Alleviation Effects of Microbial Metabolites from Resveratrol on Non-Alcoholic Fatty Liver Disease
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Culture
2.3. CCK8 Assay
2.4. Measurement Triglyceride (TG) Level of HepG2 Cells
2.5. ORO Staining of HepG2 Cells
2.6. Feeding and Grouping of Mice
2.7. Intraperitoneal Glucose Tolerance Test (IPGTT)
2.8. Biochemical Analysis of Serum and Liver Samples
2.9. Histopathological Examination
2.10. RNA Isolation and qPCR Analysis
2.11. Statistical Analysis
3. Results
3.1. Phenolic Acids Reduced Lipid Contents in OA-Induced NAFLD Cell Model
3.2. 3-HPP and 4-HPP Had Little Influence on Lipid Anabolism in Adipocytes of HFD Mice
3.3. 3-HPP and 4-HPP Alleviated Liver Damage and Hepatic Steatosis in HFD Mice
3.4. 3-HPP and 4-HPP Improved Systemic Inflammation and Insulin Resistance in HFD Mice
3.5. 3-HPP and 4-HPP Regulated the Gene Expression of Lipid Metabolism in HFD Mice
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Younossi, Z.; Tacke, F.; Arrese, M.; Sharma, B.C.; Mostafa, I.; Bugianesi, E.; Wai-Sun Wong, V.; Sun, W.; Yilmaz, Y.; George, J.; et al. Global Perspectives on Nonalcoholic Fatty Liver Disease and Nonalcoholic Steatohepatitis. Hepatology 2019, 69, 2672–2682. [Google Scholar] [CrossRef]
- Nobili, V.; Alisi, A.; Valenti, L.; Miele, L.; Feldstein, A.E.; Alkhouri, N. NAFLD in children: New genes, new diagnostic modalities and new drugs. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 517–530. [Google Scholar] [CrossRef]
- Buzzetti, E.; Pinzani, M.; Tsochatzis, E.A. The multiple-hit pathogenesis of non-alcoholic fatty liver disease (NAFLD). Metab.-Clin. Exp. 2016, 65, 1038–1048. [Google Scholar] [CrossRef] [PubMed]
- Ipsen, D.H.; Lykkesfeldt, J.; Tveden-Nyborg, P. Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell. Mol. Life Sci. 2018, 75, 3313–3327. [Google Scholar] [CrossRef] [PubMed]
- Mantovani, A.; Scorletti, E.; Mosca, A.; Alisi, A.; Byrne, C.D.; Targher, G. Complications, morbidity and mortality of nonalcoholic fatty liver disease. Metab. Clin. Exp. 2020, 111, 154170. [Google Scholar] [CrossRef]
- Bril, F.; Cusi, K. Nonalcoholic Fatty Liver Disease The New Complication of Type 2 Diabetes Mellitus. Endocrinol. Metab. Clin. North Am. 2016, 45, 765–781. [Google Scholar] [CrossRef] [PubMed]
- Targher, G.; Corey, K.E.; Byrne, C.D. NAFLD, and cardiovascular and cardiac diseases: Factors influencing risk, prediction and treatment. Diabetes Metab. 2021, 47, 101215. [Google Scholar] [CrossRef]
- Younossi, Z.M.; Henry, L.; Bush, H.; Mishra, A. Clinical and Economic Burden of Nonalcoholic Fatty Liver Disease and Nonalcoholic Steatohepatitis. Clin. Liver Dis. 2018, 22, 1–10. [Google Scholar] [CrossRef]
- Tian, B.; Liu, J. Resveratrol: A review of plant sources, synthesis, stability, modification and food application. J. Sci. Food Agric. 2020, 100, 1392–1404. [Google Scholar] [CrossRef]
- Shang, J.; Chen, L.L.; Xiao, F.X.; Sun, H.; Ding, H.C.; Xiao, H. Resveratrol improves non-alcoholic fatty liver disease by activating AMP-activated protein kinase. Acta Pharmacol. Sin. 2008, 29, 698–706. [Google Scholar] [CrossRef]
- Charytoniuk, T.; Drygalski, K.; Konstantynowicz-Nowicka, K.; Chabowski, A. Alternative treatment methods attenuate the development of NAFLD: A review of resveratrol molecular mechanisms and clinical trials. Nutrition 2017, 34, 108–117. [Google Scholar] [CrossRef] [PubMed]
- Khaleel, E.F.; Abdel-Aleem, G.A.; Mostafa, D.G. Resveratrol improves high-fat diet induced fatty liver and insulin resistance by concomitantly inhibiting proteolytic cleavage of sterol regulatory element-binding proteins, free fatty acid oxidation, and intestinal triglyceride absorption. Can. J. Physiol. Pharmacol. 2018, 96, 145–157. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Ma, J.; Wang, W.; Zhang, L.; Xu, J.; Wang, K.; Li, D. Resveratrol supplement inhibited the NF-κB inflammation pathway through activating AMPKα-SIRT1 pathway in mice with fatty liver. Mol. Cell. Biochem. 2016, 422, 75–84. [Google Scholar] [CrossRef]
- Badi, R.M.; Mostafa, D.G.; Khaleel, E.F.; Satti, H.H. Resveratrol protects against hepatic insulin resistance in a rat's model of non-alcoholic fatty liver disease by down-regulation of GPAT-1 and DGAT2 expression and inhibition of PKC membranous translocation. Clin. Exp. Pharmacol. Physiol. 2019, 46, 545–555. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Wang, J.; Li, D.; Ke, W.; Chen, F.; Hu, X. Targeting the gut microbiota with resveratrol: A demonstration of novel evidence for the management of hepatic steatosis. J. Nutr. Biochem. 2020, 81, 108363. [Google Scholar] [CrossRef] [PubMed]
- Milton-Laskibar, I.; Aguirre, L.; Fernandez-Quintela, A.; Rolo, A.P.; Teodoro, J.S.; Palmeira, C.M.; Portillo, M.P. Lack of Additive Effects of Resveratrol and Energy Restriction in the Treatment of Hepatic Steatosis in Rats. Nutrients 2017, 9, 737. [Google Scholar] [CrossRef]
- Cheng, K.; Song, Z.; Zhang, H.; Li, S.; Wang, C.; Zhang, L.; Wang, T. The therapeutic effects of resveratrol on hepatic steatosis in high-fat diet-induced obese mice by improving oxidative stress, inflammation and lipid-related gene transcriptional expression. Med. Mol. Morphol. 2019, 52, 187–197. [Google Scholar] [CrossRef]
- Zhou, R.; Yi, L.; Ye, X.; Zeng, X.; Liu, K.; Qin, Y.; Zhang, Q.; Mi, M. Resveratrol Ameliorates Lipid Droplet Accumulation in Liver Through a SIRT1/ATF6-Dependent Mechanism. Cell. Physiol. Biochem. 2018, 51, 2397–2420. [Google Scholar] [CrossRef]
- Springer, M.; Moco, S. Resveratrol and Its Human Metabolites-Effects on Metabolic Health and Obesity. Nutrients 2019, 11, 143. [Google Scholar] [CrossRef]
- Ozdal, T.; Sela, D.A.; Xiao, J.; Boyacioglu, D.; Chen, F.; Capanoglu, E. The Reciprocal Interactions between Polyphenols and Gut Microbiota and Effects on Bioaccessibility. Nutrients 2016, 8, 78. [Google Scholar] [CrossRef]
- Wang, P.; Ma, Y.; Wang, D.; Zhao, W.T.; Hu, X.S.; Chen, F.; Zhao, X.Y. Protective Effects of Dietary Resveratrol against Chronic Low-Grade Inflammation Mediated through the Gut Microbiota in High-Fat Diet Mice. Nutrients 2022, 14, 1994. [Google Scholar] [CrossRef]
- Yin, X.; Liao, W.; Li, Q.; Zhang, H.; Liu, Z.; Zheng, X.; Zheng, L.; Feng, X. Interactions between resveratrol and gut microbiota affect the development of hepatic steatosis: A fecal microbiota transplantation study in high-fat diet mice. J. Funct. Foods 2020, 67, 103883. [Google Scholar] [CrossRef]
- Kim, T.T.; Parajuli, N.; Sung, M.M.; Bairwa, S.C.; Levasseur, J.; Soltys, C.L.M.; Wishart, D.S.; Madsen, K.; Schertzer, J.D.; Dyck, J.R.B. Fecal transplant from resveratrol-fed donors improves glycaemia and cardiovascular features of the metabolic syndrome in mice. Am. J. Physiol. -Endocrinol. Metab. 2018, 315, E511–E519. [Google Scholar] [CrossRef] [PubMed]
- Bode, L.M.; Bunzel, D.; Huch, M.; Cho, G.S.; Ruhland, D.; Bunzel, M.; Bub, A.; Franz, C.; Kulling, S.E. In vivo and in vitro metabolism of trans-resveratrol by human gut microbiota. Am. J. Clin. Nutr. 2013, 97, 295–309. [Google Scholar] [CrossRef] [PubMed]
- Iglesias-Aguirre, C.E.; Vallejo, F.; Beltran, D.; Berna, J.; Puigcerver, J.; Alajarin, M.; Selma, M.V.; Espin, J.C. 4-Hydroxydibenzyl: A novel metabolite from the human gut microbiota after consuming resveratrol. Food Funct. 2022, 13, 7487–7493. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Gao, J.; Ke, W.; Wang, J.; Li, D.; Liu, R.; Jia, Y.; Wang, X.; Chen, X.; Chen, F.; et al. Resveratrol reduces obesity in high-fat diet-fed mice via modulating the composition and metabolic function of the gut microbiota. Free Radic. Biol. Med. 2020, 156, 83–98. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Wang, S.; Dong, F.; Lin, Y.; Li, H.; Shi, L.; Wang, Z.; Zhang, J. Comprehensive analysis of resveratrol metabolites in rats using ultra high performance liquid chromatography coupled with high resolution mass spectrometry. Arab. J. Chem. 2020, 13, 7055–7065. [Google Scholar] [CrossRef]
- Gunther, I.; Rimbach, G.; Mack, C.I.; Weinert, C.H.; Danylec, N.; Luersen, K.; Birringer, M.; Bracher, F.; Soukup, S.T.; Kulling, S.E.; et al. The Putative Caloric Restriction Mimetic Resveratrol has Moderate Impact on Insulin Sensitivity, Body Composition, and the Metabolome in Mice. Mol. Nutr. Food Res. 2020, 64, 1116. [Google Scholar] [CrossRef]
- Trepiana, J.; Krisa, S.; Renouf, E.; Portillo, M.P. Resveratrol Metabolites Are Able to Reduce Steatosis in Cultured Hepatocytes. Pharmaceuticals 2020, 13, 285. [Google Scholar] [CrossRef]
- Vogl, S.; Atanasov, A.G.; Binder, M.; Bulusu, M.; Zehl, M.; Fakhrudin, N.; Heiss, E.H.; Picker, P.; Wawrosch, C.; Saukel, J.; et al. The Herbal Drug Melampyrum pratense L. (Koch): Isolation and Identification of Its Bioactive Compounds Targeting Mediators of Inflammation. Evid. Based Complement. Altern. Med. 2013, 2013, 395316. [Google Scholar] [CrossRef]
- Aires, V.; Delmas, D.; Bachelier, C.L.; Latruffe, N.; Schlemmer, D.; Benoist, J.F.O.; Djouadi, F.; Bastin, J. Stilbenes and resveratrol metabolites improve mitochondrial fatty acid oxidation defects in human fibroblasts. Orphanet J. Rare Dis. 2014, 9, 79. [Google Scholar] [CrossRef] [PubMed]
- Del Rio, D.; Rodriguez-Mateos, A.; Spencer, J.P.E.; Tognolini, M.; Borges, G.; Crozier, A. Dietary (Poly)phenolics in Human Health: Structures, Bioavailability, and Evidence of Protective Effects Against Chronic Diseases. Antioxid. Redox Signal. 2013, 18, 1818–1892. [Google Scholar] [CrossRef]
- Monagas, M.; Urpi-Sarda, M.; Sánchez-Patán, F.; Llorach, R.; Garrido, I.; Gómez-Cordovés, C.; Andres-Lacueva, C.; Bartolomé, B. Insights into the metabolism and microbial biotransformation of dietary flavan-3-ols and the bioactivity of their metabolites. Food Funct. 2010, 1, 233–253. [Google Scholar] [CrossRef] [PubMed]
- Bowey, E.; Adlercreutz, H.; Rowland, I. Metabolism of isoflavones and lignans by the gut microflora: A study in germ-free and human flora associated rats. Food Chem. Toxicol. 2003, 41, 631–636. [Google Scholar] [CrossRef] [PubMed]
- Luca, S.V.; Macovei, I.; Bujor, A.; Miron, A.; Skalicka-Wozniak, K.; Aprotosoaie, A.C.; Trifan, A. Bioactivity of dietary polyphenols: The role of metabolites. Crit. Rev. Food Sci. Nutr. 2020, 60, 626–659. [Google Scholar] [CrossRef] [PubMed]
- Vissiennon, C.; Nieber, K.; Kelber, O.; Butterweck, V. Route of administration determines the anxiolytic activity of the flavonols kaempferol, quercetin and myricetin—Are they prodrugs? J. Nutr. Biochem. 2012, 23, 733–740. [Google Scholar] [CrossRef]
- Alvarez-Cilleros, D.; Angeles Martin, M.; Ramos, S. Protective effects of (-)-epicatechin and the colonic metabolite 3,4-dihydroxyphenylacetic acid against glucotoxicity-induced insulin signalling blockade and altered glucose uptake and production in renal tubular NRK-52E cells. Food Chem. Toxicol. 2018, 120, 119–128. [Google Scholar] [CrossRef]
- Alvarez-Cilleros, D.; Angeles Martin, M.; Goya, L.; Ramos, S. (-)-Epicatechin and the colonic metabolite 3,4-dihydroxyphenylacetic acid protect renal proximal tubular cell against high glucose-induced oxidative stress by modulating NOX-4/SIRT-1 signalling. J. Funct. Foods 2018, 46, 19–28. [Google Scholar] [CrossRef]
- Alvarez Cilleros, D.; Elvira Lopez-Oliva, M.; Angeles Martin, M.; Ramos, S. (-)-Epicatechin and the colonic metabolite 2,3-dihydroxybenzoic acid protect against high glucose and lipopolysaccharide-induced inflammation in renal proximal tubular cells through NOX-4/p38 signalling. Food Funct. 2020, 11, 8811–8824. [Google Scholar] [CrossRef]
- Lee, J.; Song, J.H.; Chung, M.Y.; Lee, J.H.; Nam, T.G.; Park, J.H.; Hwang, J.T.; Choi, H.K. 3,4-dihydroxytoluene, a metabolite of rutin, suppresses the progression of nonalcoholic fatty liver disease in mice by inhibiting p300 histone acetyltransferase activity. Acta Pharmacol. Sin. 2021, 42, 1449–1460. [Google Scholar] [CrossRef]
- Gao, Y.X.; Tian, R.R.; Liu, H.Y.; Xue, H.M.; Zhang, R.Z.; Han, S.P.; Ji, L.; Huang, W.D.; Zhan, J.C.; You, Y.L. Research progress on intervention effect and mechanism of protocatechuic acid on nonalcoholic fatty liver disease. Crit. Rev. Food Sci. Nutr. 2021, 2021, 9053–9075. [Google Scholar] [CrossRef] [PubMed]
- Ke, W.X.; Wang, P.; Wang, X.H.; Zhou, X.L.; Hu, X.S.; Chen, F. Dietary Platycodon grandiflorus Attenuates Hepatic Insulin Resistance and Oxidative Stress in High-Fat-Diet Induced Non-Alcoholic Fatty Liver Disease. Nutrients 2020, 12, 480. [Google Scholar] [CrossRef] [PubMed]
- Kleiner, D.E.; Brunt, E.M.; Van Natta, M.; Behling, C.; Contos, M.J.; Cummings, O.W.; Ferrell, L.D.; Liu, Y.C.; Torbenson, M.S.; Unalp-Arida, A.; et al. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 2005, 41, 1313–1321. [Google Scholar] [CrossRef] [PubMed]
- Loomba, R.; Friedman, S.L.; Shulman, G.I. Mechanisms and disease consequences of nonalcoholic fatty liver disease. Cell 2021, 184, 2537–2564. [Google Scholar] [CrossRef] [PubMed]
- Tejada, S.; Capo, X.; Mascaro, C.M.; Monserrat-Mesquida, M.; Quetglas-Llabres, M.M.; Pons, A.; Tur, J.A.; Sureda, A. Hepatoprotective Effects of Resveratrol in Non-Alcoholic Fatty Live Disease. Curr. Pharm. Des. 2021, 27, 2558–2570. [Google Scholar] [CrossRef]
- Yang, J.P.; Guo, Y.Q.; Henning, S.M.; Chan, B.; Long, J.F.; Zhong, J.; Acin-Perez, R.; Petcherski, A.; Shirihai, O.; Heber, D.; et al. Ellagic Acid and Its Microbial Metabolite Urolithin A Alleviate Diet-Induced Insulin Resistance in Mice. Mol. Nutr. Food Res. 2020, 64, e2000091. [Google Scholar] [CrossRef]
- Cueva, C.; Victoria Moreno-Arribas, M.; Martin-Alvarez, P.J.; Bills, G.; Francisca Vicente, M.; Basilio, A.; Lopez Rivas, C.; Requena, T.; Rodriguez, J.M.; Bartolome, B. Antimicrobial activity of phenolic acids against commensal, probiotic and pathogenic bacteria. Res. Microbiol. 2010, 161, 372–382. [Google Scholar] [CrossRef]
- Hodson, L.; Gunn, P.J. The regulation of hepatic fatty acid synthesis and partitioning: The effect of nutritional state. Nat. Rev. Endocrinol. 2019, 15, 689–700. [Google Scholar] [CrossRef]
- Sinha, R.A.; Singh, B.K.; Yen, P.M. Direct effects of thyroid hormones on hepatic lipid metabolism. Nat. Rev. Endocrinol. 2018, 14, 259–269. [Google Scholar] [CrossRef]
- Wang, P.; Li, D.; Ke, W.; Liang, D.; Hu, X.; Chen, F. Resveratrol-induced gut microbiota reduces obesity in high-fat diet-fed mice. Int. J. Obes. 2020, 44, 213–225. [Google Scholar] [CrossRef]
- Li, H.; Yu, X.H.; Ou, X.; Ouyang, X.P.; Tang, C.K. Hepatic cholesterol transport and its role in non-alcoholic fatty liver disease and atherosclerosis. Prog. Lipid Res. 2021, 83, 101109. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
---|---|---|
cd36 | GCCAAGCTATTGCGACATGA | GGCATTGGCTGGAAGAACAA |
fabp1 | TGGTCAGCTGTGGAAAGGAA | TCCTGGCTCTGCAATTGGTA |
slc27a5 | CGCGTAGGAGACCTGTACTT | AACACACTCCACCTCTCCAG |
cpt1a | CATATTCAGGCAGCGAGAGC | AGGTTTGAGTTCCTCACGGT |
acadm | GAAAGCTGCTAGTGGAGCAC | CTGGTAACTGAGCCTAGCGA |
pdk4 | GATGCTCTGTGCCTTTCCTG | TGCGACTCAGGCCTCATAAT |
pparg | GGAAGACCACTCGCATTCCT | GTAATCAGCAACCATTGGGTCA |
abca1 | CAGGAAGCACGTGTCTGAAG | GTGGTCTCCGAGATGCCATA |
abcg5 | CCGCGGACTTCTACAACAAG | TGTGGTTGGCTCATCTAGCA |
abcg8 | GAAGGCACAGTCTCTTGCAG | AGTCAGTGTCCTGTGTGAGG |
ldlr | GAACTCAGGGCCTCTGTCTG | AGCAGGCTGGATGTCTCTGT |
scarb1 | TTGGCCTGTTTGTTGGGATG | ATCGATCTTGCTGAGTCCGT |
gapdh | AACGGATTTGGCCGTATTGG | CATTCTCGGCCTTGACTGTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, J.; Wang, P.; Cui, Y.; Hu, X.; Chen, F.; Ma, C. Alleviation Effects of Microbial Metabolites from Resveratrol on Non-Alcoholic Fatty Liver Disease. Foods 2023, 12, 94. https://doi.org/10.3390/foods12010094
Guo J, Wang P, Cui Y, Hu X, Chen F, Ma C. Alleviation Effects of Microbial Metabolites from Resveratrol on Non-Alcoholic Fatty Liver Disease. Foods. 2023; 12(1):94. https://doi.org/10.3390/foods12010094
Chicago/Turabian StyleGuo, Jingling, Pan Wang, Yifan Cui, Xiaosong Hu, Fang Chen, and Chen Ma. 2023. "Alleviation Effects of Microbial Metabolites from Resveratrol on Non-Alcoholic Fatty Liver Disease" Foods 12, no. 1: 94. https://doi.org/10.3390/foods12010094
APA StyleGuo, J., Wang, P., Cui, Y., Hu, X., Chen, F., & Ma, C. (2023). Alleviation Effects of Microbial Metabolites from Resveratrol on Non-Alcoholic Fatty Liver Disease. Foods, 12(1), 94. https://doi.org/10.3390/foods12010094