Mitigating Response of SlCSE06 Induced by 2-Ethylfuran to Botrytis cinerea Infection
Abstract
1. Introduction
2. Results
2.1. The Identification, Chromosomal Distribution, and Physicochemical Properties of the SlCSE Family Members
2.2. Proteins Encoded by the SlCSE Family Members
2.3. Phylogenetic and Evolutionary Analyses of the CSE Family
2.4. Gene Structure and Conserved Protein Motifs and Promoter Cis-Acting Elements in the SlCSE Family Members
2.5. Collinearity and Selection Pressure Analyses of the CSE Families
2.6. Tomato Transcription Factor and CSE Family Regulatory Network
2.7. Analysis of the Expression Characteristics of SlCSE Family Members
2.7.1. Expression Analysis of the SlCSE Family Members Across Various Tissues
2.7.2. Effects of 2-Ethylfuran Treatments on SlCSE Family Members Expression Profiles During Post-Harvest Botrytis cinerea Infection
2.8. SlCSE06 Cloning and the Establishment of OE6 Tomato Plants
2.9. The SlCSE06 Expression Pattern in Response to Botrytis cinerea Infection
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Methods
4.2.1. Botrytis cinerea Strain Cultivation and Spore Suspension Preparation
4.2.2. Tomato Fruit Treatments
4.2.3. Identification and Chromosomal Localization of SlCSE Family Members
4.2.4. Physicochemical Property, Structural Characteristic, and Subcellular Localization Predictions for Tomato CSE Proteins
4.2.5. SlCSE Family Members Phylogenetic Analysis, Gene Structures, and Conserved Motif and Promoter Cis-Acting Element Predictions
4.2.6. Analysis of CSE Collinearity Across Multiple Species and Replication Events Within the SlCSE Family Members
4.2.7. Identification of Upstream Transcription Factors Regulating SlCSEs
4.2.8. Analysis of SlCSE Family Members’ Expression Characteristics
4.2.9. Analysis of SlCSE Family Members’ Expression Profiles in Post-Harvest Botrytis cinerea-Infected Tomato After 2-Ethylfuran Treatment
4.2.10. SlCSE06 Cloning, Overexpression Vector Construction, and Genetic Transformations
4.2.11. Identification of SlCSE06-Overexpressing Plants
4.2.12. SlCSE06 Expression Patterns in Response to Botrytis cinerea Infection
4.2.13. Lignin Content Determination
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Zhang, L.; Liu, Y.; Huang, Y.; Zhang, Y.; Fu, Y.; Xiao, Y.; Chen, S.; Zhang, K.; Cheng, F. SolPGD: Solanaceae Pan-Genomes Reveal Extensive Fractionation and Functional Innovation of Duplicated Genes. Plant Commun. 2024, 101231. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Zhu, X.; Gong, X.; Mei, Z.; Zhu, B. Research Advance of Molecular Marker-Assisted Selectionin Tomato Disease Resistance Breeding in China. Acta Agric. Zhejiangensis 2017, 29, 1415–1420. [Google Scholar] [CrossRef]
- Zhou, J.; Li, T.; Liu, R.; Li, C.; Yuan, Z.; Li, J. Effects of Air Humidity and Soil Water Content Coupling on Tomato Gray Mold. Acta Hortic. Sin. 2023, 50, 1779–1792. [Google Scholar] [CrossRef]
- Ma, Q.; Xu, Y.; Xiao, H.; Mariga, A.M.; Chen, Y.; Zhang, X.; Wang, L.; Li, D.; Li, L.; Luo, Z. Rethinking of Botanical Volatile Organic Compounds Applied in Food Preservation: Challenges in Acquisition, Application, Microbial Inhibition and Stimulation. Trends Food Sci. Technol. 2022, 125, 166–184. [Google Scholar] [CrossRef]
- Nawrocka, J.; Szymczak, K.; Skwarek-Fadecka, M.; Małolepsza, U. Toward the Analysis of Volatile Organic Compounds from Tomato Plants (Solanum lycopersicum L.) Treated with Trichoderma Virens or/and Botrytis cinerea. Cells 2023, 12, 1271. [Google Scholar] [CrossRef]
- Liu, K.; Liu, W.; Huang, X.; Liu, Y.; Cui, X.; Zhang, Z.; Li, B.; El-Mogy, M.M.; Tian, S.; Chen, T. Identification of Virulence-Related Proteins during Botrytis cinerea—Fruit Interaction at Early Phase. Postharvest Biol. Technol. 2023, 204, 112443. [Google Scholar] [CrossRef]
- Kang, L.; Zhang, X.; Liu, X.; Wang, R.; Liu, C.; Zhou, J.; Liu, Z.; Yuan, S. Comparative Study of β-Glucan-Degrading Enzymes from Coprinopsis cinerea for Their Capacities to Induce Stipe Cell Wall Extension. Int. J. Biol. Macromol. 2020, 152, 516–524. [Google Scholar] [CrossRef]
- Yang, C.; Liang, Y.; Qiu, D.; Zeng, H.; Yuan, J.; Yang, X. Lignin Metabolism Involves Botrytis cinerea BcGs1-Induced Defense Response in Tomato. BMC Plant Biol. 2018, 18, 103. [Google Scholar] [CrossRef]
- Cesarino, I. Structural Features and Regulation of Lignin Deposited upon Biotic and Abiotic Stresses. Curr. Opin. Biotechnol. 2019, 56, 209–214. [Google Scholar] [CrossRef]
- Liu, Q.; Luo, L.; Zheng, L. Lignins: Biosynthesis and Biological Functions in Plants. Int. J. Mol. Sci. 2018, 19, 335. [Google Scholar] [CrossRef]
- Deng, Y.; Lu, S. Biosynthesis and Regulation of Phenylpropanoids in Plants. Crit. Rev. Plant Sci. 2017, 36, 257–290. [Google Scholar] [CrossRef]
- Wang, X.; Chao, N.; Zhang, A.; Kang, J.; Jiang, X.; Gai, Y. Systematic Analysis and Biochemical Characterization of the Caffeoyl Shikimate Esterase Gene Family in Poplar. Int. J. Mol. Sci. 2021, 22, 13366. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Tao, X.; Xie, Z.; Gong, X.; Qi, K.; Zhang, S.; Shiratake, K.; Tao, S. PbCSE1 Promotes Lignification during Stone Cell Development in Pear (Pyrus bretschneideri) Fruit. Sci. Rep. 2021, 11, 9450. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.; He, J.; Liu, L.; Zhao, H.; Zhang, M.; Hong, J.; Meng, X.; Fan, H. Characterization of Caffeoyl Shikimate Esterase Gene Family Identifies CsCSE5 as a Positive Regulator of Podosphaera xanthii and Corynespora cassiicola Pathogen Resistance in Cucumber. Plant Cell Rep. 2023, 42, 1937–1950. [Google Scholar] [CrossRef] [PubMed]
- Ha, C.M.; Escamilla-Trevino, L.; Yarce, J.C.S.; Kim, H.; Ralph, J.; Chen, F.; Dixon, R.A. An Essential Role of Caffeoyl Shikimate Esterase in Monolignol Biosynthesis in Medicago truncatula. Plant J. 2016, 86, 363–375. [Google Scholar] [CrossRef]
- Vanholme, R.; Cesarino, I.; Rataj, K.; Xiao, Y.; Sundin, L.; Goeminne, G.; Kim, H.; Cross, J.; Morreel, K.; Araujo, P.; et al. Caffeoyl Shikimate Esterase (CSE) Is an Enzyme in the Lignin Biosynthetic Pathway in Arabidopsis. Science 2013, 341, 1103–1106. [Google Scholar] [CrossRef]
- Vargas, L.; Cesarino, I.; Vanholme, R.; Voorend, W.; de Lyra Soriano Saleme, M.; Morreel, K.; Boerjan, W. Improving Total Saccharification Yield of Arabidopsis Plants by Vessel-Specific Complementation of Caffeoyl Shikimate Esterase (Cse) Mutants. Biotechnol. Biofuels 2016, 9, 139. [Google Scholar] [CrossRef]
- de Vries, L.; Brouckaert, M.; Chanoca, A.; Kim, H.; Regner, M.R.; Timokhin, V.I.; Sun, Y.; De Meester, B.; Van Doorsselaere, J.; Goeminne, G.; et al. CRISPR-Cas9 Editing of CAFFEOYL SHIKIMATE ESTERASE 1 and 2 Shows Their Importance and Partial Redundancy in Lignification in Populus tremula × P. alba. Plant Biotechnol. J. 2021, 19, 2221–2234. [Google Scholar] [CrossRef]
- Kim, J.Y.; Cho, K.H.; Keene, S.A.; Colquhoun, T.A. Altered Profile of Floral Volatiles and Lignin Content by Down-Regulation of Caffeoyl Shikimate Esterase in Petunia. BMC Plant Biol. 2023, 23, 210. [Google Scholar] [CrossRef]
- Yu, Y.; Yu, Y.; Cui, N.; Ma, L.; Tao, R.; Ma, Z.; Meng, X.; Fan, H. Lignin Biosynthesis Regulated by CsCSE1 Is Required for Cucumis sativus Defence to Podosphaera xanthii. Plant Physiol. Biochem. PPB 2022, 186, 88–98. [Google Scholar] [CrossRef]
- Li, Q.; Song, J.; Peng, S.; Wang, J.P.; Qu, G.-Z.; Sederoff, R.R.; Chiang, V.L. Plant Biotechnology for Lignocellulosic Biofuel Production. Plant Biotechnol. J. 2014, 12, 1174–1192. [Google Scholar] [CrossRef] [PubMed]
- Deng, Y.; Niu, J.; Li, M. Characterization and Expression Patterns of the CSE Gene Family in Eucalyptus urophylla × E. grandis. Mol. Plant Breed. 2022; accepted. [Google Scholar]
- Yu, M.; Song, S. Biological Functions of Protein Fatty Acylation in Plant Cells. Biotechnol. Bull. 2019, 35, 170–177. [Google Scholar] [CrossRef]
- Jiang, Z.; Wang, M.; Nicolas, M.; Ogé, L.; Pérez-Garcia, M.-D.; Crespel, L.; Li, G.; Ding, Y.; Le Gourrierec, J.; Grappin, P.; et al. Glucose-6-Phosphate Dehydrogenases: The Hidden Players of Plant Physiology. Int. J. Mol. Sci. 2022, 23, 16128. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Lee, C.; Zhong, R.; Ye, Z.-H. MYB58 and MYB63 Are Transcriptional Activators of the Lignin Biosynthetic Pathway during Secondary Cell Wall Formation in Arabidopsis. Plant Cell 2009, 21, 248–266. [Google Scholar] [CrossRef]
- Xiao, R.; Zhang, C.; Guo, X.; Li, H.; Lu, H. MYB Transcription Factors and Its Regulation in Secondary Cell Wall Formation and Lignin Biosynthesis during Xylem Development. Int. J. Mol. Sci. 2021, 22, 3560. [Google Scholar] [CrossRef]
- Dong, N.-Q.; Lin, H.-X. Contribution of Phenylpropanoid Metabolism to Plant Development and Plant–Environment Interactions. J. Integr. Plant Biol. 2021, 63, 180–209. [Google Scholar] [CrossRef]
- Wang, Q.; Wang, X.; Li, H.; Yang, X.; Zhang, R.; Gong, B.; Li, X.; Shi, Q. Effects of Linalool on Botrytis cinerea Growth and Controlof Tomato Gray Mold. Chin. J. Appl. Ecol. 2023, 34, 213–220. [Google Scholar] [CrossRef]
- Lee, M.; Jeon, H.S.; Kim, S.H.; Chung, J.H.; Roppolo, D.; Lee, H.; Cho, H.J.; Tobimatsu, Y.; Ralph, J.; Park, O.K. Lignin-based Barrier Restricts Pathogens to the Infection Site and Confers Resistance in Plants. EMBO J. 2019, 38, e101948. [Google Scholar] [CrossRef]
- Jeon, H.S.; Jang, E.; Kim, J.; Kim, S.H.; Lee, M.-H.; Nam, M.H.; Tobimatsu, Y.; Park, O.K. Pathogen-Induced Autophagy Regulates Monolignol Transport and Lignin Formation in Plant Immunity. Autophagy 2023, 19, 597–615. [Google Scholar] [CrossRef]
- Reiser, L.; Bakker, E.; Subramaniam, S.; Chen, X.; Sawant, S.; Khosa, K.; Prithvi, T.; Berardini, T.Z. The Arabidopsis Information Resource in 2024. Genetics 2024, 227, iyae027. [Google Scholar] [CrossRef]
- Goodstein, D.M.; Shu, S.; Howson, R.; Neupane, R.; Hayes, R.D.; Fazo, J.; Mitros, T.; Dirks, W.; Hellsten, U.; Putnam, N.; et al. Phytozome: A Comparative Platform for Green Plant Genomics. Nucleic Acids Res. 2012, 40, D1178–D1186. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A “One for All, All for One” Bioinformatics Platform for Biological Big-Data Mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef]
- Mistry, J.; Chuguransky, S.; Williams, L.; Qureshi, M.; Salazar, G.A.; Sonnhammer, E.L.L.; Tosatto, S.C.E.; Paladin, L.; Raj, S.; Richardson, L.J.; et al. Pfam: The Protein Families Database in 2021. Nucleic Acids Res. 2021, 49, D412–D419. [Google Scholar] [CrossRef]
- Prakash, A.; Jeffryes, M.; Bateman, A.; Finn, R.D. The HMMER Web Server for Protein Sequence Similarity Search. Curr. Protoc. Bioinform. 2017, 60, 3.15.1–3.15.23. [Google Scholar] [CrossRef]
- Wang, J.; Chitsaz, F.; Derbyshire, M.K.; Gonzales, N.R.; Gwadz, M.; Lu, S.; Marchler, G.H.; Song, J.S.; Thanki, N.; Yamashita, R.A.; et al. The Conserved Domain Database in 2023. Nucleic Acids Res. 2023, 51, D384–D388. [Google Scholar] [CrossRef]
- Letunic, I.; Khedkar, S.; Bork, P. SMART: Recent Updates, New Developments and Status in 2020. Nucleic Acids Res. 2020, 49, D458–D460. [Google Scholar] [CrossRef]
- Gasteiger, E.; Gattiker, A.; Hoogland, C.; Ivanyi, I.; Appel, R.D.; Bairoch, A. ExPASy: The Proteomics Server for in-Depth Protein Knowledge and Analysis. Nucleic Acids Res. 2003, 31, 3784–3788. [Google Scholar] [CrossRef]
- Geourjon, C.; Deléage, G. SOPMA: Significant Improvements in Protein Secondary Structure Prediction by Consensus Prediction from Multiple Alignments. Comput. Appl. Biosci. CABIOS 1995, 11, 681–684. [Google Scholar] [CrossRef]
- Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; de Beer, T.A.P.; Rempfer, C.; Bordoli, L.; et al. SWISS-MODEL: Homology Modelling of Protein Structures and Complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef]
- Horton, P.; Park, K.-J.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.J.; Nakai, K. WoLF PSORT: Protein Localization Predictor. Nucleic Acids Res. 2007, 35, W585–W587. [Google Scholar] [CrossRef]
- Fernandez-Pozo, N.; Menda, N.; Edwards, J.D.; Saha, S.; Tecle, I.Y.; Strickler, S.R.; Bombarely, A.; Fisher-York, T.; Pujar, A.; Foerster, H.; et al. The Sol Genomics Network (SGN)—From Genotype to Phenotype to Breeding. Nucleic Acids Res. 2015, 43, D1036–D1041. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Bailey, T.L.; Boden, M.; Buske, F.A.; Frith, M.; Grant, C.E.; Clementi, L.; Ren, J.; Li, W.W.; Noble, W.S. MEME SUITE: Tools for Motif Discovery and Searching. Nucleic Acids Res. 2009, 37, W202–W208. [Google Scholar] [CrossRef]
- Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a Database of Plant Cis-Acting Regulatory Elements and a Portal to Tools for in Silico Analysis of Promoter Sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
- Xie, J.; Chen, Y.; Cai, G.; Cai, R.; Hu, Z.; Wang, H. Tree Visualization By One Table (tvBOT): A Web Application for Visualizing, Modifying and Annotating Phylogenetic Trees. Nucleic Acids Res. 2023, 51, W587–W592. [Google Scholar] [CrossRef]
- Wang, Y.; Tang, H.; Debarry, J.D.; Tan, X.; Li, J.; Wang, X.; Lee, T.; Jin, H.; Marler, B.; Guo, H.; et al. MCScanX: A Toolkit for Detection and Evolutionary Analysis of Gene Synteny and Collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef]
- Grant, C.E.; Bailey, T.L.; Noble, W.S. FIMO: Scanning for Occurrences of a given Motif. Bioinformatics 2011, 27, 1017–1018. [Google Scholar] [CrossRef]
- Xue, J.-Y.; Fan, H.-Y.; Zeng, Z.; Zhou, Y.-H.; Hu, S.-Y.; Li, S.-X.; Cheng, Y.-J.; Meng, X.-R.; Chen, F.; Shao, Z.-Q.; et al. Comprehensive Regulatory Networks for Tomato Organ Development Based on the Genome and RNAome of MicroTom Tomato. Hortic. Res. 2023, 10, uhad147. [Google Scholar] [CrossRef]
- Clevenger, J.P.; Van Houten, J.; Blackwood, M.; Rodríguez, G.R.; Jikumaru, Y.; Kamiya, Y.; Kusano, M.; Saito, K.; Visa, S.; van der Knaap, E. Network Analyses Reveal Shifts in Transcript Profiles and Metabolites That Accompany the Expression of SUN and an Elongated Tomato Fruit. Plant Physiol. 2015, 168, 1164–1178. [Google Scholar] [CrossRef]
- Silva, C.J.; Adaskaveg, J.A.; Mesquida-Pesci, S.D.; Ortega-Salazar, I.B.; Pattathil, S.; Zhang, L.; Hahn, M.G.; van Kan, J.A.L.; Cantu, D.; Powell, A.L.T.; et al. Botrytis cinerea Infection Accelerates Ripening and Cell Wall Disassembly to Promote Disease in Tomato Fruit. Plant Physiol. 2023, 191, 575–590. [Google Scholar] [CrossRef]











| Gene Name | Gene ID | Number of Amino Acids (aa) | Molecular Weight (MW/Da) | Theoretical pI | Instability Index | Aliphatic Index | GRAV-Y | Signal Peptide | Subcellular Localization | Transmem -Brane Region |
|---|---|---|---|---|---|---|---|---|---|---|
| SlCSE01 | Solyc02T000800.1 | 394 | 44,478.48 | 7.65 | 38.06 | 90.86 | −0.235 | No | chlo | outside |
| SlCSE02 | Solyc02T000803.1 | 266 | 30,136.47 | 9.17 | 39.42 | 92.03 | −0.085 | No | cyto | outside |
| SlCSE03 | Solyc02T001193.1 | 319 | 36,048.72 | 8.4 | 48.2 | 88.37 | −0.223 | No | cyto | outside |
| SlCSE04 | Solyc02T002201.1 | 178 | 20,378.91 | 9.05 | 42.46 | 92.02 | −0.058 | No | cyto | outside |
| SlCSE05 | Solyc02T002203.1 | 343 | 38,511.2 | 5.8 | 35.45 | 91.22 | −0.187 | No | nucl | outside |
| SlCSE06 | Solyc03T003294.1 | 327 | 36,292.32 | 5.91 | 29.86 | 71.68 | −0.258 | No | mito | outside |
| SlCSE07 | Solyc04T000407.1 | 319 | 36,518.14 | 6.38 | 27.44 | 81.88 | −0.36 | No | cyto | outside |
| SlCSE08 | Solyc05T000443.1 | 397 | 44,649.59 | 8.82 | 39.93 | 90.68 | −0.253 | No | chlo | outside |
| SlCSE09 | Solyc05T002712.1 | 335 | 37,157.77 | 6.23 | 42.32 | 93.37 | −0.016 | No | cyto | outside |
| SlCSE10 | Solyc08T001425.1 | 404 | 45,164.77 | 8.99 | 52.75 | 91.73 | −0.096 | No | chlo | outside |
| SlCSE11 | Solyc09T002257.3 | 369 | 41,750.99 | 8.44 | 44.97 | 77.13 | −0.389 | No | cysk | outside |
| Genes | Sense Primer (5′ → 3′) F | Anti-Sense Primer (5′ → 3′) R |
|---|---|---|
| SlCSE01 (Solyc02T000800.1) | GAGAAGGCAAGTAGTTCGGACAAG | AGGAAGTATGCTCATCCAACCAAG |
| SlCSE02 (Solyc02T000803.1) | AAAGTGGAAGCAAAGGCGTATCG | TCCTTCATCTTCAATCCAGCATGTG |
| SlCSE03 (Solyc02T001193.1) | TCACGGTTACTCAGAAGGCTCAC | GCACCACCTAATGACTCACCATAC |
| SlCSE04 (Solyc02T002201.1) | GTACTGTTCTTCTTGCTCCTCTGTG | ACTGCCGTCTCTCCTAAATCCTG |
| SlCSE05 (Solyc02T002203.1) | GCCAGAGTTCCGTAATCTACCAAG | AACAGCACCGTTCCAAGAATTAGG |
| SlCSE06 (Solyc03T003294.1) | GAAGGCAAGCAGTGAGGACAAG | ACAATAGCAACAGCATCGTCAGG |
| SlCSE07 (Solyc04T000407.1) | CCATCTGTAAGCAAACTCCTCCAC | GCCACACTACAATGTCCGAGAAC |
| SlCSE08 (Solyc05T000443.1) | TGGAGCAGACGATAGAGTGACAG | AGCACAGTAAGAATCCGATCATCAG |
| SlCSE09 (Solyc05T002712.1) | GTAGCAGAAGCGAACGAGTTGAG | GTTGTGAGTTACTGAGTGGTGAGAG |
| SlCSE10 (Solyc08T001425.1) | CTCCTCCGCCTTCGCCATC | CACCGTCATTCTCAACCGTCATATC |
| SlCSE11 (Solyc09T002257.3) | TATACGAGCAAGCGAGTAGCA | AGCATCACCAGTATTCTCTCCAT |
| ACTIN | GTCCTCTTCCAGCCATCCAT | ACCACTGAGCACAATGTTACCG |
| Primer Name | Sense Primer (5′ → 3′) |
|---|---|
| p1302-SlCSE06-F | GGACTCTTGACCATGGATGGCGTCGGAAGCTCCG |
| p1302-SlCSE06-R | CTTCTCCTTTACTAGTTGCAGAGCCATTGATTTTTGGAC |
| Primer Name | Sense Primer (5′ → 3′) |
|---|---|
| p1302 35s-F | GTGGATTGATGTGATATCTCC |
| p1302 mGFP-R | CTGACAGAAAATTTGTGCCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ye, H.; Gao, H.; Li, J.; Lu, L.; Zheng, S.; Wu, C.; Jin, Y.; Cao, C.; Zhu, H.; Liu, S.; et al. Mitigating Response of SlCSE06 Induced by 2-Ethylfuran to Botrytis cinerea Infection. Plants 2025, 14, 575. https://doi.org/10.3390/plants14040575
Ye H, Gao H, Li J, Lu L, Zheng S, Wu C, Jin Y, Cao C, Zhu H, Liu S, et al. Mitigating Response of SlCSE06 Induced by 2-Ethylfuran to Botrytis cinerea Infection. Plants. 2025; 14(4):575. https://doi.org/10.3390/plants14040575
Chicago/Turabian StyleYe, Huilan, Hongdou Gao, Jinnian Li, Linye Lu, Shilan Zheng, Chengxin Wu, Youliang Jin, Chengjuan Cao, Haisheng Zhu, Shuang Liu, and et al. 2025. "Mitigating Response of SlCSE06 Induced by 2-Ethylfuran to Botrytis cinerea Infection" Plants 14, no. 4: 575. https://doi.org/10.3390/plants14040575
APA StyleYe, H., Gao, H., Li, J., Lu, L., Zheng, S., Wu, C., Jin, Y., Cao, C., Zhu, H., Liu, S., & Zhong, F. (2025). Mitigating Response of SlCSE06 Induced by 2-Ethylfuran to Botrytis cinerea Infection. Plants, 14(4), 575. https://doi.org/10.3390/plants14040575
