Protective Effects and Mechanisms of Procyanidins on Parkinson’s Disease In Vivo and In Vitro
Abstract
:1. Introduction
2. Results
2.1. Effects of PCs on MPP+-Induced Cytotoxicity of PC12 Cells
2.2. PCs Reduced MPP+-Induced Oxidative Stress and Increased Antioxidant Enzyme Activity
2.3. Effects of PCs on Nrf2/ARE Pathway in MPP+-Induced PC12 Cells
2.4. Nrf2/ARE Signaling Is Related to the Neuroprotective and Antioxidant Effects Mediated by PCs
2.5. Effects of PCs on Zebrafish Larvae Motility upon MPTP Treatment
2.6. Effects of PCs on MPTP-Induced Dopaminergic Neuron Injury in Zebrafish
2.7. Effects of PCs on Oxidative Stress of Zebrafish Larvae Treated with MPTP
2.8. Effects of PCs on Nrf2/ARE Pathway in MPTP-Induced Zebrafish Larvae
3. Discussion
4. Materials and Methods
4.1. Chemical Compounds and Reagents
4.2. Cell Culture
4.3. Cell Viability Assay
4.4. Fish Maintenance
4.5. ROS Measurement
4.6. Assessment of MDA, GSH-Px, SOD, and CAT
4.7. Preparation of Whole Cell, Cytoplasmic, and Nuclear Protein
4.8. Nrf2 siRNA Transfection
4.9. Western Blotting
4.10. Locomotor Behavioral Test
4.11. Total RNA Extraction, Reverse Transcription, and Quantitative Real-Time Polymerase Chain Reaction
4.12. Zebrafish Antityrosine Hydroxylase (TH) Whole-Mount Immunostaining
4.13. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
Abbreviations
References
- Connolly, B.S.; Lang, A.E. Pharmacological treatment of Parkinson disease: A review. JAMA 2014, 311, 1670–1683. [Google Scholar] [CrossRef] [PubMed]
- Fearnley, J.M.; Lees, A.J. Aging and Parkinsons disease: Substantia nigra regional selectivity. Brain 1991, 114, 2283–2301. [Google Scholar] [CrossRef] [PubMed]
- de Lau, L.M.L.; Giesbergen, P.C.L.M.; de Rijk, M.C.; Hofman, A.; Koudstaal, P.J.; Breteler, M.M.B. Incidence of parkinsonism and Parkinson disease in a general population: The Rotterdam Study. Neurology 2004, 63, 1240–1244. [Google Scholar] [CrossRef]
- Dorsey, E.R.; Constantinescu, R.; Thompson, J.P.; Biglan, K.M.; Holloway, R.G.; Kieburtz, K.; Marshall, F.J.; Ravina, B.M.; Schifitto, G.; Siderowf, A.; et al. Projected number of people with Parkinson disease in the most populous nations, 2005 through 2030. Neurology 2007, 68, 384–386. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Xu, H.; Jiang, H.; Du, X.; Sun, P.; Xie, J. Neurorescue effect of rosmarinic acid on 6-hydroxydopamine-lesioned nigral dopamine neurons in rat model of Parkinson’s disease. J. Mol. Neurosci. 2012, 47, 113–119. [Google Scholar] [CrossRef] [PubMed]
- Armstrong, M.J.; Okun, M.S. Diagnosis and treatment of Parkinson disease: A review. JAMA 2020, 323, 548–560. [Google Scholar] [CrossRef]
- Solayman, M.; Islam, M.A.; Alam, F.; Khalil, M.I.; Kamal, M.A.; Gan, S.H. Natural products combating neurodegeneration: Parkinson’s disease. Curr. Drug Metab. 2017, 18, 50–61. [Google Scholar] [CrossRef] [PubMed]
- Cenini, G.; Lloret, A.; Cascella, R. Oxidative stress in neurodegenerative diseases: From a mitochondrial point of view. Oxid. Med. Cell. Longev. 2019, 2019, 2105607. [Google Scholar] [CrossRef] [Green Version]
- Spina, M.B.; Cohen, G. Dopamine turnover and glutathione oxidation: Implications for Parkinson disease. Proc. Natl. Acad. Sci. USA 1989, 86, 1398–1400. [Google Scholar] [CrossRef] [Green Version]
- Choi, H.J.; Kim, S.W.; Lee, S.Y.; Hwang, O. Dopamine-dependent cytotoxicity of tetrahydrobiopterin: A possible mechanism for selective neurodegeneration in Parkinson’s disease. J. Neurochem. 2003, 86, 143–152. [Google Scholar] [CrossRef]
- Imaizumi, Y.; Okada, Y.; Akamatsu, W.; Koike, M.; Kuzumaki, N.; Hayakawa, H.; Nihira, T.; Kobayashi, T.; Ohyama, M.; Sato, S.; et al. Mitochondrial dysfunction associated with increased oxidative stress and alpha-synuclein accumulation in PARK2 iPSC-derived neurons and postmortem brain tissue. Mol. Brain. 2012, 5, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Kruk, J.; Aboul-Enein, H.Y.; Kladna, A.; Bowser, J.E. Oxidative stress in biological systems and its relation with pathophysiological functions: The effect of physical activity on cellular redox homeostasis. Free Radic. Res. 2019, 53, 497–521. [Google Scholar] [CrossRef] [PubMed]
- Maleki, S.J.; Crespo, J.F.; Cabanillas, B. Anti-inflammatory effects of flavonoids. Food Chem. 2019, 299, 125124. [Google Scholar] [CrossRef]
- Terra, X.; Fernández-Larrea, J.; Pujadas, G.; Ardèvol, A.; Bladé, C.; Salvadó, J.; Arola, L.; Blay, M. Inhibitory effects of grape seed procyanidins on foam cell formation in vitro. J. Agric. Food Chem. 2009, 57, 2588–2594. [Google Scholar] [CrossRef]
- Bagchi, D.; Garg, A.; Krohn, R.L.; Bagchi, M.; Tran, M.X.; Stohs, S.J. Oxygen free radical scavenging abilities of vitamins C and E, and a grape seed proanthocyanidin extract in vitro. Res. Commun. Mol. Pathol. Pharmacol. 1997, 95, 179–189. [Google Scholar] [PubMed]
- Jiang, Y.R.; Mao, S.Q.; Huang, W.S.; Lu, B.Y.; Cai, Z.X.; Zhou, F.; Li, M.Q.; Lou, T.T.; Zhao, Y.J. Phenylethanoid glycoside profiles and antioxidant activities of osmanthus fragrans lour. flowers by UPLC/PDA/MS and simulated digestion model. J Agr Food Chem. 2016, 64, 2459–2466. [Google Scholar] [CrossRef]
- Guo, S.; Wilson, S.W.; Cooke, S.; Chitnis, A.B.; Driever, W.; Rosenthal, A. Mutations in the zebrafish unmask shared regulatory pathways controlling the development of catecholaminergic neurons. Dev. Biol. 1999, 208, 473–487. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Holzschuh, J.; Ryu, S.; Aberger, F.; Driever, W. Dopamine transporter expression distinguishes dopaminergic neurons from other catecholaminergic neurons in the developing zebrafish embryo. Mech. Develop. 2001, 101, 237–243. [Google Scholar] [CrossRef]
- McLean, D.L.; Fetcho, J.R. Ontogeny and innervation patterns of dopaminergic, noradrenergic, and serotonergic neurons in larval zebrafish. J. Comp. Neurol. 2004, 480, 38–56. [Google Scholar] [CrossRef]
- Rink, E.; Wullimann, M.F. Development of the catecholaminergic system in the early zebrafish brain: An immunohistochemical study. Dev. Brain Res. 2002, 137, 89–100. [Google Scholar] [CrossRef]
- Kalueff, A.V.; Stewart, A.M.; Gerlai, R. Zebrafish as an emerging model for studying complex brain disorders. Trends Pharmacol. Sci. 2014, 35, 63–75. [Google Scholar] [CrossRef] [Green Version]
- Santos, S.D.; Verveer, P.J.; Bastiaens, P.I. Growth factor-induced MAPK network topology shapes Erk response determining PC-12 cell fate. Nat. Cell Biol. 2007, 9, 324–330. [Google Scholar] [CrossRef]
- Greenberg, D.A.; Jin, K. From angiogenesis to neuropathology. Nature 2005, 438, 954–959. [Google Scholar] [CrossRef] [PubMed]
- Shui, G.; Bao, Y.M.; Bo, J.; An, L.J. Protective effect of protocatechuic acid from Alpinia oxyphylla on hydrogen peroxide-induced oxidative PC12 cell death. Eur. J. Pharmacol. 2006, 538, 73–79. [Google Scholar] [CrossRef]
- Cheng, X.R.; Zhang, L.; Hu, J.J.; Sun, L.; Du, G.H. Neuroprotective effects of tetramethylpyrazine on hydrogen peroxide-induced apoptosis in PC12 cells. Cell Biol. Int. 2007, 31, 438–443. [Google Scholar] [CrossRef] [PubMed]
- Jiang, B.; Liu, J.H.; Bao, Y.M.; An, L.J. Hydrogen peroxide-induced apoptosis in pc12 cells and the protective effect of puerarin. Cell Biol. Int. 2003, 27, 1025–1031. [Google Scholar] [CrossRef]
- Langston, J.W.; Ballard, P.; Tetrud, J.W.; Irwin, I. Chronic parkinsonism in humans due to a product of meperidine-analog synthesis. Science 1983, 219, 979–980. [Google Scholar] [CrossRef] [Green Version]
- Miller, G.W.; Gainetdinov, R.R.; Levey, A.I.; Caron, M.G. Dopamine transporters and neuronal injury. Trends Pharmacol. Sci. 1999, 20, 424–429. [Google Scholar] [CrossRef]
- Blum, D.; Torch, S.; Lambeng, N.; Nissou, M.F.; Benabid, A.L.; Sadoul, R.; Verna, J.M. Molecular pathways involved in the neurotoxicity of 6-OHDA, dopamine and MPTP: Contribution to the apoptotic theory in Parkinson’s disease. Prog. Neurobiol. 2001, 65, 135–172. [Google Scholar] [CrossRef]
- Nicotra, A.; Parvez, S.H. Cell death induced by MPTP, a substrate for monoamine oxidase B. Toxicology 2000, 153, 157–166. [Google Scholar] [CrossRef]
- Grau-Bove, C.; Sierra-Cruz, M.; Miguens-Gomez, A.; Rodriguez-Gallego, E.; Beltran-Debon, R.; Blay, M.; Terra, X.; Pinent, M.; Ardevol, A. A ten-day grape seed procyanidin treatment prevents certain ageing processes in female rats over the long term. Nutrients 2020, 12, 3467. [Google Scholar] [CrossRef] [PubMed]
- Xu, Q.; Chen, Z.Y.; Zhu, B.R.; Wang, G.R.; Jia, Q.; Li, Y.M.; Wu, X.J. A-type cinnamon procyanidin oligomers protect against 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced neurotoxicity in mice through inhibiting the p38 mitogen-activated protein kinase/P53/BCL-2 associated X protein signaling pathway. J. Nutr. 2020, 150, 1731–1737. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Huang, N.Q.; Chen, M.J.; Jin, H.; Nie, J.; Shi, J.S.; Ji, F. Procyanidin protects against 6-hydroxydopamine-induced dopaminergic neuron damage via the regulation of the PI3K/Akt signalling pathway. Biomed. Pharmacother. 2019, 114, 108789. [Google Scholar] [CrossRef] [PubMed]
- Kook, Y.H.; Ka, M.; Um, M. Neuroprotective cytokines repress PUMA induction in the 1-methyl-4-phenylpyridinium (MPP+) model of Parkinson’s disease. Biochem. Bioph. Res. Commun. 2011, 411, 370–374. [Google Scholar] [CrossRef] [PubMed]
- Tang, X.Q.; Fang, H.R.; Li, Y.J.; Zhou, C.F.; Ren, Y.K.; Chen, R.Q.; Wang, C.-Y.; Hu, B. Endogenous hydrogen sulfide is involved in asymmetric dimethylarginine-induced protection against neurotoxicity of 1-methyl-4-phenyl-pyridinium ion. Neurochem. Res. 2011, 36, 2176–2185. [Google Scholar] [CrossRef]
- Chong, C.M.; Ma, D.; Zhao, C.; Franklin, R.J.M.; Zhou, Z.Y.; Ai, N.; Li, C.; Yu, H.; Hou, T.; Sa, F.; et al. Discovery of a novel neuroprotectant, BHDPC, that protects against MPP+/MPTP-induced neuronal death in multiple experimental models. Free Radical. Biol. Med. 2015, 89, 1057–1066. [Google Scholar] [CrossRef]
- Kondo, K.; Klco, J.; Nakamura, E.; Lechpammer, M.; Kaelin, W.G., Jr. Inhibition of HIF is necessary for tumor suppression by the von Hippel-Lindau protein. Cancer Cell. 2002, 1, 237–246. [Google Scholar] [CrossRef] [Green Version]
- Razavi, S.M.; Gholamin, S.; Eskandari, A.; Mohsenian, N.; Ghorbanihaghjo, A.; Delazar, A.; Rashtchizadeh, N.; Keshtkar-Jahromi, M.; Argani, H. Red grape seed extract improves lipid profiles and decreases oxidized low-density lipoprotein in patients with mild hyperlipidemia. J. Med. Food. 2013, 16, 255–258. [Google Scholar] [CrossRef]
- Kong, X.; Guan, J.; Gong, S.; Wang, R. Neuroprotective effects of grape seed procyanidin extract on Ischemia-reperfusion brain injury. Chin. Med. Sci. J. 2017, 32, 92–99. [Google Scholar] [CrossRef] [Green Version]
- Fang, L.; Li, M.; Zhao, L.; Han, S.; Li, Y.; Xiong, B.; Jiang, L. Dietary grape seed procyanidins suppressed weaning stress by improving antioxidant enzyme activity and mRNA expression in weanling piglets. J. Anim. Physiol. Anim. Nutr. 2020, 104, 1178–1185. [Google Scholar] [CrossRef]
- Wen, F.; Li, Y.; Feng, T.; Du, Y.; Ren, F.; Zhang, L.; Han, N.; Ma, S.; Li, F.; Wang, P.; et al. Grape seed procyanidin extract (GSPE) improves goat sperm quality when preserved at 4 °C. Animals (Basel) 2019, 9, 810. [Google Scholar] [CrossRef] [Green Version]
- Tang, S.; Tang, Q.; Jin, J.; Zheng, G.; Xu, J.; Huang, W.; Li, X.; Shang, P.; Liu, H. Polydatin inhibits the IL-1β-induced inflammatory response in human osteoarthritic chondrocytes by activating the Nrf2 signaling pathway and ameliorates murine osteoarthritis. Food Funct. 2018, 9, 1701–1712. [Google Scholar] [CrossRef]
- Li, C.; Tang, B.; Feng, Y.; Tang, F.; Pui-Man Hoi, M.; Su, Z.; Ming-Yuen Lee, S. Pinostrobin exerts neuroprotective actions in neurotoxin-induced Parkinson’s disease models through Nrf2 induction. J. Agric. Food Chem. 2018, 66, 8307–8318. [Google Scholar] [CrossRef] [PubMed]
- McMahon, M.; Thomas, N.; Itoh, K.; Yamamoto, M.; Hayes, J.D. Redox-regulated turnover of Nrf2 is determined by at least two separate protein domains, the redox-sensitive Neh2 degron and the redox-insensitive Neh6 degron. J. Biol. Chem. 2004, 279, 31556–31567. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, M.; Li, H.; Liu, Q.; Liu, F.; Tang, L.; Li, C.; Yuan, Y.; Zhan, Y.; Xu, W.; Li, W.; et al. Nuclear factor p65 interacts with Keap1 to repress the Nrf2-ARE pathway. Cell. Signal. 2011, 23, 883–892. [Google Scholar] [CrossRef] [PubMed]
- Itoh, K.; Igarashi, K.; Hayashi, N.; Nishizawa, M.; Yamamoto, M. Cloning and characterization of a novel erythroid cell-derived CNC family transcription factor heterodimerizing with the small Maf family proteins. Mol. Cell. Biol. 1995, 15, 4184–4193. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hybertson, B.M.; Gao, B.; Bose, S.K.; McCord, J.M. Oxidative stress in health and disease: The therapeutic potential of Nrf2 activation. Mol. Aspects Med. 2011, 32, 234–246. [Google Scholar] [CrossRef] [PubMed]
- Itoh, K.; Wakabayashi, N.; Katoh, Y.; Ishii, T.; Igarashi, K.; Engel, J.D.; Yamamoto, M. Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev. 1999, 13, 76–86. [Google Scholar] [CrossRef] [Green Version]
- Kobayashi, A.; Kang, M.-I.; Okawa, H.; Ohtsuji, M.; Zenke, Y.; Chiba, T.; Igarashi, K.; Yamamoto, M. Oxidative stress sensor Keap1 functions as an adaptor for Cul3-based E3 ligase to regulate proteasomal degradation of Nrf2. Mol. Cell. Biol. 2004, 24, 7130–7139. [Google Scholar] [CrossRef] [Green Version]
- Lu, M.-C.; Ji, J.-A.; Jiang, Z.-Y.; You, Q.-D. The Keap1-Nrf2-ARE pathway as a potential preventive and therapeutic target: An update. Med. Res. Rev. 2016, 36, 924–963. [Google Scholar] [CrossRef]
- Ungvari, Z.; Bagi, Z.; Feher, A.; Recchia, F.A.; Sonntag, W.E.; Pearson, K.; de Cabo, R.; Csiszar, A. Resveratrol confers endothelial protection via activation of the antioxidant transcription factor Nrf2. Am. J. Physiol. Heart Circ. Physiol. 2010, 299, H18–H24. [Google Scholar] [CrossRef] [Green Version]
- Schmidlin, C.J.; Dodson, M.B.; Madhavan, L.; Zhang, D.D. Redox regulation by NRF2 in aging and disease. Free Radic. Biol. Med. 2019, 134, 702–707. [Google Scholar] [CrossRef] [PubMed]
- Slocum, S.L.; Kensler, T.W. Nrf2: Control of sensitivity to carcinogens. Arch. Toxicol. 2011, 85, 273–284. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, T.; Motohashi, H.; Yamamoto, M. Toward clinical application of the Keap1-Nrf2 pathway. Trends Pharmacol. Sci. 2013, 34, 340–346. [Google Scholar] [CrossRef]
- Peng, S.; Hou, Y.; Yao, J.; Fang, J. Activation of Nrf2-driven antioxidant enzymes by cardamonin confers neuroprotection of PC12 cells against oxidative damage. Food Funct. 2017, 8, 997–1007. [Google Scholar] [CrossRef] [PubMed]
- Mi, Y.; Zhang, W.; Tian, H.; Li, R.; Huang, S.; Li, X.; Qi, G.; Liu, X. EGCG evokes Nrf2 nuclear translocation and dampens PTP1B expression to ameliorate metabolic misalignment under insulin resistance condition. Food Funct. 2018, 9, 1510–1523. [Google Scholar] [CrossRef]
- Nagle, A.A.; Reddy, S.A.; Bertrand, H.; Tajima, H.; Dang, T.M.; Wong, S.C.; Hayes, J.D.; Wells, G.; Chew, E.H. 3-(2-oxoethylidene)indolin-2-one derivatives activate Nrf2 and inhibit NF-κB: Potential candidates for chemoprevention. ChemMedChem 2014, 9, 1763–1774. [Google Scholar] [CrossRef]
- Cullinan, S.B.; Gordan, J.D.; Jin, J.; Harper, J.W.; Diehl, J.A. The Keap1-BTB protein is an adaptor that bridges Nrf2 to a Cul3-based E3 ligase: Oxidative stress sensing by a Cul3-Keap1 ligase. Mol. Cell. Biol. 2004, 24, 8477–8486. [Google Scholar] [CrossRef] [Green Version]
- Cheng, B.H.; Guo, Y.L.; Li, C.G.; Ji, B.Y.; Pan, Y.Y.; Chen, J.; Bai, B. Edaravone protected PC12 cells against MPP(+)-cytoxicity via inhibiting oxidative stress and up-regulating heme oxygenase-1 expression. J Neurol Sci 2014, 343, 115–119. [Google Scholar] [CrossRef]
- Gu, J.; Wang, H.Y.; Zhou, L.J.; Fan, D.L.; Shi, L.L.; Ji, G.X.; Gu, A. Oxidative stress in bisphenol AF-induced cardiotoxicity in zebra fish and the protective role of N-acetyl N-cysteine. Sci. Total. Environ. 2020, 731, 139190. [Google Scholar] [CrossRef]
- Li, M.Q.; Zhou, F.; Xu, T.; Song, H.X.; Lu, B.Y. Acteoside protects against 6-OHDA-induced dopaminergic neuron damage via Nrf2-ARE signaling pathway. Food and Chem. Toxicol. 2018, 119, 6–13. [Google Scholar] [CrossRef]
- Chen, Y.; Li, G.; Law, H.C.H.; Chen, H.; Lee, S.M. Determination of oxyphylla a enantiomers in the fruits of alpinia oxyphylla by a chiral high-performance liquid chromatography-multiple reaction monitoring-mass spectrometry method and comparison of their in vivo biological activities. J. Agric. Food Chem. 2020, 68, 11170–11181. [Google Scholar] [CrossRef] [PubMed]
- Kimmel, C.B.; Ballard, W.W.; Kimmel, S.R.; Ullmann, B.; Schilling, T.F. Stages of embryonic-development of the zebrafish. Dev. Dyn. 1995, 203, 253–310. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Chen, Y.X.; Zheng, Y.F.; Zhao, J.W.; Yu, H.L.; Zhu, J.J.; Li, D. Neuroprotective effects and mechanisms of procyanidins in vitro and in vivo. Molecules 2021, 26, 2963. [Google Scholar] [CrossRef] [PubMed]
- Jin, M.; He, Q.; Zhang, S.; Cui, Y.; Han, L.; Liu, K. Gastrodin suppresses pentylenetetrazole-induced seizures progression by modulating oxidative stress in zebrafish. Neurochem. Res. 2018, 43, 904–917. [Google Scholar] [CrossRef]
- Zhao, B.; Ren, B.; Guo, R.; Zhang, W.; Ma, S.; Yao, Y.; Yuan, T.; Liu, Z.; Liu, X. Supplementation of lycopene attenuates oxidative stress induced neuroinflammation and cognitive impairment via Nrf2/NF-κB transcriptional pathway. Food Chem. Toxicol. 2017, 109, 505–516. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.J.; Cheang, L.C.V.; Wang, M.W.; Li, G.H.; Chu, I.K.; Lin, Z.X.; Lee, S.M.Y. Ethanolic extract of fructus Alpinia oxyphylla protects against 6-hydroxydopamine-induced damage of PC12 cells in vitro and dopaminergic neurons in zebrafish. Cell. Mol. Neurobiol. 2012, 32, 27–40. [Google Scholar] [CrossRef]
Genes | Forward Primer | Reverse Primer |
---|---|---|
β-Actin | CACTGAGGCTCCCCTGAATC | GGGTCACACCATCACCAGAG |
Nrf2 | CTGCTGTCACTCCCAGAGTT | GCCGTAGTTTTGGGTTGGTG |
HO-1 | AAGAGCTGGACAGAAACGCA | AGAAGTGCTCCAAGTCCTGC |
GCLC | CTCCTCACAGTCACGGCATT | TGAATGGAGACGGGGTGTTG |
GCLM | AAGCCAGACACTGACACACC | ATCTGGAGGCATCACACAGC |
NQO1 | AAGCCTCTGTCCTTTGCTCC | TGCTGTGGTAATGCCGTAGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, J.; Chen, Y.; Zheng, Y.; Zhao, J.; Yu, H.; Zhu, J.; Li, D. Protective Effects and Mechanisms of Procyanidins on Parkinson’s Disease In Vivo and In Vitro. Molecules 2021, 26, 5558. https://doi.org/10.3390/molecules26185558
Chen J, Chen Y, Zheng Y, Zhao J, Yu H, Zhu J, Li D. Protective Effects and Mechanisms of Procyanidins on Parkinson’s Disease In Vivo and In Vitro. Molecules. 2021; 26(18):5558. https://doi.org/10.3390/molecules26185558
Chicago/Turabian StyleChen, Juan, Yixuan Chen, Yangfan Zheng, Jiawen Zhao, Huilin Yu, Jiajin Zhu, and Duo Li. 2021. "Protective Effects and Mechanisms of Procyanidins on Parkinson’s Disease In Vivo and In Vitro" Molecules 26, no. 18: 5558. https://doi.org/10.3390/molecules26185558
APA StyleChen, J., Chen, Y., Zheng, Y., Zhao, J., Yu, H., Zhu, J., & Li, D. (2021). Protective Effects and Mechanisms of Procyanidins on Parkinson’s Disease In Vivo and In Vitro. Molecules, 26(18), 5558. https://doi.org/10.3390/molecules26185558