A Novel Plate Compartment–Confrontation Method Discovered That Volatile Organic Compounds Produced by Saccharomyces cerevisiae Inhibit Botrytis cinerea and Fusarium graminearum
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains and Reagents
2.2. Yeast and Pathogenic Fungi Growth and Confrontation
2.3. Microscopy Observation and Digital Camera Photographing
2.4. Examination and Identification for VOC Composition
3. Results
3.1. Volatile Organic Compounds (VOCs) of Yeast Confront the Growth and Development of Botrytis cinerae

3.2. Volatile Organic Compounds (VOCs) of Yeast Confront the Growth and Development of Fusarium graminearum
3.3. Inhibition of Growth and Development of B. cinerea and F. graminearum by One of the Yeast VOCs Ethyl Acetate
3.4. Altering the Genes Regulating Ethyl Acetate Syntheis Did Not Significantly Change the Inhibitory Effect of Yeast VOCs on Pathogenic Fungi
3.5. The New Yeast VOC Phenylethyl Acetate from Overexpression of ATF1 Inhibited Growth and Development of F. graminearum Stronger than Ethyl Acetate
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhang, Q.Q.; Men, X.Y.; Hui, C.; Ge, F.; Ouyang, F. Wheat yield losses from pests and pathogens in China. Agric. Ecosyst. Environ. 2022, 326, 107821. [Google Scholar] [CrossRef] [Scilit]
- Stukenbrock, E.; Gurr, S. Address the growing urgency of fungal disease in crops. Nature 2023, 617, 31–34. [Google Scholar] [CrossRef] [Scilit]
- Fones, H.N.; Bebber, D.P.; Chaloner, T.M.; Kay, W.T.; Steinberg, G.; Gurr, S.J. Threats to global food security from emerging fungal and oomycete crop pathogens. Nat. Food 2020, 1, 332–342. [Google Scholar] [CrossRef] [Scilit]
- Steinberg, G.; Gurr, S.J. Fungi, fungicide discovery and global food security. Fungal Genet. Biol. 2020, 144, 103476. [Google Scholar] [CrossRef] [Scilit]
- Rosslenbroich, H.-J.; Stuebler, D. Botrytis cinerea—History of chemical control and novel fungicides for its management. Crop Prot. 2000, 19, 557–561. [Google Scholar] [CrossRef] [Scilit]
- Williamson, B.; Tudzynski, B.; Tudzynski, P.; van Kan, J.A. Botrytis cinerea: The cause of grey mould disease. Mol. Plant Pathol. 2007, 8, 561–580. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sarrocco, S.; Esteban, P.; Vicente, I.; Bernardi, R.; Plainchamp, T.; Domenichini, S.; Puntoni, G.; Baroncelli, R.; Vannacci, G.; Dufresne, M. Straw competition and wheat root endophytism of Trichoderma gamsii T6085 as useful traits in the biological control of Fusarium Head Blight. Phytopathology 2021, 111, 1129–1136. [Google Scholar] [CrossRef] [Scilit]
- Hamrouni, R.; Regus, F.; Farnet Da Silva, A.M.; Orsiere, T.; Boudenne, J.L.; Laffont-Schwob, I.; Christen, P.; Dupuy, N. Current status and future trends of microbial and nematode-based biopesticides for biocontrol of crop pathogens. Crit. Rev. Biotechnol. 2025, 45, 333–352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sellamuthu, G.; Chakraborty, A.; Vetukuri, R.R.; Sarath, S.; Roy, A. RNAi-biofungicides: A quantum leap for tree fungal pathogen management. Crit. Rev. Biotechnol. 2024. [Google Scholar] [CrossRef] [Scilit]
- Wytinck, N.; Manchur, C.L.; Li, V.H.; Whyard, S.; Belmonte, M.F. dsRNA Uptake in Plant Pests and Pathogens: Insights into RNAi-Based Insect and Fungal Control Technology. Plants 2020, 9, 1780. [Google Scholar] [CrossRef] [Scilit]
- Septiani, P.; Pramesti, Y.; Ghildan, M.; Aprilia, K.Z.; Awaludin, R.; Medina, S.; Subandiyah, S.; Meitha, K. RNAi-based biocontrol for crops: A revised expectation for a non-recent technology. Planta 2025, 261, 44. [Google Scholar] [CrossRef] [Scilit]
- Bencheqroun, S.K.; Bajji, M.; Massart, S.; Bentata, F.; Labhilili, M.; Achbani, H.; El Jaafari, S.; Jijakli, M.H. Biocontrol of blue mold on apple fruits by Aureobasidium pullulans (strain Ach 1-1): In vitro and in situ evidence for the possible involvement of competition for nutrients. Commun. Agric. Appl. Biol. Sci. 2006, 71, 1151–1157. [Google Scholar] [PubMed]
- Wang, X.X.; Chi, Z.; Peng, Y.; Wang, X.H.; Ru, S.G.; Chi, Z.M. Purification, characterization and gene cloning of the killer toxin produced by the marine-derived yeast Williopsis saturnus WC91-2. Microbiol. Res. 2012, 167, 558–563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, B.; Zhang, H.; Chen, K.; Xu, Q.; Yao, Y.; Gao, H. Biocontrol of postharvest Rhizopus decay of peaches with Pichia caribbica. Curr. Microbiol. 2013, 67, 255–261. [Google Scholar] [CrossRef] [Scilit]
- Castoria, R.; Caputo, L.; De Curtis, F.; De Cicco, V. Resistance of postharvest biocontrol yeasts to oxidative stress: A possible new mechanism of action. Phytopathology 2003, 93, 564–572. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lutz, M.C.; Lopes, C.A.; Rodriguez, M.E.; Sosa, M.C.; Sangorrin, M.P. Efficacy and putative mode of action of native and commercial antagonistic yeasts against postharvest pathogens of pear. Int. J. Food Microbiol. 2013, 164, 166–172. [Google Scholar] [CrossRef] [Scilit]
- Haissam, J.M. Pichia anomala in biocontrol for apples: 20 years of fundamental research and practical applications. Antonie Leeuwenhoek 2011, 99, 93–105. [Google Scholar] [CrossRef] [Scilit]
- Sui, Y.; Liu, J.; Wisniewski, M.; Droby, S.; Norelli, J.; Hershkovitz, V. Pretreatment of the yeast antagonist, Candida oleophila, with glycine betaine increases oxidative stress tolerance in the microenvironment of apple wounds. Int. J. Food Microbiol. 2012, 157, 45–51. [Google Scholar] [CrossRef] [Scilit]
- Huang, R.; Li, G.Q.; Zhang, J.; Yang, L.; Che, H.J.; Jiang, D.H.; Huang, H.C. Control of postharvest Botrytis fruit rot of strawberry by volatile organic compounds of Candida intermedia. Phytopathology 2011, 101, 859–869. [Google Scholar] [CrossRef] [Scilit]
- Oro, L.; Feliziani, E.; Ciani, M.; Romanazzi, G.; Comitini, F. Volatile organic compounds from Wickerhamomyces anomalus, Metschnikowia pulcherrima and Saccharomyces cerevisiae inhibit growth of decay causing fungi and control postharvest diseases of strawberries. Int. J. Food Microbiol. 2018, 265, 18–22. [Google Scholar] [CrossRef] [Scilit]
- Cavalcanti, V.P.; Araújo, N.A.F.; Machado, N.B.; Costa, P.S.P.; Pasqual, M.; Alves, E.; Schwan-Estrada, K.R.F.; Dória, J. Yeasts and Bacillus spp. as potential biocontrol agents of Sclerotinia sclerotiorum in garlic. Sci. Hortic. 2020, 261, 108931. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Wisniewski, M.; Droby, S.; Vero, S.; Tian, S.; Hershkovitz, V. Glycine betaine improves oxidative stress tolerance and biocontrol efficacy of the antagonistic yeast Cystofilobasidium infirmominiatum. Int. J. Food Microbiol. 2011, 146, 76–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Medina-Córdova, N.; López-Aguilar, R.; Ascencio, F.; Castellanos, T.; Campa-Córdova, A.I.; Angulo, C. Biocontrol activity of the marine yeast Debaryomyces hansenii against phytopathogenic fungi and its ability to inhibit mycotoxins production in maize grain (Zea mays L.). Biol. Control 2016, 97, 70–79. [Google Scholar] [CrossRef] [Scilit]
- Hua, S.S.; Beck, J.J.; Sarreal, S.B.; Gee, W. The major volatile compound 2-phenylethanol from the biocontrol yeast, Pichia anomala, inhibits growth and expression of aflatoxin biosynthetic genes of Aspergillus flavus. Mycotoxin Res. 2014, 30, 71–78. [Google Scholar] [CrossRef] [Scilit]
- Ando, H.; Hatanaka, K.; Ohata, I.; Yamashita-Kitaguchi, Y.; Kurata, A.; Kishimoto, N. Antifungal activities of volatile substances generated by yeast isolated from Iranian commercial cheese. Food Control 2012, 26, 472–478. [Google Scholar] [CrossRef] [Scilit]
- Nally, M.C.; Pesce, V.M.; Maturano, Y.P.; Assaf, L.A.R.; Toro, M.E.; de Figueroa, L.I.C.; Vazquez, F. Antifungal modes of action of and other biocontrol yeasts against fungi isolated from sour and grey rots. Int. J. Food Microbiol. 2015, 204, 91–100. [Google Scholar] [CrossRef] [Scilit]
- Liang, Y.; Morozova, N.; Tokarev, A.A.; Mulholland, J.W.; Segev, N. The role of Trs65 in the Ypt/Rab guanine nucleotide exchange factor function of the TRAPP II complex. Mol. Biol. Cell 2007, 18, 2533–2541. [Google Scholar] [CrossRef] [Scilit]
- Brachmann, C.B.; Davies, A.; Cost, G.J.; Caputo, E.; Li, J.; Hieter, P.; Boeke, J.D. Designer deletion strains derived from Saccharomyces cerevisiae S288C: A useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 1998, 14, 115–132. [Google Scholar] [CrossRef] [Scilit]
- Ren, W.; Zhang, Z.; Shao, W.; Yang, Y.; Zhou, M.; Chen, C. The autophagy-related gene BcATG1 is involved in fungal development and pathogenesis in Botrytis cinerea. Mol. Plant Pathol. 2017, 18, 238–248. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Wu, L.; Mei, Y.; Zhao, Y.; Ma, Z.; Zhang, X.; Chen, Y. Host-induced gene silencing of multiple genes of Fusarium graminearum enhances resistance to Fusarium head blight in wheat. Plant Biotechnol. J. 2020, 18, 2373–2375. [Google Scholar] [CrossRef] [Scilit]
- Xie, Z.; Nair, U.; Klionsky, D.J. Atg8 controls phagophore expansion during autophagosome formation. Mol. Biol. Cell 2008, 19, 3290–3298. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, W.; Qian, M.C. Headspace solid phase microextraction and gas chromatography-olfactometry dilution analysis of young and aged Chinese “Yanghe Daqu” liquors. J. Agric. Food Chem. 2005, 53, 7931–7938. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dennis, C.; Webster, J. Antagonistic properties of species-groups of Trichoderma. Trans. Br. Mycol. Soc. 1971, 57, 25–39. [Google Scholar] [CrossRef] [Scilit]
- Alvarez-Garcia, S.; Mayo-Prieto, S.; Carro-Huerga, G.; Rodriguez-Gonzalez, A.; Gonzalez-Lopez, O.; Gutierrez, S.; Casquero, P.A. Volatile organic compound chamber: A novel technology for microbiological volatile interaction assays. J. Fungi 2021, 7, 248. [Google Scholar] [CrossRef] [Scilit]
- Lancioni, C.; Castells, C.; Candal, R.; Tascon, M. Headspace solid-phase microextraction: Fundamentals and recent advances. Adv. Sample Prep. 2022, 3, 100035. [Google Scholar] [CrossRef] [Scilit]
- Holt, S.; Trindade de Carvalho, B.; Foulquie-Moreno, M.R.; Thevelein, J.M. Polygenic Analysis in Absence of Major Effector ATF1 Unveils Novel Components in Yeast Flavor Ester Biosynthesis. mBio 2018, 9, e01279-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lilly, M.; Lambrechts, M.G.; Pretorius, I.S. Effect of increased yeast alcohol acetyltransferase activity on flavor profiles of wine and distillates. Appl. Environ. Microbiol. 2000, 66, 744–753. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Zhang, C.; Qi, Y.; Dai, L.; Ma, H.; Guo, X.; Xiao, D. Acetate ester production by Chinese yellow rice wine yeast overexpressing the alcohol acetyltransferase-encoding gene ATF2. Genet. Mol. Res. 2014, 13, 9735–9746. [Google Scholar] [CrossRef] [Scilit]
- Fujii, T.; Yoshimoto, H.; Tamai, Y. Acetate ester production by Saccharomyces cerevisiae lacking the ATF1 gene encoding the alcohol acetyltransferase. J. Ferment. Bioeng. 1996, 81, 538–542. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Wang, J.-H.; Zhang, C.-Y.; Ma, H.-X.; Xiao, D.-G. Regulation of Saccharomyces cerevisiae genetic engineering on the production of acetate esters and higher alcohols during Chinese Baijiu fermentation. J. Ind. Microbiol. Biotechnol. 2017, 44, 949–960. [Google Scholar] [CrossRef] [Scilit]
- Ma, J.; Lu, Q.; Yuan, Y.; Ge, H.; Li, K.; Zhao, W.; Gao, Y.; Niu, L.; Teng, M. Crystal structure of isoamyl acetate-hydrolyzing esterase from Saccharomyces cerevisiae reveals a novel active site architecture and the basis of substrate specificity. Proteins Struct. Funct. Bioinform. 2010, 79, 662–668. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fukuda, K.; Yamamoto, N.; Kiyokawa, Y.; Yanagiuchi, T.; Wakai, Y.; Kitamoto, K.; Inoue, Y.; Kimura, A. Balance of activities of alcohol acetyltransferase and esterase in Saccharomyces cerevisiae is important for production of isoamyl acetate. Appl. Environ. Microbiol. 1998, 64, 4076–4078. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Masoud, W.; Poll, L.; Jakobsen, M. Influence of volatile compounds produced by yeasts predominant during processing of Coffea arabica in East Africa on growth and ochratoxin A (OTA) production by Aspergillus ochraceus. Yeast 2005, 22, 1133–1142. [Google Scholar] [CrossRef] [Scilit]
- Bölker, M.; Basse, C.W.; Schirawski, J. Ustilago maydis secondary metabolism-from genomics to biochemistry. Fungal Genet. Biol. 2008, 45, S88–S93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Demain, A.L.; Fang, A. The natural functions of secondary metabolites. Adv. Biochem. Eng. Biotechnol. 2000, 69, 1–39. [Google Scholar] [CrossRef] [Scilit]
- Bruce, A.; Stewart, D.; Verrall, S.; Wheatley, R.E. Effect of volatiles from bacteria and yeast on the growth and pigmentation of sapstain fungi. Int. Biodeterior. Biodegrad. 2003, 51, 101–108. [Google Scholar] [CrossRef] [Scilit]






| Strain Number | Alias | Genotype | Source |
|---|---|---|---|
| YLY2323 | BY4741 | MAT a his3∆1 leu2∆0 met15∆0 ura3∆0 | [28] |
| YLY4049 | YLY2323 atf1∆::kanMX3 | This study | |
| YLY4050 | YLY2323 atf2∆::kanMX3 | This study | |
| YLY4053 | YLY2323 atf1∆::hphMX4 atf2∆::kanMX3 | This study | |
| YLY4055 | YLY2323 iah∆::kanMX3 | This study | |
| B05.10 | Botrytis cinerea | [29] | |
| PH-1 | Fusarium graminearum | [30] |
| Primer # | Primer Name | Sequence |
|---|---|---|
| YLO-2821 | ATF1+500 For | TGACACCCGGATAATTAAGAAGTGG |
| YLO-2822 | ATF1+500 Rev | GGGAGAAGTCCGAAAAATGCGTATC |
| YLO-877 | Ptef | ACCCATGGTTGTTTATGTTC |
| YLO-2403 | ATF1::Hyg For | ATCACAAATACCATCAATTTATCAGCTCTCATGAATGAAAGATCTGTTTAGC TTGCCTC |
| YLO-2404 | ATF1::Hyg Rev | GAATAATATCAGTCAAGCATCATGTGAGATCTAAGGGCCTGCTCGTTTTCGACACTGGG |
| YLO-2823 | ATF1::KanMX For | ATCACAAATACCATCAATTTATCAGCTCTCATGAATGAACCAAAACTAACCAGCTGAAGCTTCGTACGC |
| YLO-2824 | ATF1::KanMX Rev | GAATAATATCAGTCAAGCATCATGTGAGATCTAAGGGCCTTAGGCCACTAGT GGATCTG |
| YLO-2396 | ATF1 Diag For | GGGCGACAGTATTTCAAGAC |
| YLO-2825 | ATF2::KanMX For | CTTCAGCAATAAAAATTGTCCAGGTTAATTCCAAAACTAACCAGCTGAAGCTTCGTACGC |
| YLO-2826 | ATF2::KanMX Rev | TATACGAAGGCCCGCTACGGCAGTA TCGCATAGGCCACTAGTGGATCTG |
| YLO-2395 | ATF2 Diag For | CCGATGGGAGGTCCATCGGC |
| YLO-2827 | IAH1::KanMX For | TCTGTTCGTACGCTTAAACTGTGACCAAATCCAAAACTAACCAGCTGAAGCTTCGTACGC |
| YLO-2828 | IAH1::KanMX Rev | AGACAGAGTACGTACAAAGGATTA CTGCATTAGGCCACTAGTGGATCTG |
| YLO-2531 | IAH1 Diag up | TTTTTTCTGGGAGGACTGCAGAAGCT GAGA |
| YLO-2523 | F-SmaI-HIS3p | GTGAATTCGAGCTCGGTACCCGGGCCCGGGCTAGTACACTCTATATTTTT |
| YLO-2524 | R-SmaI-HIS3 | CCTGCAGGTCGACTCTAGAGGATCCCCGGGCTACATAAGAACA |
| YLO-2542 | F-PGK1p-XhoI-ATF1 | ACTTTTTACAACAAATATAAAACACTCGAGATGAATGAAATCGATGAGAA |
| YLO-2543 | R-PGK1t-XhoI-ATF1 | CTATCGATTTCAATTCAATTCAATCTCGAGCTAAGGGCCTAAAAGGAGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Meng, Y.; Wang, J.; Xu, H.; Yu, Y.; Liang, Y. A Novel Plate Compartment–Confrontation Method Discovered That Volatile Organic Compounds Produced by Saccharomyces cerevisiae Inhibit Botrytis cinerea and Fusarium graminearum. J. Fungi 2025, 11, 418. https://doi.org/10.3390/jof11060418
Meng Y, Wang J, Xu H, Yu Y, Liang Y. A Novel Plate Compartment–Confrontation Method Discovered That Volatile Organic Compounds Produced by Saccharomyces cerevisiae Inhibit Botrytis cinerea and Fusarium graminearum. Journal of Fungi. 2025; 11(6):418. https://doi.org/10.3390/jof11060418
Chicago/Turabian StyleMeng, Ying, Jing Wang, Hui Xu, Yaqi Yu, and Yongheng Liang. 2025. "A Novel Plate Compartment–Confrontation Method Discovered That Volatile Organic Compounds Produced by Saccharomyces cerevisiae Inhibit Botrytis cinerea and Fusarium graminearum" Journal of Fungi 11, no. 6: 418. https://doi.org/10.3390/jof11060418
APA StyleMeng, Y., Wang, J., Xu, H., Yu, Y., & Liang, Y. (2025). A Novel Plate Compartment–Confrontation Method Discovered That Volatile Organic Compounds Produced by Saccharomyces cerevisiae Inhibit Botrytis cinerea and Fusarium graminearum. Journal of Fungi, 11(6), 418. https://doi.org/10.3390/jof11060418

