An Evaluation of the Sensitivity and Applicability of a Droplet Digital Polymerase Chain Reaction Assay to Simultaneously Detect Pseudomonas aeruginosa and Pseudomonas fragi in Foods
Abstract
:1. Introduction
2. Material and Methods
2.1. Sample Preparation
2.2. Strain Culture and DNA Extraction
2.3. Screening of Specific Genes of P. aeruginosa and P. fragi
2.4. Primers, Probe Design for dddPCR and Specificity Verification
2.5. Establishment of dddPCR Assay
2.6. Establishment of Standard Curve
2.7. Sensitivity Test of dddPCR Detection
2.8. Anti-Interference Ability Evaluation
2.9. Evaluation of Artificial Simulated Contamination of Actual Samples
3. Results and Discussions
3.1. Analysis of Candidate Gene Selection
3.2. Results of Evaluation of dddPCR Reaction System Construction
3.3. A Linear Relationship Analysis of the Reaction System
3.4. Analysis of Specific Primers for dddPCR
3.5. Sensitivity Analysis of Genome and Colony Detection by dddPCR
3.6. Analysis of Anti-Interference Ability
3.7. Analysis of Test Results of Artificially Contaminated Food
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tropea, A. Microbial Contamination and Public Health: An Overview. Int. J. Environ. Res. Public Health 2022, 19, 7441. [Google Scholar] [CrossRef]
- Gutiérrez-Barranquero, J.A.; Cazorla, F.M.; de Vicente, A. Pseudomonas syringae pv. syringae Associated With Mango Trees, a Particular Pathogen within the “Hodgepodge” of the Pseudomonas syringae Complex. Front. Plant Sci. 2019, 10, 570. [Google Scholar] [CrossRef]
- Winsor, G.L.; Griffiths, E.J.; Lo, R.; Dhillon, B.K.; Shay, J.A.; Brinkman Fiona, S.L. Enhanced annotations and features for comparing thousands of Pseudomonas genomes in the Pseudomonas genome database. Nucleic Acids Res. 2016, 44, D646–D653. [Google Scholar] [CrossRef]
- Alonso, V.P.P.; Gonçalves, M.P.M.B.B.; de Brito, F.A.E.; Barboza, G.R.; Rocha, L.D.O.; Silva, N.C.C. Dry surface biofilms in the food processing industry: An overview on surface characteristics, adhesion and biofilm formation, detection of biofilms, and dry sanitization methods. Compr. Rev. Food Sci. Food Saf. 2022, 22, 688–713. [Google Scholar] [CrossRef]
- Rossi, C.; Serio, A.; Chaves-López, C.; Anniballi, F.; Auricchio, B.; Goffredo, E.; Cenci-Goga, B.T.; Lista, F.; Fillo, S.; Paparella, A. Biofilm formation, pigment production and motility in Pseudomonas spp. isolated from the dairy industry. Food Control 2018, 86, 241–248. [Google Scholar] [CrossRef]
- Hadi, J.; Rapp, D.; Dhawan, S.; Gupta, S.K.; Gupta, T.B.; Brightwell, G. Molecular detection and characterization of foodborne bacteria: Recent progresses and remaining challenges. Compr. Rev. Food Sci. Food Saf. 2023, 22, 2433–2464. [Google Scholar] [CrossRef]
- Bilican, I.; Bahadir, T.; Bilgin, K.; Guler, M.T. Alternative screening method for analyzing the water samples through an electrical microfluidics chip with classical microbiological assay comparison of P. aeruginosa. Talanta 2020, 219, 121293. [Google Scholar] [CrossRef]
- Gao, Y.; Chen, Y.; Li, M.; Jia, L.; Zhang, L.; Zhu, J. Gelatin-based photonic hydrogels for visual detection of pathogenic Pseudomonas aeruginosa. Sens. Actuators B Chem. 2021, 329, 129137. [Google Scholar] [CrossRef]
- Huang, S.; Wang, X.; Chen, X.; Liu, X.; Xu, Q.; Zhang, L.; Huang, G.; Wu, J. Rapid and sensitive detection of Pseudomonas aeruginosa by isothermal amplification combined with Cas12a-mediated detection. Sci. Rep. 2023, 13, 19199. [Google Scholar] [CrossRef]
- Garedew, L.; Berhanu, A.; Mengesha, D.; Tsegay, G. Identification of gram-negative bacteria from critical control points of raw and pasteurized cow milk consumed at Gondar town and its suburbs, Ethiopia. BMC Public Health 2012, 12, 950. [Google Scholar] [CrossRef]
- Quintieri, L.; Fanelli, F.; Caputo, L. Antibiotic Resistant Pseudomonas Spp. Spoilers in Fresh Dairy Products: An Underestimated Risk and the Control Strategies. Foods 2019, 8, 372. [Google Scholar] [CrossRef]
- Bloomfield, S.J.; Palau, R.; Holden, E.R.; Webber, M.A.; Mather, A.E. Genomic characterization of Pseudomonas spp. on food: Implications for spoilage, antimicrobial resistance and human infection. BMC Microbiol. 2024, 24, 20. [Google Scholar] [CrossRef]
- Dong, Q.; Sun, L.; Fang, T.; Wang, Y.; Li, Z.; Wang, X.; Wu, M.; Zhang, H. Biofilm Formation of Listeria monocytogenes and Pseudomonas aeruginosa in a Simulated Chicken Processing Environment. Foods 2022, 11, 1917. [Google Scholar] [CrossRef]
- Yang, J.; Liang, R.; Mao, Y.; Dong, P.; Zhu, L.; Luo, X.; Zhang, Y.; Yang, X. Potential inhibitory effect of carbon dioxide on the spoilage behaviors of Pseudomonas fragi in high-oxygen packaged beef during refrigerated storage. Food Microbiol. 2023, 112, 104229. [Google Scholar] [CrossRef]
- Zhang, Y.; Wei, J.; Yuan, Y.; Yue, T. Diversity and characterization of spoilage-associated psychrotrophs in food in cold chain. Int. J. Food Microbiol. 2019, 290, 86–95. [Google Scholar] [CrossRef]
- Quintieri, L.; Caputo, L.; Brasca, M.; Fanelli, F. Recent Advances in the Mechanisms and Regulation of QS in Dairy Spoilage by Pseudomonas spp. Foods 2021, 10, 3088. [Google Scholar] [CrossRef]
- Shao, L.; Chen, S.; Wang, H.; Zhang, J.; Xu, X.; Wang, H. Advances in understanding the predominance, phenotypes, and mechanisms of bacteria related to meat spoilage. Trends Food Sci. Technol. 2021, 118, 822–832. [Google Scholar] [CrossRef]
- Wang, G.-Y.; Wang, H.-H.; Han, Y.-W.; Xing, T.; Ye, K.-P.; Xu, X.-L.; Zhou, G.-H. Evaluation of the spoilage potential of bacteria isolated from chilled chicken in vitro and in situ. Food Microbiol. 2017, 63, 139–146. [Google Scholar] [CrossRef]
- Cui, F.; Wang, Q.; Liu, J.; Wang, D.; Li, J.; Li, T. Effects of deletion of siderophore biosynthesis gene in Pseudomonas fragi on quorum sensing and spoilage ability. Int. J. Food Microbiol. 2023, 396, 110196. [Google Scholar] [CrossRef]
- Li, J.; Zhou, G.; Xue, P.; Dong, X.; Xia, Y.; Regenstein, J.; Du, M.; Sun, L. Spoilage microbes’ effect on freshness and IMP degradation in sturgeon fillets during chilled storage. Food Biosci. 2021, 41, 101008. [Google Scholar] [CrossRef]
- Jiang, Y.; Zheng, C.; Jin, M.; Zhou, R.; Wu, Q.; Huang, F.; Lou, Y.; Zheng, L. An Ultrasensitive Colorimetric Foodborne Pathogenic Detection Method Using a CRISPR/Cas12a Mediated Strand Displacement/Hybridization Chain Reaction. J. Agric Food Chem. 2023, 71, 4193–4200. [Google Scholar] [CrossRef]
- Furet, J.P.; Quenee, P.; Tailliez, P. Molecular quantification of lactic acid bacteria in fermented milk products using real-time quantitative PCR. Int. J. Food Microbiol. 2004, 97, 197–207. [Google Scholar] [CrossRef]
- Li, Z.; Xu, X.; Wang, D.; Jiang, X. Recent advancements in nucleic acid detection with microfluidic chip for molecular diagnostics. TrAC Trends Anal. Chem. 2023, 158, 116871. [Google Scholar] [CrossRef] [PubMed]
- Mangal, M.; Bansal, S.; Sharma, S.K.; Gupta, R.K. Molecular Detection of Foodborne Pathogens: A Rapid and Accurate Answer to Food Safety. Crit. Rev. Food Sci. Nutr. 2015, 56, 1568–1584. [Google Scholar] [CrossRef]
- Wang, C.; Ye, Q.; Jiang, A.; Zhang, J.; Shang, Y.; Li, F.; Zhou, B.; Xiang, X.; Gu, Q.; Pang, R.; et al. Pseudomonas aeruginosa Detection Using Conventional PCR and Quantitative Real-Time PCR Based on Species-Specific Novel Gene Targets Identified by Pangenome Analysis. Front. Microbiol. 2022, 13, 820431. [Google Scholar] [CrossRef] [PubMed]
- Murugan, N.; Malathi, J.; Therese, K.L.; Madhavan, H.N. Application of six multiplex PCR’s among 200 clinical isolates of Pseudomonas aeruginosa for the detection of 20 drug resistance encoding genes. Kaohsiung J. Med. Sci. 2017, 34, 79–88. [Google Scholar] [CrossRef] [PubMed]
- Ercolini, D.; Casaburi, A.; Nasi, A.; Ferrocino, I.; Di Monaco, R.; Ferranti, P.; Mauriello, G.; Villani, F. Different molecular types of Pseudomonas fragi have the same overall behaviour as meat spoilers. Int. J. Food Microbiol. 2010, 142, 120–131. [Google Scholar] [CrossRef]
- Hou, Y.; Chen, S.; Zheng, Y.; Zheng, X.; Lin, J.-M. Droplet-based digital PCR (ddPCR) and its applications. TrAC Trends Anal. Chem. 2023, 158, 116897. [Google Scholar] [CrossRef]
- Zhang, L.; Parvin, R.; Fan, Q.; Ye, F. Emerging digital PCR technology in precision medicine. Biosens. Bioelectron. 2022, 211, 114344. [Google Scholar] [CrossRef]
- Yin, J.; Zou, Z.; Hu, Z.; Zhang, S.; Zhang, F.; Wang, B.; Lv, S.; Mu, Y. A “sample-in-multiplex-digital-answer-out” chip for fast detection of pathogens. Lab A Chip 2020, 20, 979–986. [Google Scholar] [CrossRef]
- Saravanan, A.; Kumar, P.S.; Hemavathy, R.V.; Jeevanantham, S.; Kamalesh, R.; Sneha, S.; Yaashikaa, P.R. Methods of detection of food-borne pathogens: A review. Environ. Chem. Lett. 2020, 19, 189–207. [Google Scholar] [CrossRef]
- Zhao, G.; Shen, X.; Liu, Y.; Xie, P.; Yao, C.; Li, X.; Sun, Y.; Lei, Y.; Lei, H. Direct lysis-multiplex polymerase chain reaction assay for beef fraud substitution with chicken, pork and duck. Food Control 2021, 129, 108252. [Google Scholar] [CrossRef]
- Ruiz-Roldán, L.; Rojo-Bezares, B.; Lozano, C.; López, M.; Chichón, G.; Torres, C.; Sáenz, Y. Occurrence of Pseudomonas spp. in Raw Vegetables: Molecular and Phenotypical Analysis of Their Antimicrobial Resistance and Virulence-Related Traits. Int. J. Mol. Sci. 2021, 22, 12626. [Google Scholar] [CrossRef]
- Lee, C.S.; Wetzel, K.; Buckley, T.; Wozniak, D.; Lee, J. Rapid and sensitive detection of Pseudomonas aeruginosa in chlorinated water and aerosols targeting gyrB gene using real-time PCR. J. Appl. Microbiol. 2011, 111, 893–903. [Google Scholar] [CrossRef]
- Zhang, J.; Huang, Y.; Xue, P.; Zhan, Z.; Huang, Z.; Li, J.; Diao, B.; Kan, B. A duplex droplet digital PCR assay for Salmonella and Shigella and its application in diarrheal and non-diarrheal samples. Int. J. Infect. Dis. 2022, 120, 210–216. [Google Scholar] [CrossRef]
- Luo, J.; Li, J.; Yang, H.; Yu, J.; Wei, H.; Ledeboer, N.A. Accurate Detection of Methicillin-Resistant Staphylococcus aureus in Mixtures by Use of Single-Bacterium Duplex Droplet Digital PCR. J. Clin. Microbiol. 2017, 55, 2946–2955. [Google Scholar] [CrossRef]
- Yin, J.; Xia, L.; Zou, Z.; Zhuang, J.; Mu, Y. A direct and multiplex digital PCR chip for EGFR mutation. Talanta 2022, 250, 123725. [Google Scholar] [CrossRef]
- Xie, T.; Luo, Y.; Wang, P.; Wu, L.; Cui, X.; Sun, B.; Li, G. Controlled Rehydration of Dried Reagents for Robust Multiplex Digital PCR. Anal. Chem. 2022, 94, 13223–13232. [Google Scholar] [CrossRef]
- Xu, Y.; Kutsanedzie, F.Y.H.; Sun, H.; Wang, M.; Chen, Q.; Guo, Z.; Wu, J. Rapid Pseudomonas Species Identification from Chicken by Integrating Colorimetric Sensors with Near-Infrared Spectroscopy. Food Anal. Methods 2017, 11, 1199–1208. [Google Scholar] [CrossRef]
- Zhang, Z.; Zhang, H.; Tian, D.; Phan, A.; Seididamyeh, M.; Alanazi, M.; Ping Xu, Z.; Sultanbawa, Y.; Zhang, R. Luminescent sensors for residual antibiotics detection in food: Recent advances and perspectives. Coord. Chem. Rev. 2024, 498, 215455. [Google Scholar] [CrossRef]
- Liu, C.; Lu, C.; Tang, Z.; Chen, X.; Wang, G.; Sun, F. Aptamer-functionalized magnetic nanoparticles for simultaneous fluorometric determination of oxytetracycline and kanamycin. Microchim. Acta 2015, 182, 2567–2575. [Google Scholar] [CrossRef]
- Bolzon, V.; Bulfoni, M.; Pesando, M.; Nencioni, A.; Nencioni, E. Verification of a Rapid Analytical Method for the Qualitative Detection of Listeria spp. and Listeria monocytogenes by a Real-Time PCR Assay according to EN UNI ISO 16140-3:2021. Pathogens 2024, 13, 141. [Google Scholar] [CrossRef]
- Cheng, Y.-Y.; Chen, Z.; Cao, X.; Ross, T.D.; Falbel, T.G.; Burton, B.M.; Venturelli, O.S. Programming bacteria for multiplexed DNA detection. Nat. Commun. 2023, 14, 2001. [Google Scholar] [CrossRef]
- Xiang, Y.; Yan, L.; Zheng, X.-C.; Li, L.-Z.; Liu, P.; Cao, W.-S. Rapid detection of Pseudomonas aeruginosa by cross priming amplification. J. Integr. Agric. 2020, 19, 2523–2529. [Google Scholar] [CrossRef]
- Qin, M.; Ma, X.; Fan, S.; Wu, H.; Yan, W.; Tian, X.; Lu, J.; Lyu, M.; Wang, S. Rapid detection of Pseudomonas aeruginosa using a DNAzyme-based sensor. Food Sci. Nutr. 2021, 9, 3873–3884. [Google Scholar] [CrossRef]
- Zhao, T.; Zhang, J.; Han, X.; Yang, J.; Wang, X.; Vercruysse, M.; Hu, H.-Y.; Lei, X. A Pseudopaline Fluorescent Probe for the Selective Detection of Pseudomonas aeruginosa. CCS Chem. 2021, 3, 2405–2417. [Google Scholar] [CrossRef]
- Wang, M.; Yang, J.; Gai, Z.; Huo, S.; Zhu, J.; Li, J.; Wang, R.; Xing, S.; Shi, G.; Shi, F.; et al. Comparison between digital PCR and real-time PCR in detection of Salmonella typhimurium in milk. Int. J. Food Microbiol. 2018, 266, 251–256. [Google Scholar] [CrossRef]
- Lee, S.-Y.; Kim, J.-H.; Oh, S.-W. Combination of filtration and immunomagnetic separation based on real-time PCR to detect foodborne pathogens in fresh-cut apple. J. Microbiol. Methods 2022, 201, 106577. [Google Scholar] [CrossRef] [PubMed]
- Maier, C.; Hofmann, K.; Huptas, C.; Scherer, S.; Wenning, M.; Lücking, G. Simultaneous quantification of the most common and proteolytic Pseudomonas species in raw milk by multiplex qPCR. Appl. Microbiol. Biotechnol. 2021, 105, 1693–1708. [Google Scholar] [CrossRef] [PubMed]
Source | Gene | Annotation | Primer | Sequence (5′–3′) | Source |
---|---|---|---|---|---|
P. fragi | RS22665 | Transcriptional regulatory protein | pf1-7 | ATAACGGCAAGAACACCA | In this study |
CCAAACACGCCTCTGAAC | |||||
RS22680 | NeuD/PglB/VioB family sugar acetyltransferase | pf1-18 | GGCACAAGTCAATGGTCG | ||
CACAGTCAGGGCAAGGAT | |||||
RS10890 | triacylglycerol lipase | Pf3-21 | CCTTGAATGCGCTTAACGCCCTGACCACC | ||
CGTAGACCCGGTCCAGTAGGCGAGGCTGAT | |||||
ribA | GTP cyclohydrolase II | Pf3-13 | CGATGTATTCGGGTCCAGACGCTGTGATT | ||
ATAGTGGTAGTTGTCTTGGGACGGTAGGC | |||||
P. aeruginosa | lasR | Transcriptional regulatory protein | lasR1 | CGAGAACGCCTTCATCGTCGGCAACTACC | In this study |
GAAGAACTCGTGCTGCTTTCGCGTCTGGTA | |||||
gyrB | DNA gyrase subunit B | gyrB2 | ATCCGCACCCTGCTGTTGACCTTCTTCTTCCG | ||
TGATGTACTGCTCCTGCTTGCCACGCTTGACC | |||||
rpoB | DNA-directed RNA polymerase beta chain | rpoB3 | TGCCCGATCGAAACCCCTGAAGGTCCGAA | ||
ATCTCGTCGGTTACCAGGCTGTCCTTGACT |
Bacterial Strains | Gene | Primer | Sequences of Primer (5′–3′) | PCR Product | Source |
---|---|---|---|---|---|
P. aeruginosa | lasR | Pa-2F | AGCCGGGAGAAGGAAGTGTT | 80 bp | In this study |
Pa-2R | TCCGAGCAGTTGCAGATAACC | ||||
Pa-2P | VIC-TGCGCCATCGGCAAGACCAGT-BHQ1 | ||||
P. fragi | RS22680 | Pf-2F | GGCCGGCACGCAAGT | 59 bp | In this study |
Pf-2R | CTTGGACAGTAGCGAAAAACGA | ||||
Pf-2P | FAM-TGTCGAGAAGCCAGTCTCCGTGTTCC-BHQ1 |
Component | Addition |
---|---|
5× MIX | 4.5 μL |
Primer 1-F (10 μM) | 1 μM |
Primer 1-R (10 μM) | 1 μM |
Primer 2-F(10 μM) | 1 μM |
Primer 2-R (10 μM) | 1 μM |
Probe1 (10 μM) | 0.25 μM |
Probe2 (10 μM) | 0.25 μM |
ROX dye | 0.3 μL |
Enzyme | 0.2 μL |
Template 1 | 1 μL |
Template 2 | 1 μL |
Complemented by water to | 15 μL |
Bacterial Strains | Source | Results | ||||||
---|---|---|---|---|---|---|---|---|
lasR | rpoB | gyrB | RS22665 | RS22680 | RS10890 | ribA | ||
Pseudomonas fragi | SHBCC D24613 | − | − | − | + | + | + | + |
Pseudomonas fragi | CGMCC1.3349 | − | − | − | + | + | + | + |
Pseudomonas fragi | Laboratory isolates | − | − | − | + | + | + | − |
Pseudomonas aeruginosa | ATCC 15442 | + | + | + | − | − | − | − |
Pseudomonas aeruginosa | ATCC 27853 | + | + | + | − | − | − | − |
Pseudomonas aeruginosa | DSM 939 | + | + | + | − | − | − | − |
Pseudomonas aeruginosa | Laboratory isolates | + | + | + | − | − | − | − |
Pseudomonas fluorescens | ATCC 13525 | − | − | − | + | − | + | − |
Pseudomonas putida | ATCC 49128 | − | + | − | − | − | − | + |
Pseudomonas pseudoalaligenes | CGMCC1.10611 | − | − | − | − | − | − | − |
Pseudomonas mendocina | ATCC 25411 | − | + | − | − | − | − | + |
Pseudomonas stutzeri | ATCC 17588 | − | − | − | − | − | − | − |
Pseudomonas alcaligenes | ATCC 14909 | − | − | − | − | − | − | − |
Pseudomonas cepacia | SHBCC D 14769 | − | − | − | − | − | − | − |
Pseudomonas putida | ATCC 17485 | − | − | − | − | − | − | − |
Pseudomonas fluorescens | GIM1.110 | − | − | − | − | − | + | − |
Pseudomonas fluorescens | ATCC 17397 | − | − | + | − | − | − | − |
Staphylococcus | CICC 10788 | − | − | − | − | − | − | − |
Enterococcus avium | ATCC 14025 | − | − | − | − | − | − | − |
Bacillus pumilus | CMCC 63202 | − | − | − | − | − | − | − |
Listeria monocytogenes | CICC 21622 | − | − | − | − | − | − | − |
salmonella enterica | CICC 21482 | − | − | − | − | − | − | − |
Cronobacter sakazakii | CICC 21560 | − | − | − | − | − | − | − |
Cronobacter universalis | NCTC 9529 | − | − | − | − | − | − | − |
salmonella anatum | CICC 21498 | − | − | − | − | − | − | − |
Escherichia coli | ATCC 25922 | − | − | − | − | − | − | + |
Bacillus cereus | CICC 23384 | − | − | − | − | − | − | − |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, J.; Zhai, L.; Wang, J.; Sun, X.; Wang, B.; Wei, Z. An Evaluation of the Sensitivity and Applicability of a Droplet Digital Polymerase Chain Reaction Assay to Simultaneously Detect Pseudomonas aeruginosa and Pseudomonas fragi in Foods. Foods 2024, 13, 1453. https://doi.org/10.3390/foods13101453
Huang J, Zhai L, Wang J, Sun X, Wang B, Wei Z. An Evaluation of the Sensitivity and Applicability of a Droplet Digital Polymerase Chain Reaction Assay to Simultaneously Detect Pseudomonas aeruginosa and Pseudomonas fragi in Foods. Foods. 2024; 13(10):1453. https://doi.org/10.3390/foods13101453
Chicago/Turabian StyleHuang, Ju, Ligong Zhai, Junyin Wang, Xiaotian Sun, Baoshi Wang, and Zhaohui Wei. 2024. "An Evaluation of the Sensitivity and Applicability of a Droplet Digital Polymerase Chain Reaction Assay to Simultaneously Detect Pseudomonas aeruginosa and Pseudomonas fragi in Foods" Foods 13, no. 10: 1453. https://doi.org/10.3390/foods13101453
APA StyleHuang, J., Zhai, L., Wang, J., Sun, X., Wang, B., & Wei, Z. (2024). An Evaluation of the Sensitivity and Applicability of a Droplet Digital Polymerase Chain Reaction Assay to Simultaneously Detect Pseudomonas aeruginosa and Pseudomonas fragi in Foods. Foods, 13(10), 1453. https://doi.org/10.3390/foods13101453