A Pea (Pisum sativum L.) Seed Vicilins Hydrolysate Exhibits PPARγ Ligand Activity and Modulates Adipocyte Differentiation in a 3T3-L1 Cell Culture Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Pea Seed Fractionation Procedure
2.3. Production of Pea Proteins Hydrolysates
2.4. Cell Culture and Viability Assay
2.5. 2-deoxy-D-glucose Uptake and Lipid Accumulation Assay
2.6. Cell Differentiation-Oil Red Staining
2.7. RNA Preparation and Real Time rt-PCR Assay
2.8. PPARγ Ligand Activity
2.9. Partial Characterization of PV and PVH
2.10. Statistical Analysis
3. Results
3.1. PVH Enhanced Lipid Accumulation in 3T3-L1 Cells
3.2. PVH Enhanced Gucose Uptake in 3T3-L1 Cells
3.3. PVH Increased the Expression Levels of Marker Genes in 3T3-L1 Adipocytes
3.4. PVH Treatment Exhibited PPARγ Ligand Activity
3.5. Partial Characterization of PV and PVH
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
| aP2 | Adipocyte fatty acid-binding protein 2 |
| GLUT4 | Insulin-responsive glucose transporter 4 |
| Lactalb. H | Lactalbumin hydrolysate |
| PAH | Pea albumin hydrolysate |
| PLH | Pea legumin hydrolysate |
| PPARγ | Peroxisome proliferator-activated receptor γ |
| Pref-1 | Preadipocyte factor-1 |
| PVH | Pea vicilin hydrolysate |
| SEC | Size-exclusion chromatography |
| WAT | White adipose tissue |
References
- Tilg, H.; Moschen, A.R.; Kaser, A. Obesity and the microbiota. Gastroenterology 2009, 136, 1476–1483. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Engbers, L.H.; van Poppel, M.-N.; Paw, M.C.A.; van Mechelen, W. The effects of a controlled worksite environmental intervention on determinants of dietary behaviour and self-reported fruit, vegetable and fat intake. BMC Public Health 2006, 6, 1. [Google Scholar] [CrossRef] [Scilit]
- Ismaiel, A.; Dumitrascu, D.L. Cardiovascular Risk in Fatty Liver Disease: The Liver-Heart Axis-Literature Review. Front. Med. 2019, 6, 202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Centrone, M.; Gena, P.; Ranieri, M.; Di Mise, A.; D’Agostino, M.; Mastrodonato, M.; Venneri, M.; De Angelis, D.; Pavan, S.; Pasqualone, A.; et al. In Vitro and In Vivo Nutraceutical Characterization of Two Chickpea Accessions: Differential Effects on Hepatic Lipid Over-Accumulation. Antioxidants 2020, 9, 268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Williams, P.G.; Grafenauer, S.-J.; O’Shea, J.E. Cereal grains, legumes, and weight management: A comprehensive review of the scientific evidence. Nutr. Rev. 2008, 66, 171–182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dahl, W.J.; Foster, L.M.; Tyler, R.T. Review of the health benefits of peas (Pisum sativum L.). Br. J. Nutr. 2012, 108, S3–S10. [Google Scholar] [CrossRef] [Scilit]
- Rebello, C.J.; Greenway, F.L.; Finley, J.-W. A review of the nutritional value of legumes and their effects on obesity and its related co-morbidities. Obes. Rev. 2014, 15, 392–407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abete, I.; Parra, D.; Martinez, J.A. Legume-, fish-, or high-protein-based hypocaloric diets: Effects on weight loss and mitochondrial oxidation in obese men. J. Medic. Food 2009, 12, 100–108. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.J.; de Souza, R.J.; Choo, V.L.; Ha, V.; Cozma, A.I.; Chiavaroli, L.; Mirrahimi, A.; Mejia, S.B.; Di Buono, M.; Bernstein, A.M.; et al. Effects of Dietary Pulse Consumption on Body Weight: A Systematic Review and Meta-Analysis of Randomized Controlled Trials. Am. J. Clin. Nutr. 2016, 103, 1213–1223. [Google Scholar] [CrossRef] [Scilit]
- Papandreou, C.; Becerra-Tomás, N.; Bulló, M.; Martínez-González, M.A.; Corella, D.; Estruch, R.; Ros, E.; Arós, F.; Schroder, H.; Fitó, M.; et al. Legume consumption and risk of all-cause, cardiovascular, and cancer mortality in the PREDIMED study. Clin. Nutr. 2019, 38, 348–356. [Google Scholar] [CrossRef] [Scilit]
- Leterme, P. Recommendations by health organizations for legume consumption. Br. J. Nutr. 2002, 88, 239–242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salas-Salvadó, J.; Guasch-Ferré, M.; Lee, C.-H.; Estruch, R.; Clish, C.B.; Ros, E. Protective effects of the Mediterranean diet on type 2 diabetes and metabolic syndrome. J. Nutr. 2016, 146, 920S–927S. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duranti, M. Grain legume proteins and nutraceutical properties. Fitoterapia 2006, 77, 67–82. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rubio, L.A.; Pérez, A.; Ruiz, R.; Guzmán, M.A.; Aranda-Olmedo, I.; Clemente, A. Characterization of pea (Pisum sativum L.) seed protein fractions. J. Sci. Food Agric. 2014, 94, 280–287. [Google Scholar] [CrossRef] [Scilit]
- Utrilla, M.P.; Peinado, M.J.; Ruiz, R.; Rodríguez-Nogales, A.; Algieri, F.; Rodríguez-Cabezas, M.E.; Clemente, A.; Gálvez, J.; Rubio, L.A. Pea (Pisum sativum L.) seed albumin extracts show anti-inflammatory effect in a DSS model of mouse colitis. Mol. Nutr. Food Res. 2015, 59, 807–819. [Google Scholar] [CrossRef] [Scilit]
- Aranda-Olmedo, I.; Ruiz, R.; Peinado, M.J.; Rubio, L.A. A pea (Pisum sativum L.) seed albumin extract prevents colonic DSS induced dysbiosis in mice. J. Funct. Foods 2017, 35, 279–294. [Google Scholar] [CrossRef] [Scilit]
- Rubio, L.A. Physiological effects of legume storage proteins. Nutr. Abs. Rev. 2000, 70, 197–204. [Google Scholar]
- Webb, K.-E. Intestinal absorption of protein hydrolysis products: A review. J. Anim. Sci. 1990, 68, 3011–3022. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caillard, I.; Tome, D. Modulation of beta-lactoglobulin transport in rabbit ileum. Am. J. Physiol. 1994, 266, G1053–G1059. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miner-Williams, W.M.; Stevens, B.R.; Moughan, P.J. Are intact peptides absorbed from the healthy gut in the adult human? Nutr. Res. Rev. 2014, 27, 308–329. [Google Scholar] [CrossRef] [Scilit]
- Sholz-Ahrens, K.; Hagemeister, H.; Unshelm, J.; Agergaard, N.; Barth, C.A. Response of hormones modulating plasma cholesterol to dietary casein or soy protein in minipigs. J. Nutr. 1990, 120, 1387–1392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beynen, A.C. Comparison of the mechanisms proposed to explain the hypocholesterolemic effect of soybean protein versus casein in experimental animals. J. Nutr. Sci. Vitaminol. 1990, 36 (Suppl. S2), S87–S93. [Google Scholar] [CrossRef] [Scilit]
- Sirtori, C.R.; Galli, C.; Anderson, J.W.; Arnoldi, A. Nutritional and nutraceutical approaches to dyslipidemia and atherosclerosis prevention: Focus on dietary proteins. Atherosclerosis 2009, 203, 8–17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lovati, M.R.; Manzoni, C.; Corsini, A.; Granata, A.; Frattini, R.; Fumagalli, R.; Sirtori, C.R. Low density lipoprotein redeptor activity is modulated by soybean globulins in cell culture. J. Nutr. 1992, 122, 1971–1978. [Google Scholar] [CrossRef] [Scilit]
- Rubio, L.A.; Seiquer, I. Transport of amino acids from in vitro digested legume proteins or casein in Caco-2 cell cultures. J. Agric. Food Chem. 2002, 50, 5202–5207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rubio, L.A.; Rodríguez, J.; Fernández, C.; Crespo, J.F. Storage proteins: Physiological and antigenic effects. In Recent Advances of Research in Antinutritional Factors in Legume Seeds; Wageningen Academic Publishers: Wageningen, The Netherlands, 2004; pp. 159–176. ISBN 9076998396. [Google Scholar]
- Goto, T.; Mori, A.; Nagaoka, S. Soluble soy protein peptic hydrolysate stimulates adipocyte differentiation in 3T3-L1 cells. Mol. Nutr. Food Res. 2013, 57, 1435–1445. [Google Scholar] [CrossRef] [Scilit]
- Lehman, J.M.; Moore, L.B.; Smith-Oliver, T.-A.; Wilkison, W.-O.; Willson, T.M.; Kliewer, S.A. An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor gamma (PPARγ). J. Biol. Chem. 1995, 270, 12953–12956. [Google Scholar] [CrossRef] [Scilit]
- Yamauchi, T.; Kamon, J.; Waki, H.; Murakami, K.; Motojima, K.; Komeda, K.; Ide, T.; Kubota, N.; Terauchi, Y.; Tobe, K.; et al. The mechanisms by which both heterozygous peroxisome proliferator-activated receptor gamma (PPARγ) deficiency and PPARγ agonist improve insulin resistance. J. Biol. Chem. 2001, 276, 41245–41254. [Google Scholar] [CrossRef] [Scilit]
- Glahn, R.P.; Wien, E.M.; Van Campen, D.R.; Miller, D.D. Caco-2 cell iron uptake from meat and casein digests parallels in vivo studies: Use of a novel in vitro method for rapid estimation of iron bioavailability. J. Nutr. 1996, 126, 332–339. [Google Scholar] [CrossRef] [Scilit]
- Moreno, F.J.; Rubio, L.A.; Olano, A.; Clemente, A. Uptake of 2S albumin allergens, Ber e1 and Ses i 1, across human intestinal epithelial Caco-2 cell monolayers. J. Agric. Food Chem. 2006, 54, 8631–8639. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clemente, A.; Gee, J.M.; Johnson, I.T.; MacKenzie, D.A.; Domoney, C. Pea (Pisum sativum L.) protease inhibitors from the Bowman-Birk class influence the growth of human colorectal adenocarcinoma HT29 cells in vitro. J. Agric. Food Chem. 2005, 53, 8979–8986. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Desjardins, E.M.; Steinberg, G.R. Emerging Role of AMPK in Brown and Beige Adipose Tissue (BAT): Implications for Obesity, Insulin Resistance, and Type 2 Diabetes. Curr. Diab. Rep. 2018, 18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rosen, E.D.; Spiegelman, B.M. Adipocytes as regulators of energy balance and glucose homeostasis. Nature 2006, 444, 847–853. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vishwanath, D.; Srinivasan, H.; Manjunath, S.P.; Seetarama, S.; Agrawal, S.K.; Dixit, M.N.; Dhar, K. Novel method to differentiate 3T3 L1 cells in vitro to produce highly sensitive adipocytes for a GLUT4 mediated glucose uptake using fluorescent glucose analog. J. Cell Commun. Signal 2013, 7, 129–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cekanova, M.; Yuan, J.J.; Li, X.; Kim, K.; Baek, S.J. Gene alterations by peroxisome proliferator-activated receptor γ agonists in human colorectal cancer cells. Int. J. Oncol. 2008, 32, 809–819. [Google Scholar] [PubMed]
- XLSTAT (Addinsoft, 2017). Available online: https://www.xlstat.com/es/soluciones/base (accessed on 3 April 2007).
- Yajima, H.; Ikeshima, E.; Shiraki, M.; Kanaya, T.; Fujiwara, D.; Odai, H.; Tsuboyama-Kasaoka, N.; Ezaki, O.; Oikawa, S.; Kondo, K. Isohumulones, bitter acids derived from hops, activate both peroxisome proliferator-activated receptor alpha and gamma and reduce insulin resistance. J. Biol. Chem. 2004, 279, 33456–33462. [Google Scholar] [CrossRef] [Scilit]
- Torre-Villalvazo, I.; Tovar, A.R.; Ramos-Barragán, V.E.; Cerbón-Cervantes, M.-A.; Torres, N. Soy protein ameliorates metabolic abnormalities in liver and adipose tissue of rats fed a high fat diet. J. Nutr. 2008, 138, 462–468. [Google Scholar] [CrossRef] [Scilit]
- Cawthorn, W.P.; Sethi, J.K. TNF-alpha and adipocyte biology. FEBS Lett. 2008, 582, 117–131. [Google Scholar] [CrossRef] [Scilit]
- Spiegelman, B.M.; Flier, J.S. Adipogenesis and obesity: Rounding out the big picture. Cell 1996, 87, 377–389. [Google Scholar] [CrossRef] [Scilit]
- Tsuchida, A.; Yamauchi, T.; Kadowaki, T. Nuclear receptors as targets for drug development: Molecular mechanisms for regulation of obesity and insulin resistance by peroxisome proliferator-activated receptor gamma, CREB-binding protein, and adiponectin. J. Pharmacol. Sci. 2005, 97, 164–170. [Google Scholar] [CrossRef] [Scilit]
- Ndiaye, F.; Vuong, T.; Duarte, J.; Aluko, R.E.; Matar, C. Anti-oxidant, anti-inflammatory and immunomodulating properties of an enzymatic protein hydrolysate from yellow field pea seeds. Eur. J. Nutr. 2012, 51, 29–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Menéndez-Gutiérrez, M.P.; Röszer, T.; Ricote, M. Biology and therapeutic applications of peroxisome proliferator-activated receptors. Curr. Top. Medic. Chem. 2012, 12, 548–584. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marion-Letellier, R.; De’chelotte, P.; Iacucci, M.; Ghosh, S. Dietary modulation of peroxisome proliferator-activated receptor gamma. Gut 2009, 58, 586–593. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weidner, C.; de Groot, J.C.; Prasad, A.; Freiwald, A.; Quedenau, C.; Kliem, M.; Witzke, A.; Kodelja, V.; Han, C.-T.; Giegold, S.; et al. Amorfrutins are potent antidiabetic dietary natural products. Proc. Natl. Acad. Sci. USA 2012, 109, 7257–7262. [Google Scholar] [CrossRef] [Scilit]
- Moreno-Valdespino, C.A.; Luna-Vital, D.; Camacho-Ruiz, R.M.; Mojica, L. Bioactive proteins and phytochemicals from legumes: Mechanisms of action preventing obesity and type-2 diabetes. Food Res. Int. 2020, 130, 108905. [Google Scholar] [CrossRef] [Scilit]
- Jakubczyk, A.; Baraniak, B. Angiotensin I converting enzyme inhibitory peptides obtained after in vitro hydrolysis of pea (Pisum sativum var. Bajka) globulins. BioMed Res. Int. 2014, 2014, 438459. [Google Scholar] [CrossRef] [Scilit]
- Sato, N.; Moore, F.A.; Kone, B.C.; Zou, L.; Smith, M.A.; Childs, M.A.; Moore-Olufemi, S.; Schultz, S.G.; Kozar, R.A. Differential induction of PPAR-c by luminal glutamine and iNOS by luminal arginine in the rodent postischemic small bowel. Am. J. Physiol. Gastrointest. Liver Physiol. 2006, 290, G616–G623. [Google Scholar] [CrossRef] [Scilit]
- Rubio, L.A.; Clemente, A. In vivo (rat) and in vitro (Caco-2 cells) absorption of amino acids from legume protein isolates as compared to lactalbumin or casein. Arch. Anim. Nutr. 2009, 63, 413–426. [Google Scholar] [CrossRef] [Scilit]
- Chakrabarti, S.; Wu, J. Milk-derived tripeptides IPP (Ile-Pro-Pro) and VPP (Val-Pro-Pro) promote adipocyte differentiation and inhibit inflammation in 3T3-F442A cells. PLoS ONE 2015, 10, e0117492. [Google Scholar] [CrossRef] [Scilit]
- Kwak, S.J.; Kim, C.S.; Choi, M.S.; Park, T.; Sung, M.K.; Yun, J.W.; Yoo, H.; Mine, Y.; Yu, R. The soy peptide Phe-Leu-Val reduces TNF alpha-induced inflammatory response and insulin resistance in adipocytes. J. Medic. Food 2016, 19, 678–685. [Google Scholar] [CrossRef] [Scilit]







| Gene | Primer Sequences | Accession No. |
|---|---|---|
| Adiponectin | Fw: ACAACCAACAGAATCATTATGACGG | |
| Rv: GAAAGCCAGTAAATGTAGAGTCGTTGA | NM_009605.4 | |
| Adipocyte fatty acid-binding protein (aP2) | Fw: AAGACAGCTCCTCCTCGAAGGTT | |
| Rv: TGACCAAATCCCCATTTACGC | NM_024406.2 | |
| Glucose transporter (Glut4) | Fw: CGGATGCTATGGGTCCTTACG | |
| Rv: TGAGATCTGGTCAAACGTCCG | NM_009204 | |
| Peroxisome proliferator-activated receptor γ (PPARγ) | Fw: GGAGATCTCCAGTGATATCGACCA | |
| Rv: ACGGCTTCTACGGATCGAAACT | NM_001127330.1 | |
| Pre-adipocyte factor-1 (Pref-1) | Fw: GTGACCCCCAGTATGGATTC | |
| Rv: AGGGAGAACCATTGATCACG | NR_033813.1 | |
| 36B4 | Fw: TGTGTGTCTGCAGATCGGGTAC | |
| Rv: CTTTGGCGGGATTAGTCGAAG | NM_007475.5 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ruiz, R.; Olías, R.; Clemente, A.; Rubio, L.A. A Pea (Pisum sativum L.) Seed Vicilins Hydrolysate Exhibits PPARγ Ligand Activity and Modulates Adipocyte Differentiation in a 3T3-L1 Cell Culture Model. Foods 2020, 9, 793. https://doi.org/10.3390/foods9060793
Ruiz R, Olías R, Clemente A, Rubio LA. A Pea (Pisum sativum L.) Seed Vicilins Hydrolysate Exhibits PPARγ Ligand Activity and Modulates Adipocyte Differentiation in a 3T3-L1 Cell Culture Model. Foods. 2020; 9(6):793. https://doi.org/10.3390/foods9060793
Chicago/Turabian StyleRuiz, Raquel, Raquel Olías, Alfonso Clemente, and Luis A. Rubio. 2020. "A Pea (Pisum sativum L.) Seed Vicilins Hydrolysate Exhibits PPARγ Ligand Activity and Modulates Adipocyte Differentiation in a 3T3-L1 Cell Culture Model" Foods 9, no. 6: 793. https://doi.org/10.3390/foods9060793
APA StyleRuiz, R., Olías, R., Clemente, A., & Rubio, L. A. (2020). A Pea (Pisum sativum L.) Seed Vicilins Hydrolysate Exhibits PPARγ Ligand Activity and Modulates Adipocyte Differentiation in a 3T3-L1 Cell Culture Model. Foods, 9(6), 793. https://doi.org/10.3390/foods9060793
