar] [CrossRef]
- Kummer, M.P.; Hermes, M.; Delekarte, A.; Hammerschmidt, T.; Kumar, S.; Terwel, D.; Walter, J.; Pape, H.-C.; König, S.; Roeber, S.; et al. Nitration of Tyrosine 10 Critically Enhances Amyloid β Aggregation and Plaque Formation. Neuron 2011, 71, 833–844. [Google Scholar] [CrossRef]
- Zhao, B.; Liu, P.; Wei, M.; Li, Y.; Liu, J.; Ma, L.; Shang, S.; Jiang, Y.; Huo, K.; Wang, J.; et al. Chronic sleep restriction induces Abeta accumulation by disrupting the balance of Abeta production and clearance in rats. Neurochem. Res. 2019, 44, 859–873. [Google Scholar] [CrossRef]
- Liu, P.; Zhao, B.; Wei, M.; Li, Y.; Liu, J.; Ma, L.; Shang, S.; Huo, K.; Wang, J.; Li, R.; et al. Activation of Inflammation is Associated with Amyloid-β Accumulation Induced by Chronic Sleep Restriction in Rats. J. Alzheimers Dis. 2020, 74, 1–15. [Google Scholar] [CrossRef]
- Wilms, H.; Sievers, J.; Rickert, U.; Rostami-Yazdi, M.; Mrowietz, U.; Lucius, R. Dimethyl fumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J. Neuroinflamm. 2010, 7, 30. [Google Scholar] [CrossRef]
- Peng, H.; Li, H.; Sheehy, A.; Cullen, P.; Allaire, N.; Scannevin, R.H. Dimethyl fumarate alters microglia phenotype and protects neurons against proinflammatory toxic microenvironments. J. Neuroimmunol. 2016, 299, 35–44. [Google Scholar] [CrossRef]
- Bitton, A.; Avlas, S.; Reichman, H.; Itan, M.; Karo-Atar, D.; Azouz, N.P.; Rozenberg, P.; Diesendruck, Y.; Nahary, L.; Rothenberg, M.E.; et al. A key role for IL-13 signaling via the type 2 IL-4 receptor in experimental atopic dermatitis. Sci. Immunol. 2020, 5, eaaw2938. [Google Scholar] [CrossRef]
- Rubio-Perez, J.M.; Morillas-Ruiz, J.M. A review: Inflammatory process in Alzheimer’s disease, role of cytokines. Sci. World J. 2012, 2012, 756357. [Google Scholar] [CrossRef] [PubMed]
- Gadani, S.P.; Cronk, J.C.; Norris, G.T.; Kipnis, J. IL-4 in the brain: A cytokine to remember. J. Immunol. 2012, 189, 4213–4219. [Google Scholar] [CrossRef]
- Daina, A.; Michielin, O.; Zoete, V. iLOGP: A Simple, Robust, and Efficient Description of n-Octanol/Water Partition Coefficient for Drug Design Using the GB/SA Approach. J. Chem. Inf. Model. 2014, 54, 3284–3301. [Google Scholar] [CrossRef]
- Clark, D.E. Rapid calculation of polar molecular surface area and its application to the prediction of transport phenomena. 1. Prediction of intestinal absorption. J. Pharm. Sci. 1999, 88, 807–814. [Google Scholar] [CrossRef]
- Ajay; Walters, W.P.; Murcko, M.A. Can We Learn to Distinguish between “Drug-like” and “Nondrug-like” Molecules? J. Med. Chem. 1998, 41, 3314–3324. [Google Scholar] [CrossRef]
- Lipinski, C.A.; Lombardo, F.; Dominy, B.W.; Feeney, P.J. Experimental and computational approaches to estimate solubility and permeability in drug discovery and development settings. Adv. Drug Deliv. Rev. 1997, 23, 3–25. [Google Scholar] [CrossRef]
- Baell, J.B.; Holloway, G.A. New Substructure Filters for Removal of Pan Assay Interference Compounds (PAINS) from Screening Libraries and for Their Exclusion in Bioassays. J. Med. Chem. 2010, 53, 2719–2740. [Google Scholar] [CrossRef]
- Daina, A.; Michielin, O.; Zoete, V. SwissADME: A free web tool to evaluate pharmacokinetics, drug-likeness and medicinal chemistry friendliness of small molecules. Sci. Rep. 2017, 7, 42717. [Google Scholar] [CrossRef]
- Cagnin, M.; Ozzano, M.; Bellio, N.; Fiorentino, I.; Follo, C.; Isidoro, C. Dopamine induces apoptosis in APPswe-expressing Neuro2A cells following Pepstatin-sensitive proteolysis of APP in acid compartments. Brain Res. 2012, 1471, 102–117. [Google Scholar] [CrossRef]
- O’Brien, J.; Wilson, I.; Orton, T.; Pognan, F. Investigation of the Alamar Blue (resazurin) fluorescent dye for the assessment of mammalian cell cytotoxicity. Eur. J. Biochem. 2000, 267, 5421–5426. [Google Scholar] [CrossRef]
- Neves, B.M.; Rosa, S.C.; Martins, J.D.; Silva, A.; Gonçalo, M.; Lopes, M.; Cruz, M.T. Development of an in Vitro Dendritic Cell-Based Test for Skin Sensitizer Identification. Chem. Res. Toxicol. 2013, 26, 368–378. [Google Scholar] [CrossRef]










| Chemical Name | Mechanistic Domains of Chemical Reaction | Oral Absorption | BBB Crossing |
|---|---|---|---|
| Atranol | – | High | Yes |
| 5-Chloro-2-methyl-4-isothiazolin-3-one/MCI | – | High | Yes |
| 4-Nitrobenzyl bromide | – | High | Yes |
| 1,4-Phenylenediamine/PPD | Michael Acceptor | High | Yes |
| 2,4,6-Trichloro-1,3,5-triazine/cyanuric chloride | – | High | Yes |
| Tetrachlorosalicylanilide/3,3′,4′,5-Tetrachlorosalicylanilide/Tetrachloro-salicylanilide | Acyl Transfer | High | Yes |
| 4-Ethoxymethylene-2-phenyl-2-oxazolin-5-one/oxazolone | – | High | Yes |
| Squaric acid dibutyl ester | – | High | Yes |
| Chloroatranol | – | High | Yes |
| Dimethyl fumarate/DMF | Michael Acceptor | High | Yes |
| Diphenylcyclopropenone/DP/DCP/DPCP | Acyl Transfer | High | Yes |
| Benzoyl peroxide | Acyl Transfer | High | Yes |
| 3-Methyl catechol | – | High | Yes |
| Glutaraldehyde (act. 50%) | Schiff base reagent | High | Yes |
| Cinnamic aldehyde | – | High | Yes |
| Methyl heptine carbonate/Methyl 2-octynoate/MHC | Michael Acceptor | High | Yes |
| Methyl octine carbonate/Methyl 2-nonynoate | Michael Acceptor | High | Yes |
| N,N-dimethyl-4-nitrosoaniline | – | High | Yes |
| Diethyl maleate | – | High | Yes |
| 6-Methyl-3,5-heptadien-2-one | Michael Acceptor | High | Yes |
| 2-Hexylidene cyclopentanone | Michael Acceptor | High | Yes |
| 1,2-Benzisothiazolin-3-one/Proxel active | SN2-reaction at the S-atom proposed | High | Yes |
| 1,2-Dibromo-2,4-dicyanobutane/MDGN/Methyldibromo glutaronitrile | Michael Acceptor | High | Yes |
| Thimerosal | – | High | Yes |
| trans-2-Hexenal | Michael Acceptor | High | Yes |
| Hexahydrophthalic anhydride/1,2-cyclohexane dicarboxylic anhydride | – | High | Yes |
| Phthalic anhydride/PA | – | High | Yes |
| 5-methyl-2-phenyl-2,4-dihydro-pyrazol-3-one/Phenylmethylpyrazole/A039 | – | High | Yes |
| 2-Methoxy-4-methylphenol/Creosol | Michael Acceptor | High | Yes |
| 2-Aminophenol | Michael Acceptor | High | Yes |
| Isoeugenol | Michael Acceptor | High | Yes |
| Cinnamyl Alcohol | Michael Acceptor | High | Yes |
| Farnesol | Michael Acceptor | High | Yes |
| 1,4-Hydrochinone/Hydroquinone | Michael Acceptor | High | Yes |
| Abietic acid/colophony | Not know | High | Yes |
| Citral/3,7-Dimethyl-2,6-octadienal | Schiff base reagent | High | Yes |
| Eugenol/2-Methoxy-4-(2-propenyl)phenol | Michael Acceptor | High | Yes |
| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| Hprt-1 | 5′ GTTGAAGATATAATTGACACTG 3′ | 5′ GGCATATCCAACAACAAAC 3′ |
| Hmox1 | 5′ CCAGTTCTACCAGAGTAA 3′ | 5′ ACAGAAGTTAGAGACCAA 3′ |
| iNos | 5′ GCTGTTAGAGACACTTCTGAG 3′ | 5′ CACTTTGGTAGGATTTGACTTTG 3′ |
| Il-1β | 5′ TCTATACCTGTCCTGTGTAATG 3′ | 5′ GCTTGTGCTTGTG 3′ |
| Tnf-α | 5′ CAAGGGACTAGCCAGGAG 3′ | 5′ TGCCTCTTCTGCCAGTTC 3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Silva, A.; Pereira, M.; Carrascal, M.A.; Brites, G.; Neves, B.; Moreira, P.; Resende, R.; Silva, M.M.; Santos, A.E.; Pereira, C.; et al. Calcium Modulation, Anti-Oxidant and Anti-Inflammatory Effect of Skin Allergens Targeting the Nrf2 Signaling Pathway in Alzheimer’s Disease Cellular Models. Int. J. Mol. Sci. 2020, 21, 7791. https://doi.org/10.3390/ijms21207791
Silva A, Pereira M, Carrascal MA, Brites G, Neves B, Moreira P, Resende R, Silva MM, Santos AE, Pereira C, et al. Calcium Modulation, Anti-Oxidant and Anti-Inflammatory Effect of Skin Allergens Targeting the Nrf2 Signaling Pathway in Alzheimer’s Disease Cellular Models. International Journal of Molecular Sciences. 2020; 21(20):7791. https://doi.org/10.3390/ijms21207791
Chicago/Turabian StyleSilva, Ana, Marta Pereira, Mylène A. Carrascal, Gonçalo Brites, Bruno Neves, Patrícia Moreira, Rosa Resende, Maria Manuel Silva, Armanda E. Santos, Cláudia Pereira, and et al. 2020. "Calcium Modulation, Anti-Oxidant and Anti-Inflammatory Effect of Skin Allergens Targeting the Nrf2 Signaling Pathway in Alzheimer’s Disease Cellular Models" International Journal of Molecular Sciences 21, no. 20: 7791. https://doi.org/10.3390/ijms21207791
APA StyleSilva, A., Pereira, M., Carrascal, M. A., Brites, G., Neves, B., Moreira, P., Resende, R., Silva, M. M., Santos, A. E., Pereira, C., & Cruz, M. T. (2020). Calcium Modulation, Anti-Oxidant and Anti-Inflammatory Effect of Skin Allergens Targeting the Nrf2 Signaling Pathway in Alzheimer’s Disease Cellular Models. International Journal of Molecular Sciences, 21(20), 7791. https://doi.org/10.3390/ijms21207791

