Staphylococcus capitis Bloodstream Isolates: Investigation of Clonal Relationship, Resistance Profile, Virulence and Biofilm Formation
Abstract
:1. Introduction
2. Results
2.1. Characterization of the Isolates
2.2. Resistance Profile
2.3. Biofilm Production
2.4. Detection of Enterotoxin and Hemolysin Genes
2.5. Clonal Profile
3. Discussion
4. Materials and Methods
4.1. Sample Collection
4.2. Isolation and Identification of S. capitis
4.3. Phenotypic Antimicrobial Susceptibility Testing
4.4. Detection of the mecA Methicillin Resistance Gene
4.5. Staphylococcal Cassette Chromosome mec Typing
4.6. Detection of Hemolysin and Staphylococcal Enteroxin Genes
4.7. Detection of Genes Involved in Biofilm Formation
4.8. Investigation of Biofilm Production by the Polystyrene Plate Adherence Method
4.9. Identification of the Clonal Profile by Pulsed-Field Gel Electrophoresis
4.10. Visualization of Amplified Products
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kloos, W.E.; Schleifer, K.H. Isolation and Characterization of Staphylococci from Human Skin II. Descriptions of Four New Species: Staphylococcus warneri, Staphylococcus capitis, Staphylococcus hominis, and Staphylococcus simulans. Int. J. Syst. Bacteriol. 1975, 25, 62–79. [Google Scholar] [CrossRef]
- Chong, C.E.; Bengtsson, R.J.; Horsburgh, M.J. Comparative genomics of Staphylococcus capitis reveals species determinants. Front. Microbiol. 2022, 13, 1005949. [Google Scholar] [CrossRef]
- Tevell, S.; Baig, S.; Hellmark, B.; Martins Simoes, P.; Wirth, T.; Butin, M.; Nilsdotter-Augustinsson, Å.; Söderquist, B.; Stegger, M. Presence of the Neonatal Staphylococcus capitis Outbreak Clone (NRCS-A) in Prosthetic Joint Infections. Sci. Rep. 2020, 10, 22389. [Google Scholar] [CrossRef]
- Flurin, L.; Greenwood-Quaintance, K.E.; Patel, R. Microbiology of Polymicrobial Prosthetic Joint Infection. Diagn. Microbiol. Infect. Dis. 2019, 94, 255–259. [Google Scholar] [CrossRef]
- Al Hennawi, H.E.T.; Mahdi, E.M.; Memish, Z.A. Native Valve Staphylococcus capitis Infective Endocarditis: A Mini Review. Infection 2020, 48, 3–5. [Google Scholar] [CrossRef]
- Nalmas, S.; Bishburg, E.; Meurillio, J.; Khoobiar, S.; Cohen, M. Staphylococcus capitis Prosthetic Valve Endocarditis: Report of Two Rare Cases and Review of Literature. Heart Lung J. Acute Crit. Care 2008, 37, 380–384. [Google Scholar] [CrossRef]
- Cone, L.A.; Sontz, E.M.; Wilson, J.W.; Mitruka, S.N. Staphylococcus capitis Endocarditis Due to a Transvenous Endocardial Pacemaker Infection: Case Report and Review of Staphylococcus capitis Endocarditis. Int. J. Infect. Dis. 2005, 9, 335–339. [Google Scholar] [CrossRef]
- Azimi, T.; Mirzadeh, M.; Sabour, S.; Nasser, A.; Fallah, F.; Pourmand, M.R. Coagulase-Negative Staphylococci (CoNS) Meningitis: A Narrative Review of the Literature from 2000 to 2020. New Microbes New Infect. 2020, 37, 100755. [Google Scholar] [CrossRef]
- Rasigade, J.P.; Raulin, O.; Picaud, J.C.; Tellini, C.; Bes, M.; Grando, J.; Ben Saïd, M.; Claris, O.; Etienne, J.; Tigaud, S.; et al. Methicillin-Resistant Staphylococcus capitis with Reduced Vancomycin Susceptibility Causes Late-Onset Sepsis in Intensive Care Neonates. PLoS ONE 2012, 7, e31548. [Google Scholar] [CrossRef]
- Cui, B.; Smooker, P.M.; Rouch, D.A.; Daley, A.J.; Deighton, M.A. Differences between Two Clinical Staphylococcus capitis Subspecies as Revealed by Biofilm, Antibiotic Resistance, and Pulsed-Field Gel Electrophoresis Profiling. J. Clin. Microbiol. 2013, 51, 9–14. [Google Scholar] [CrossRef]
- Carter, G.P.; Ussher, J.E.; Da Silva, A.G.; Baines, S.L.; Heffernan, H.; Riley, T.V.; Broadbent, R.; Van Der Linden, A.; Lee, J.; Monk, I.R.; et al. Genomic Analysis of Multiresistant Staphylococcus capitis Associated with Neonatal Sepsis. Antimicrob. Agents Chemother. 2018, 62, 1–10. [Google Scholar] [CrossRef]
- Wirth, T.; Bergot, M.; Rasigade, J.P.; Pichon, B.; Barbier, M.; Martins-Simoes, P.; Jacob, L.; Pike, R.; Tissieres, P.; Picaud, J.C.; et al. Niche Specialization and Spread of Staphylococcus capitis Involved in Neonatal Sepsis. Nat. Microbiol. 2020, 5, 735–745. [Google Scholar] [CrossRef]
- Laurent, F.; Butin, M. Staphylococcus capitis and NRCS-A Clone: The Story of an Unrecognized Pathogen in Neonatal Intensive Care Units. Clin. Microbiol. Infect. 2019, 25, 1081–1085. [Google Scholar] [CrossRef]
- Butin, M.; Rasigade, J.; Meugnier, H.; Lemriss, H.; Goering, R.V.; Kearns, A.; Deighton, M.A. Wide Geographical Dissemination of the Multiresistant Staphylococcus capitis NRCS-A Clone in Neonatal Intensive-Care Units. Clin. Microbiol. Infect. 2016, 22, 46–52. [Google Scholar] [CrossRef]
- Chavignon, M.; Reboux, M.; Tasse, J.; Tristan, A.; Claris, O.; Laurent, F.; Butin, M. Persistent Microbial Contamination of Incubators despite Disinfection. Pediatr. Res. 2021, 90, 1215–1220. [Google Scholar] [CrossRef]
- Cameron, D.R.; Jiang, J.H.; Hassan, K.A.; Elbourne, L.D.H.; Tuck, K.L.; Paulsen, I.T.; Peleg, A.Y. Insights on Virulence from the Complete Genome of Staphylococcus capitis. Front. Microbiol. 2015, 6, 980. [Google Scholar] [CrossRef]
- Ma, X.X.; Wang, E.H.; Liu, Y.; Luo, E.J. Antibiotic Susceptibility of Coagulase-Negative staphylococci (CoNS): Emergence of Teicoplaninnon-Susceptible CoNS Strains with Inducible Resistance to Vancomycin. J. Med. Microbiol. 2011, 60, 1661–1668. [Google Scholar] [CrossRef]
- Uehara, Y. Current Status of Staphylococcal Cassette Chromosome mec (SCCmec). Antibiotics 2022, 11, 86. [Google Scholar] [CrossRef]
- Zong, Z.; Peng, C.; Lü, X. Diversity of SCCmec Elements in Methicillin-Resistant Coagulase-Negative Staphylococci Clinical Isolates. PLoS ONE 2011, 6, e20191. [Google Scholar] [CrossRef]
- Lakhundi, S.; Zhang, K. Methicillin-Resistant Staphylococcus aureus: Molecular Characterization, Evolution, and Epidemiology. Clin. Microbiol. Rev. 2018, 32, 10–1128. [Google Scholar] [CrossRef]
- Szczuka, E.; Krzymińska, S.; Bogucka, N.; Kaznowski, A. Multifactorial Mechanisms of the Pathogenesis of Methicillin-Resistant Staphylococcus hominis Isolated from Bloodstream Infections. Antonie Van Leeuwenhoek Int. J. Gen. Mol. Microbiol. 2018, 111, 1259–1265. [Google Scholar] [CrossRef]
- Chen, X.P.; Li, W.G.; Zheng, H.; Du, H.Y.; Zhang, L.; Zhang, L.; Che, J.; Wu, Y.; Liu, S.M.; Lu, J.X. Extreme Diversity and Multiple SCCmec Elements in Coagulase-Negative Staphylococcus Found in the Clinic and Community in Beijing, China. Ann. Clin. Microbiol. Antimicrob. 2017, 16, 57. [Google Scholar] [CrossRef]
- Machado, A.B.M.P.; Reiter, K.C.; Paiva, R.M.; Barth, A.L. Distribution of Staphylococcal Cassette Chromosome mec (SCCmec) Types I, II, III and IV in Coagulase-Negative Staphylococci from Patients Attending a Tertiary Hospital in Southern Brazil. J. Med. Microbiol. 2007, 56, 1328–1333. [Google Scholar] [CrossRef]
- Becker, K.; Heilmann, C.; Peters, G. Coagulase-Negative Staphylococci. Clin. Microbiol. Rev. 2014, 27, 870–926. [Google Scholar] [CrossRef]
- Simões, P.M.; Lemriss, H.; Dumont, Y.; Lemriss, S.; Rasigade, J.P.; Assant-Trouillet, S.; Ibrahimi, A.; El Kabbaj, S.; Butin, M.; Laurent, F. Single-Molecule Sequencing (PacBio) of the Staphylococcus capitis NRCS-A Clone Reveals the Basis of Multidrug Resistance and Adaptation to the Neonatal Intensive Care Unit Environment. Front. Microbiol. 2016, 7, 1991. [Google Scholar] [CrossRef]
- Suja, K.R.S.; Sheela, P.; Jyothis, S.; Radhakrishnan, E.K. Virulence Factors Associated with Coagulase Negative Staphylococci Isolated from Human Infections. 3 Biotech. 2017, 7, 140. [Google Scholar] [CrossRef]
- Greco-Stewart, V.S.; Ali, H.; Kumaran, D.; Kalab, M.; Rood, I.G.H.; de Korte, D.; Ramírez-Arcos, S. Biofilm Formation by Staphylococcus Capitis Strains Isolated from Contaminated Platelet Concentrates. J. Med. Microbiol. 2013, 62, 1051–1059. [Google Scholar] [CrossRef]
- Otto, M. Staphylococcal Biofilms. Curr. Top. Microbiol. Immunol. 2009, 19, 4. [Google Scholar] [CrossRef]
- França, A.; Gaio, V.; Lopes, N.; Melo, D.R. Virulence Factors in Coagulase-Negative Staphylococci. Pathogens 2021, 10, 170. [Google Scholar] [CrossRef]
- Chavignon, M.; Coignet, L.; Bonhomme, M.; Bergot, M.; Tristan, A.; Verhoeven, P.; Josse, J.; Laurent, F.; Butin, M. Environmental Persistence of Staphylococcus capitis NRCS-A in Neonatal Intensive Care Units: Role of Biofilm Formation, Desiccation, and Disinfectant Tolerance. Microbiol. Spectr. 2022, 10, e04215-22. [Google Scholar] [CrossRef]
- Sharma, D.; Misba, L.; Khan, A.U. Antibiotics versus Biofilm: An Emerging Battleground in Microbial Communities. Antimicrob. Resist. Infect. Control 2019, 8, 76. [Google Scholar] [CrossRef]
- Argemi, X.; Hansmann, Y.; Prola, K.; Pr, G. Coagulase-Negative Staphylococci Pathogenomics. Int. J. Mol. Sci. 2019, 20, 1215. [Google Scholar] [CrossRef]
- Podkowik, M.; Park, J.Y.; Seo, K.S.; Bystro, J.; Bania, J. Enterotoxigenic Potential of Coagulase-Negative Staphylococci. Int. J. Food Microbiol. 2013, 163, 34–40. [Google Scholar] [CrossRef]
- Barretti, P.; Montelli, A.C.; Batalha, J.E.N.; Caramori, J.C.T.; Cunha, M.D.L.R. The Role of Virulence Factors in the Outcome of Staphylococcal Peritonitis in CAPD Patients. BMC Infect. Dis. 2009, 9, 212. [Google Scholar] [CrossRef]
- Marrack, P.; Kappler, J. The Staphylococcal Enterotoxins and Their Relatives. Science 1990, 248, 705–711. [Google Scholar] [CrossRef]
- Xu, S.X.; McCormick, J.K. Staphylococcal Superantigens in Colonization and Disease. Front. Cell Infect. Microbiol. 2012, 2, 52. [Google Scholar] [CrossRef]
- D’Mello, D.; Daley, A.J.; Rahman, M.S.; Qu, Y.; Garland, S.; Pearce, C.; Deighton, M.A. Vancomycin Heteroresistance in Bloodstream Isolates of Staphylococcus capitis. J. Clin. Microbiol. 2008, 46, 3124–3126. [Google Scholar] [CrossRef]
- Song, M.; Li, Q.; He, Y.; Lan, L.; Feng, Z.; Fan, Y.; Liu, H.; Qin, F.; Chen, D.; Yang, M. A Comprehensive Multilocus Sequence Typing Scheme for Identification and Genotyping of Staphylococcus Strains. Foodborne Pathog. Dis. 2019, 16, 331–338. [Google Scholar] [CrossRef]
- Kondo, Y.; Ito, T.; Ma, X.X.; Watanabe, S.; Kreiswirth, B.N.; Etienne, J.; Hiramatsu, K. Combination of Multiplex PCRs for Staphylococcal Cassette Chromosome mec Type Assignment: Rapid Identification System for mec, ccr, and Major Differences in Junkyard Regions. Antimicrob. Agents Chemother. 2007, 51, 264–274. [Google Scholar] [CrossRef]
- Heath, V.; Cloutman-Green, E.; Watkin, S.; Karlikowska, M.; Ready, D.; Hatcher, J.; Pearce-Smith, N.; Brown, C.; Demirjian, A. Staphylococcus capitis: Review of Its Role in Infections and Outbreaks. Antibiotics 2023, 12, 669. [Google Scholar] [CrossRef]
- Trevisoli, L.E.; Bail, L.; Rodrigues, L.S.; Conte, D.; Palmeiro, J.K.; Dalla-Costa, L.M. Matrix-Assisted Laser Desorption Ionization-Time of Flight: A Promising Alternative Method of Identifying the Major Coagulase-Negative Staphylococci Species. Rev. Soc. Bras. Med. Trop. 2018, 51, 85–87. [Google Scholar] [CrossRef]
- Martins, K.B.; Ferreira, A.M.; Mondelli, A.L.; Rocchetti, T.T.; De Lr De S Da Cunha, M. Evaluation of MALDI-TOF VITEK®MS and VITEK® 2 System for the Identification of Staphylococcus saprophyticus. Future Microbiol. 2018, 13, 1603–1609. [Google Scholar] [CrossRef]
- Delmas, J.; Chacornac, J.P.; Robin, F.; Giammarinaro, P.; Talon, R.; Bonnet, R. Evaluation of the Vitek 2 System with a Variety of Staphylococcus Species. J. Clin. Microbiol. 2008, 46, 311–313. [Google Scholar] [CrossRef]
- Watanabe, S.; Aiba, Y.; Tan, X.E.; Li, F.Y.; Boonsiri, T.; Thitiananpakorn, K.; Cui, B.; Sato’O, Y.; Kiga, K.; Sasahara, T.; et al. Complete Genome Sequencing of Three Human Clinical Isolates of Staphylococcus caprae Reveals Virulence Factors Similar to Those of S. epidermidis and S. capitis. BMC Genom. 2018, 19, 810. [Google Scholar] [CrossRef]
- Pereira, V.C.; Romero, L.C.; Pinheiro-Hubinger, L.; Oliveira, A.; Martins, K.B.; Cunha, M.L.R.S. Coagulase-Negative Staphylococci: A 20-Year Study on the Antimicrobial Resistance Profile of Blood Culture Isolates from a Teaching Hospital. Braz. J. Infect. Dis. 2020, 24, 160–169. [Google Scholar] [CrossRef]
- Cui, J.; Liang, Z.; Mo, Z.; Zhang, J. The Species Distribution, Antimicrobial Resistance and Risk Factors for Poor Outcome of Coagulase-Negative Staphylococci Bacteraemia in China. Antimicrob. Resist. Infect. Control 2019, 8, 65. [Google Scholar] [CrossRef]
- Hirose, M.; Aung, M.S.; Fujita, Y.; Kato, T.; Hirose, Y.; Yahata, S.; Fukuda, A.; Saitoh, M.; Urushibara, N.; Kobayashi, N. Genetic Characterization of Staphylococcus aureus, Staphylococcus argenteus, and Coagulase-Negative Staphylococci Colonizing Oral Cavity and Hand of Healthy Adults in Northern Japan. Pathogens 2022, 11, 849. [Google Scholar] [CrossRef]
- Xu, Z.; Shah, H.N.; Misra, R.; Chen, J.; Zhang, W.; Liu, Y.; Cutler, R.R.; Mkrtchyan, H.V. The Prevalence, Antibiotic Resistance and mecA Characterization of Coagulase Negative Staphylococci Recovered from Non-Healthcare Settings in London, UK. Antimicrob. Resist. Infect. Control 2018, 7, 73. [Google Scholar] [CrossRef]
- Butin, M.; Dumont, Y.; Monteix, A.; Raphard, A.; Roques, C.; Martins Simoes, P.; Picaud, J.C.; Laurent, F. Sources and Reservoirs of Staphylococcus capitis NRCS-A inside a NICU. Antimicrob. Resist. Infect. Control 2019, 8, 157. [Google Scholar] [CrossRef]
- Montazeri, E.A.; Seyed-Mohammadi, S.; Dezfuli, A.A.; Khosravi, A.D.; Dastoorpoor, M.; Roointan, M.; Saki, M. Investigation of SCCmec Types I–IV in Clinical Isolates of Methicillin-Resistant Coagulase-Negative Staphylococci in Ahvaz, Southwest Iran. Biosci. Rep. 2020, 40, BSR20200847. [Google Scholar] [CrossRef] [PubMed]
- Mendoza-Olazarán, S.; Morfin-Otero, R.; Villarreal-Trevino, L.; Rodriguez-Noriega, E.; Llaca-Diaz, J.; Camacho-Ortiz, A.; González, G.M.; Casillas-Vega, N.; Garza-González, E. Antibiotic Susceptibility of Biofilm Cells and Molecular Characterisation of Staphylococcus hominis Isolates from Blood. PLoS ONE 2015, 10, e144684. [Google Scholar] [CrossRef]
- Al-Haqan, A.; Boswihi, S.S.; Pathan, S.; Udo, E.E. Antimicrobial Resistance and Virulence Determinants in Coagulase-Negative Staphylococci Isolated Mainly from Preterm Neonates. PLoS ONE 2020, 15, e0236713. [Google Scholar] [CrossRef]
- Pinheiro-Hubinger, L.; Riboli, D.F.M.; Abraão, L.M.; Pereira Franchi, E.P.L.; Ribeiro de Souza da Cunha, M.d.L. Coagulase-Negative Staphylococci Clones Are Widely Distributed in the Hospital and Community. Pathogens 2021, 10, 792. [Google Scholar] [CrossRef]
- Urushibara, N.; Aung, M.S.; Kawaguchiya, M.; Kobayashi, N. Novel Staphylococcal Cassette Chromosome mec (SCCmec) Type XIV (5A) and a Truncated SCCmec Element in SCC Composite Islands Carrying SpeG in ST5 MRSA in Japan. J. Antimicrob. Chemother. 2020, 75, 46–50. [Google Scholar] [CrossRef]
- Ito, T.; Ma, X.X.; Takeuchi, F.; Okuma, K.; Yuzawa, H.; Hiramatsu, K. Novel Type V Staphylococcal Cassette Chromosome mec Driven by a Novel Cassette Chromosome Recombinase, CcrC. Antimicrob. Agents Chemother. 2004, 48, 2637–2651. [Google Scholar] [CrossRef]
- Lim, Y.; Shin, H.J.; Kwon, A.S.; Reu, J.H.; Park, G.; Kim, J. Predictive Genetic Risk Markers for Strong Biofilm-Forming Staphylococcus aureus: FnbB Gene and SCCmec Type III. Diagn. Microbiol. Infect. Dis. 2013, 76, 539–541. [Google Scholar] [CrossRef]
- Da Fonseca Batistaõ, D.W.; de Campos, P.A.; Camilo, N.C.; Royer, S.; Araújo, B.F.; Naves, K.S.C.; Martins, M.; Pereira, M.O.; Henriques, M.; Gontijo-Filho, P.P.; et al. Biofilm Formation of Brazilian Methicillin-Resistant Staphylococcus aureus Strains: Prevalence of Biofilm Determinants and Clonal Profiles. J. Med. Microbiol. 2016, 65, 286–297. [Google Scholar] [CrossRef]
- Silva, V.; Correia, E.; Pereira, J.E.; González-Machado, C.; Capita, R.; Alonso-Calleja, C.; Igrejas, G.; Poeta, P. Exploring the Biofilm Formation Capacity in S. Pseudintermedius and Coagulase-Negative Staphylococci Species. Pathogens 2022, 11, 689. [Google Scholar] [CrossRef]
- Becker, K.; Both, A.; Weißelberg, S.; Heilmann, C.; Rohde, H. Emergence of Coagulase-Negative Staphylococci. Expert Rev. Anti-Infect. Ther. 2020, 18, 349–366. [Google Scholar] [CrossRef]
- Qu, Y.; Li, Y.; Cameron, D.R.; Easton, C.D.; Zhu, X.; Zhu, M.; Salwiczek, M.; Muir, B.W.; Thissen, H.; Daley, A.; et al. Hyperosmotic Infusion and Oxidized Surfaces Are Essential for Biofilm Formation of Staphylococcus capitis from the Neonatal Intensive Care Unit. Front. Microbiol. 2020, 11, 920. [Google Scholar] [CrossRef]
- Lade, H.; Park, J.H.; Chung, S.H.; Kim, I.H.; Kim, J.M.; Joo, H.S.; Kim, J.S. Biofilm Formation by Staphylococcus aureus Clinical Isolates Is Differentially Affected by Glucose and Sodium Chloride Supplemented Culture Media. J. Clin. Med. 2019, 8, 1853. [Google Scholar] [CrossRef]
- Jones, S.U.; Chew, C.H.; Yeo, C.C.; Abdullah, F.H.; Othman, N.; Kee, B.P.; Chua, K.H.; Puah, S.M. The Phenotypes and Genotypes Associated with Biofilm Formation among Methicillin-Susceptible Staphylococcus aureus (MSSA) Isolates Collected from a Tertiary Hospital in Terengganu, Malaysia. Int. Microbiol. 2023, 26, 841–849. [Google Scholar] [CrossRef] [PubMed]
- Tan, X.; Qin, N.; Wu, C.; Sheng, J.; Yang, R.; Zheng, B.; Ma, Z.; Liu, L.; Peng, X.; Jia, A. Transcriptome Analysis of the Biofilm Formed by Methicillin-Susceptible Staphylococcus aureus. Sci. Rep. 2015, 5, 11997. [Google Scholar] [CrossRef] [PubMed]
- Pinheiro, L.; Brito, C.I.; de Oliveira, A.; Martins, P.Y.F.; Pereira, V.C.; da Cunha, M. de L.R. de S. Staphylococcus epidermidis and Staphylococcus haemolyticus: Molecular Detection of Cytotoxin and Enterotoxin Genes. Toxins 2015, 7, 3688–3699. [Google Scholar] [CrossRef]
- Yang, C.; Anahtar, M.N.; Pierce, V.M. It’s Not You, It’s SOSA: A Case Study on Breaking up with an FDA-Cleared Susceptibility Testing System’s Oxacillin Results for Staphylococcus spp. Other than S. aureus and S. lugdunensis. Open Forum Infect. Dis. 2022, 9, ofac421. [Google Scholar] [CrossRef]
- Andrade-Figueiredo, M.; Leal-Balbino, T.C. Clonal Diversity and Epidemiological Characteristics of Staphylococcus Aureus: High Prevalence of Oxacillin-Susceptible mecA-Positive Staphylococcus aureus (OS-MRSA) Associated with Clinical Isolates in Brazil. BMC Microbiol. 2016, 16, 115. [Google Scholar] [CrossRef]
- Williams, M.C.; Dominguez, S.R.; Prinzi, A.; Lee, K.; Parker, S.K. Reliability of mecA in Predicting Phenotypic Susceptibilities of Coagulase-Negative Staphylococci and Staphylococcus aureus. Open Forum Infect. Dis. 2020, 7, ofaa553. [Google Scholar] [CrossRef]
- Ferreira, A.M.; Bonesso, M.F.; Mondelli, A.L.; Camargo, C.H.; Cunha, M.D.L.R.S. Oxacillin Resistance and Antimicrobial Susceptibility Profile of Staphylococcus saprophyticus and Other Staphylococci Isolated from Patients with Urinary Tract Infection. Chemotherapy 2013, 58, 482–491. [Google Scholar] [CrossRef] [PubMed]
- Andersson, D.I.; Nicoloff, H.; Hjort, K. Mechanisms and Clinical Relevance of Bacterial Heteroresistance. Nat. Rev. Microbiol. 2019, 17, 479–496. [Google Scholar] [CrossRef]
- Pinheiro, L.; Mello, P.L.; Abraão, L.M.; Corrente, J.E.; Cunha, M.D.L.R.S. Evaluation of Reference Values for Phenotypic Tests to Detect Oxacillin Resistance in Coagulase-Negative Staphylococci. Future Microbiol. 2018, 13, 565–575. [Google Scholar] [CrossRef]
- Hryniewicz, M.M.; Garbacz, K. Borderline Oxacillin-Resistant Staphylococcus Aureus (BORSA)—A More Common Problem than Expected? J. Med. Microbiol. 2017, 66, 1367–1373. [Google Scholar] [CrossRef]
- Schwendimann, L.; Merda, D.; Berger, T.; Denayer, S.; Feraudet-Tarisse, C.; Kläui, A.J.; Messio, S.; Mistou, M.Y.; Nia, Y.; Hennekinne, J.A.; et al. Staphylococcal Enterotoxin Gene Cluster: Prediction of Enterotoxin (SEG and SEI) Production and of the Source of Food Poisoning on the Basis of VSaβ Typing. Appl. Environ. Microbiol. 2021, 87, e02662-20. [Google Scholar] [CrossRef]
- Hirotaki, S.; Sasaki, T.; Kuwahara-Arai, K.; Hiramatsu, K. Rapid and Accurate Identification of Human-Associated Staphylococci by Use of Multiplex PCR. J. Clin. Microbiol. 2011, 49, 3627. [Google Scholar] [CrossRef] [PubMed]
- Murakami, K.; Minamide, W.; Wada, K.; Nakamura, E.; Teraoka, H.; Watanabe, S. Identification of Methicillin-Resistant Strains of Staphylococci by Polymerase Chain Reaction. J. Clin. Microbiol. 1991, 29, 2240–2244. [Google Scholar] [CrossRef]
- Arciola, C.R.; Gamberini, S.; Campoccia, D.; Visai, L.; Speziale, P.; Baldassarri, L.; Montanaro, L. A Multiplex PCR Method for the Detection of All Five Individual Genes of Ica Locus in Staphylococcus epidermidis. A Survey on 400 Clinical Isolates from Prosthesis-Associated Infections. J. Biomed. Mater. Res. A 2005, 75A, 408–413. [Google Scholar] [CrossRef]
- Johnson, W.M.; Tyler, S.D.; Ewan, E.P.; Ashton, F.E.; Pollard, D.R.; Rozee, K.R. Detection of Genes for Enterotoxins, Exfoliative Toxins, and Toxic Shock Syndrome Toxin 1 in Staphylococcus aureus by the Polymerase Chain Reaction. J. Clin. Microbiol. 1991, 29, 426. [Google Scholar] [CrossRef]
- Jarraud, S.; Cozon, G.; Vandenesch, F.; Bes, M.; Etienne, J.; Lina, G. Involvement of Enterotoxins G and I in Staphylococcal Toxic Shock Syndrome and Staphylococcal Scarlet Fever. J. Clin. Microbiol. 1999, 37, 2446. [Google Scholar] [CrossRef]
- Jarraud, S.; Mougel, C.; Thioulouse, J.; Lina, G.; Meugnier, H.; Forey, F.; Nesme, X.; Etienne, J.; Vandenesch, F. Relationships between Staphylococcus aureus Genetic Background, Virulence Factors, Agr Groups (Alleles), and Human Disease. Infect. Immun. 2002, 70, 631–641. [Google Scholar] [CrossRef]
- Marconi, C.; Cunha, M.L.R.S.; Araújo, J.P., Jr.; Rugolo, L.M.S.S. Standardization of the PCR Technique for the Detection of Delta Toxin in Staphylococcus Spp. J. Venom. Anim. Toxins Incl. Trop. Dis. 2005, 11, 117–128. [Google Scholar] [CrossRef]
- M100; Performance Standards for Antimicrobial Susceptibility Testing. 29th ed. CLSI Supplement M100. Clinical and Laboratory Standards Institute (CLSI): Wayne, PA, USA, 2019.
- Oliveira, D.C.; De Lencastre, H. Multiplex PCR Strategy for Rapid Identification of Structural Types and Variants of the mec Element in Methicillin-Resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 2002, 46, 2155–2161. [Google Scholar] [CrossRef]
- Da Cunha, M.D.L.R.D.S.; Peresi, E.; Oliveira Calsolari, R.A.; Araújo, J.P. Detection of Enterotoxins Genes in Coagulase-Negative Staphylococci Isolated from Foods. Braz. J. Microbiol. 2006, 37, 70–74. [Google Scholar] [CrossRef]
- Christensen, G.D.; Simpson, W.A.; Younger, J.J.; Baddour, L.M.; Barrett, F.F.; Melton, D.M.; Beachey, E.H.; Christensen, G.D.; Simpson, W.A.; Beachey, E.H.; et al. Adherence of Coagulase-Negative Staphylococci to Plastic Tissue Culture Plates: A Quantitative Model for the Adherence of Staphylococci to Medical Devices. J. Clin. Microbiol. 1985, 22, 996. [Google Scholar] [CrossRef]
- Oliveira, A.; Cunha, M.D.L.R.S. Comparison of Methods for the Detection of Biofilm Production in Coagulase-Negative Staphylococci. BMC Res. Notes 2010, 3, 260. [Google Scholar] [CrossRef] [PubMed]
- McDougal, L.K.; Steward, C.D.; Killgore, G.E.; Chaitram, J.M.; McAllister, S.K.; Tenover, F.C. Pulsed-Field Gel Electrophoresis Typing of Oxacillin-Resistant Staphylococcus aureus Isolates from the United States: Establishing a National Database. J. Clin. Microbiol. 2003, 41, 5113–5120. [Google Scholar] [CrossRef] [PubMed]
S. capitis (n = 141) | MSSC (n = 42) | MRSC (n = 99) | p-Value a | SCCmec Typing of MRSC | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
I (n = 6) | I and III (n = 1) | II and III (n = 2) | III (n = 31) | III and IV (n = 6) | IV (n = 23) | V (n = 20) | V and XIV (n = 1) | VI (n = 1) | NT (n= 8) | p-Value b | ||||||
Demographic data | 57 ± 25.0 (0–97) | 65 ± 25.0 (2–97) | 53 ± 25.3 (0–91) | - | 59 ± 26.0 (38–82) | 0 | 0 | 54 ± 25.0 (0–81) | 61 ± 20.2 (0–89) | 57 ± 25.3 (0.1–89) | 50 ± 26 (0–91) | 43 | 83 | 59 ± 26 (0–90) | - | |
Age, mean ± SD (range) (years) | ||||||||||||||||
Age group, n (%) | Neonatal | 9 (6.4) | 0 (0.0) | 9 (9.1) | 0.104 | 0 (0.0) | 1 (100.0) | 2 (100.0) | 2 (6.5) | 1 (16.7) | 0 (0.0) | 2 (10.0) | 0 (0.0) | 0 (0.0) | 1 (12.5) | 0.8735 |
Pediatric | 5 (3.6) | 2 (4.8) | 3 (3.0) | 0.9915 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 2 (8.7) | 1 (5.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.8735 | |
Adult | 48 (34.0) | 11 (26.2) | 37 (37.4) | 0.3188 | 3 (50.0) | 0 (0.0) | 0 (0.0) | 15 (48.4) | 1 (16.7) | 8 (34.8) | 7 (35.0) | 1 (100.0) | 0 (0.0) | 2 (25.0) | 0.5529 | |
Older adult | 79 (56.0) | 29 (69.0) | 50 (50.5) | 0.0653 | 3 (50.0) | 0 (0.0) | 0 (0.0) | 14 (45.2) | 4 (66.7) | 13 (56.5) | 10 (50.0) | 0 (0.0) | 1 (100.0) | 5 (62.5) | 0.3983 | |
Hospital sector of origin, n (%) | ||||||||||||||||
Adult Emergency Department | 40 (28.4) | 24 (57.1) | 16 (16.2) | <0.0001 | 1 (16.7) | 0 (0.0) | 0 (0.0) | 2 (6.5) | 2 (33.3) | 6 (26.1) | 2 (10.0) | 1 (100.0) | 0 (0.0) | 2 (25.0) | 0.2068 | |
Pediatric Emergency Department | 3 (2.1) | 2 (4.8) | 1 (1.0) | 0.439 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (4.3) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.9494 | |
Intensive Care Unit | 24 (17.0) | 6 (14.3) | 18 (18.2) | 0.7505 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 8 (25.8) | 1 (16.7) | 5 (21.7) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (12.5) | 0.8998 | |
Neonatal Intensive Care Unit | 10 (7.1) | 0 (0.0) | 10 (10.1) | 0.0743 | 0 (0.0) | 1 (100.0) | 2 (100.0) | 2 (6.5) | 1 (16.7) | 1 (4.3) | 2 (10.0) | 0 (0.0) | 0 (0.0) | 1 (12.5) | 0.000593 | |
Nursery | 1 (0.7) | 0 (0.0) | 1 (1.0) | 1 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (5.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.912 | |
Internal Medicine | 27 (19.1) | 5 (11.9) | 22 (22.2) | 0.2341 | 3 (50.0) | 0 (0.0) | 0 (0.0) | 6 (19.4) | 0 (0.0) | 5 (21.7) | 6 (30.0) | 0 (0.0) | 1 (100.0) | 1 (12.5) | 0.3249 | |
Surgery | 4 (2.8) | 0 (0.0) | 4 (4.0) | 0.4431 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 2 (6.5) | 0 (0.0) | 1 (4.3) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (12.5) | 0.9409 | |
Stroke Unit | 1 (0.7) | 0 (0.0) | 1 (1.0) | 1 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (3.2) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.9876 | |
Dermatology | 3 (2.1) | 1 (2.4) | 2 (2.0) | 1 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (3.2) | 0 (0.0) | 0 (0.0) | 1 (5.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.9895 | |
Gastroenterology | 1 (0.7) | 1 (2.4) | 0 (0.0) | 0.6574 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | - | |
Neurology | 8 (5.7) | 0 (0.0) | 8 (8.1) | 0.1339 | 1 (16.7) | 0 (0.0) | 0 (0.0) | 3 (9.7) | 0 (0.0) | 0 (0.0) | 3 (15.0) | 0 (0.0) | 0 (0.0) | 1 (12.5) | 0.8174 | |
Palliative Care | 3 (2.1) | 1 (2.4) | 2 (2.0) | 1 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (16.7) | 1 (4.3) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.4774 | |
Cardiothoracic Ward | 1 (0.7) | 0 (0.0) | 1 (1.0) | 1 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (3.2) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.9876 | |
Infectious Diseases Ward | 1 (0.7) | 0 (0.0) | 1 (1.0) | 1 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (5.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.912 | |
Hemodialysis | 2 (1.4) | 1 (2.4) | 1 (1.0) | 1 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (12.5) | 0.2435 | |
Gynecology | 3 (2.1) | 0 (0.0) | 3 (3.0) | 0.6155 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (3.2) | 1 (16.7) | 0 (0.0) | 1 (5.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.8002 | |
Nephrology | 1 (0.7) | 0 (0.0) | 1 (1.0) | 1 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (3.2) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.9876 | |
Orthopedics | 2 (1.4) | 0 (0.0) | 2 (2.0) | 0.8815 | 1 (16.7) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (4.3) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.4774 | |
Chemotherapy | 1 (0.7) | 1 (2.4) | 0 (0.0) | 0.6574 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | - | |
Ophthalmology and Otorhinolaryngology Ward | 1 (0.7) | 0 (0.0) | 1 (1.0) | 1 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (3.2) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.9876 | |
Not reported | 4 (2.8) | 0 (0.0) | 4 (4.0) | 0.4431 | 0 (0.0) | 0 (0.0) | 0 (0.0) | 2 (6.5) | 0 (0.0) | 2 (8.7) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.9332 |
S. capitis (n = 141) | Antimicrobial | ||||
---|---|---|---|---|---|
mecA Gene | n (%) | Cefoxitin n (%) | Oxacillin n (%) | Linezolid n (%) | Sulfamethoxazole/ Trimethoprim, n (%) |
Not detected | 42 (29.8) | 1 (2.4) | 2 (4.8) | 0 (0.0) | 0 (0.0) |
Detected | 99 (70.2) | 96 (97.0) | 93 (93.9) | 0 (0.0) | 0 (0.0) |
SCCmec | |||||
I | 6 (6.1) | 6 (100.0) | 5 (83.3) | 0 (0.0) | 0 (0.0) |
I and III | 1 (1.0) | 1 (100.0) | 1 (100.0) | 0 (0.0) | 0 (0.0) |
II and III | 2 (2.0) | 2 (100.0) | 2 (100.0) | 0 (0.0) | 0 (0.0) |
III | 31 (31.3) | 28 (90.3) | 29 (93.5) | 0 (0.0) | 0 (0.0) |
III and IV | 6 (6.1) | 6 (100.0) | 6 (100.0) | 0 (0.0) | 0 (0.0) |
IV | 23 (23.2) | 23 (100.0) | 22 (95.7) | 0 (0.0) | 0 (0.0) |
V | 20 (20.2) | 20 (100.0) | 19 (95.0) | 0 (0.0) | 0 (0.0) |
V and XIV | 1 (1.0) | 1 (100.0) | 1 (100.0) | 0 (0.0) | 0 (0.0) |
VI | 1 (1.0) | 1 (100.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
NT | 8 (8.1) | 8 (100.0) | 8 (100.0) | 0 (0.0) | 0 (0.0) |
Adherence | n (%) | Detection of Genes by PCR | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
icaA + n (%) | icaD + n (%) | icaB + n (%) | icaC + n (%) | icaAB + n (%) | icaAC + n (%) | icaAD + n (%) | icaBC + n (%) | icaBD + n (%) | icaDC + n (%) | icaABC + n (%) | icaADB + n (%) | icaACD + n (%) | icaDBC + n (%) | icaADBC + n (%) | ica- n (%) | ||
Strong | 27 (19.1) | 9 (33.3) | 7 (25.9) | 3 (11.1) | 8 (29.6) | 3 (11.1) | 5 (18.5) | 6 (22.2) | 3 (11.1) | 3 (11.1) | 5 (18.5) | 3 (11.1) | 3 (11.1) | 4 (14.8) | 3 (11.1) | 3 (11.1) | 15 (55.6) |
Weak | 19 (13.5) | 4 (21.1) | 3 (15.8) | 0 (0.0) | 1 (5.3) | 0 (0.0) | 0 (0.0) | 11 (5.3) | 0 (0.0) | 0 (0.0) | 1 (5.3) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 13 (68.42) |
Non-adherent | 95 (67.4) | 38 (40.0) | 31 (32.6) | 11 (11.6) | 18 (18.9) | 6 (6.3) | 12 (12.6) | 15 (15.8) | 6 (6.3) | 7 (7.4) | 10 (10.5) | 4 (4.2) | 5 (5.3) | 9 (9.5) | 4 (4.2) | 4 (4.2) | 35 (36.8) |
Total | 141 (100.0) | 51 (36.2) | 41 (29.1) | 14 (9.9) | 27 (19.1) | 9 (6.4) | 17 (12.1) | 22 (15.6) | 9 (6.4) | 10 (7.1) | 16 (11.3) | 7 (5.0) | 8 (5.7) | 13 (9.2) | 7 (5.0) | 7 (5.0) | 63 (44.7) |
Virulence Genes | Biofilm Production, n (%) | |||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
sea | seb | sec | sed | see | seg | seh | sei | tst | sea + seg | seg + sei | seg, seh + sei | sec, seg + sei | sea, seg + sei | hla | hld | WA | SA | |
S. capitis (n = 141) | 14 (9.9) | 0 (0.0) | 16 (11.3) | 1 (0.7) | 2 (1.4) | 61 (43.3) | 27 (19.1) | 50 (35.5) | 0 (0.0) | 13 (9.2) | 38 (27.0) | 11 (7.8) | 5 (3.5) | 8 (5.7) | 2 (1.4) | 1 (0.7) | 19 (13.5) | 27 (19.1) |
MSSC (n = 42) | 3 (7.1) | - | 6 (14.3) | 1 (2.4) | 0 (0.0) | 13 (31.0) | 5 (11.9) | 12 (28.6) | - | 2 (4.8) | 9 (21.4) | 1 (2.4) | 2 (4.8) | 2 (4.8) | 1 (2.4) | 1 (2.4) | 7 (16.7) | 15 (35.7) |
MRSC (n = 99) | 11 (11.1) | - | 10 (10.1) | 0 (0.0) | 2 (2.0) | 48 (48.5) | 22 (22.2) | 38 (38.4) | - | 11 (11.1) | 29 (29.3) | 10 (10.1) | 3 (3.0) | 6 (6.1) | 1 (1.0) | 0 (0.0) | 12 (12.1) | 12 (12.0) |
p-value | 0.4712 | - | 0.4737 | 0.1234 | 0.3535 | 0.0546 | 0.1545 | 0.2643 | - | 0.3824 | 0.4503 | 0.2225 | 0.9915 | 1 | 1 | 0.6574 | 0.6504 | 0.0025 |
SCCmec (n) | ||||||||||||||||||
I (6) | 1 (16.7) | - | 1 (16.7) | 0 (0.0) | 0 (0.0) | 6 (100.0) | 1 (16.7) | 6 (100.0) | - | 1 (16.7) | 6 (100.0) | 1 (16.7) | 1 (16.7) | 1 (16.7) | 0 (0.0) | 0 (0.0) | 1 (16.7) | 0 (0.0) |
I and III (1) | 0 (0.0) | - | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (100.0) | 1 (100.0) | 1 (100.0) | - | 0 (0.0) | 1 (100.0) | 1 (100.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
II and III (2) | 0 (0.0) | - | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (50.0) | 0 (0.0) | - | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (50.0) | 0 (0.0) |
III (31) | 4 (12.9) | - | 3 (9.7) | 0 (0.0) | 0 (0.0) | 17 (54.8) | 9 (29.0) | 17 (54.8) | - | 4 (12.9) | 14 (45.2) | 6 (19.4) | 1 (3.2) | 3 (9.7) | 0 (0.0) | 0 (0.0) | 4 (12.9) | 2 (6.5) |
III and IV (6) | 0 (0.0) | - | 1 (16.7) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | - | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 4 (66.7) |
IV (23) | 3 (13.0) | - | 3 (13.0) | 0 (0.0) | 1 (4.34) | 10 (43.5) | 3 (13.0) | 5 (21.7) | - | 3 (13.0) | 3 (13.0) | 0 (0.0) | 1 (4.34) | 1 (4.34) | 0 (0.0) | 0 (0.0) | 3 (13.0) | 5 (21.7 |
V (20) | 2 (10.0) | - | 1 (5.0) | 0 (0.0) | 1 (5.0) | 12 (60.0) | 4 (20.0) | 6 (30.0) | - | 2 (10.0) | 4 (20.0) | 1 (5.0) | 0 (0.0) | 1 (5.0) | 1 (5.0) | 0 (0.0) | 2 (10.0) | 1 (5.0) |
V and XIV (1) | 0 (0.0) | - | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | - | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
VI (1) | 0 (0.0) | - | 1 (100.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (100.0) | - | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
NT (8) | 1 (12.5) | - | 0 (0.0) | 0 (0.0) | 0 (0.0) | 2 (25.0) | 3 (37.5) | 2 (25.0) | - | 1 (12.5) | 1 (12.5) | 1 (12.5) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (12.5) | 0 (0.0) |
p-value | 0.9944 | - | 0.2358 | - | 0.2358 | 0.0155 | 0.3606 | 0.0002 | - | 0.9944 | 0.0001 | 0.0582 | 0.8205 | 0.9521 | 0.912 | - | 0.8996 | 0.0056 |
Isolate | Hemolysin Gene | Year | Hospital Unit | ica Operon Profile/ Biofilm Production | Resistance Profile |
---|---|---|---|---|---|
161 | hla/hld | 2016 | ICU | ica-/non-adherent | mecA− |
239 | hla | 2017 | Internal Medicine | icaADBC/non-adherent | mecA+/SCCmec V |
Target | Primer | 5′-3′ Nucleotide Sequence | Amplicon Size (bp) | Reference |
---|---|---|---|---|
S. capitis a | SCap F | ACTACGCCTATGATTATTGC | 525 | [73] |
SCap R | GAGCTTCTTTACCATAGGG | |||
mecA | mecA F | AAAATCGAT GGT AAAGGTTGG | 533 | [74] |
mecA R | AGTTCTGCAGTACCGGATTTG | |||
icaA | icaA F | TCTCTTGCAGGAGCAATCAA | 187 | [75] |
icaA R | TCAGGCACTAACATCCAGCA | |||
icaB | icaB F | CTGATCAAGAATTTAAATCACAAA | 302 | [75] |
icaB R | AAAGTCCCATAAGCCTGTTT | |||
icaC | icaC F | TAACTTTAGGCGCATATGTTT | 400 | [75] |
icaC R | TTCCAGTTAGGCTGGTATTG | |||
icaD | icaD F | ATGGTCAAGCCCAGACAGAG | 198 | [75] |
icaD R | CGTGTTTTCAACATTTAATGCAA | |||
sea | sea F | TTGGAAACGGTTAAAACGAA GAACCTTCCCATCAAAAACA | 120 | [76] |
sea R | ||||
seb | seb F | TCGCATCAAACTGACAAACG | 478 | [76] |
seb R | GCAGGTACTCTATAAGTGCC | |||
sec | sec F | GACATAAAAGCTAGGAATTT | 257 | [76] |
sec R | AAATCGGATTAACATTATCC | |||
sed | sed F | CTAGTTTGGTAATATCTCCT | 317 | [76,77] |
sed R | TAATGCTATATCTTATAGGG | |||
see | see F | CAAAGAAATGCTTTAAGCAATCTTAGGCCAC | 482 | [77] |
see R | CTTACCGCCAAAGCTG | |||
seg | seg F | AATTATGTGAATGCTCAACCCGATC | 642 | [78] |
seg R | AAACTTATATGGAACAAAAGGTACTAGTTC | |||
seh | seh F | CAATCACATCATATGCGAAAGCAG | 375 | [78] |
seh R | CATCTACCCAAACATTAGCACC | |||
sei | sei F | GGTGATTATGTAGATGCTTGGG | 576 | [77] |
sei R | TCGGGTGTTACTTCTGTTTGC | |||
tst | tsst F | ATGGCAGCATCAGCTTGATA | 350 | [77] |
tsst R | TTTCCAATAACCACCCGTTT | |||
SCCmec I | CIF2 F2 | TTCGAGTTGCTGGATGAAGAAGG | 495 | [23] |
CIF2 R2 | ATTTACCACAAGGACTACCAGC | |||
SCCmec II | KDP F1 | AATCATCTGCCATTGGTGATGC | 284 | [23] |
KDP R1 | CGAATGAAGTGAAAGAAAGTGG | |||
SCCmec I, II, IV | DCS F2 | CATCCTATGATAGCTTGGTC | 342 | [23] |
DCS R1 | CTAAATCATAGCCATGACCG | |||
SCCmec III | RIF4 F3 | GTGATTGTTCGAGATATGTGG | 414 | [23] |
RIF4 R9 | CGCTTTATCTGTATCTATCGC | |||
mecA (mA1-mA2) | mA1 | TGCTATCCACCCTCAAACAGG | 286 | [39] |
mA2 | AACGTTGTAACCACCCCAAGA | |||
ccrA1-ccrB (α1-βc) | α1 | AACCTATATCATCAATCAGTACGT | 695 | [39] |
ccrA2-ccrB (α2-βc) | α2 | TAAAGGCATCAATGCACAAACACT | 937 | [39] |
ccrA3-ccrB (α3-βc) | α3 | AGCTCAAAAGCAAGCAATAGAAT | 1791 | [39] |
βc | ATTGCCTTGATAATAGCCITCT | [39] | ||
ccrA4-ccrB4 (α4.2-β4.2) | α4.2 | GTATCAATGCACCAGAACTT | 1287 | [39] |
β4.2 | TTGCGACTCTCTTGGCGTTT | |||
ccrC (γR-γF) | γR | CCTTTATAGACTGGATTATTCAAAATAT | 518 | [39] |
γF | CGTCTATTACAAGATGTTAAGGATAAT | |||
mecA-mecI (mA7-mI6) | mI6 | CATAACTTCCCATTCTGCAGATG | 1963 | [39] |
mecA-IS1272 (mA7-IS7) | IS7 | ATGCTTAATGATAGCATCCGAATG | 2827 | [39] |
mecA-IS431 (mA7-IS2 [iS-2]) | IS2(iS-2) | TGAGGTTATTCAGATATTTCGATGT | 804 | [39] |
mA7 | ATATACCAAACCCGACAACTACA | [39] | ||
hla | hla F | CTGATTACTATCCAAGAAATTCGATTG | 209 | [64] |
hla R | CTTTCCAGCCTACTTTTTTATCAGT | |||
hld | hld F | ATGGCAGCAGATATCATTTC | 357 | [79] |
hld R | CGTGAGCTTGGGAGAGAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Romero, L.C.; Silva, L.P.; Teixeira, N.B.; de Camargo, K.V.; Del Masso Pereira, M.A.; Corrente, J.E.; Pereira, V.C.; Ribeiro de Souza da Cunha, M.d.L. Staphylococcus capitis Bloodstream Isolates: Investigation of Clonal Relationship, Resistance Profile, Virulence and Biofilm Formation. Antibiotics 2024, 13, 147. https://doi.org/10.3390/antibiotics13020147
Romero LC, Silva LP, Teixeira NB, de Camargo KV, Del Masso Pereira MA, Corrente JE, Pereira VC, Ribeiro de Souza da Cunha MdL. Staphylococcus capitis Bloodstream Isolates: Investigation of Clonal Relationship, Resistance Profile, Virulence and Biofilm Formation. Antibiotics. 2024; 13(2):147. https://doi.org/10.3390/antibiotics13020147
Chicago/Turabian StyleRomero, Letícia Calixto, Lucas Porangaba Silva, Nathalia Bibiana Teixeira, Karen Vilegas de Camargo, Milena Aparecida Del Masso Pereira, José Eduardo Corrente, Valéria Cataneli Pereira, and Maria de Lourdes Ribeiro de Souza da Cunha. 2024. "Staphylococcus capitis Bloodstream Isolates: Investigation of Clonal Relationship, Resistance Profile, Virulence and Biofilm Formation" Antibiotics 13, no. 2: 147. https://doi.org/10.3390/antibiotics13020147
APA StyleRomero, L. C., Silva, L. P., Teixeira, N. B., de Camargo, K. V., Del Masso Pereira, M. A., Corrente, J. E., Pereira, V. C., & Ribeiro de Souza da Cunha, M. d. L. (2024). Staphylococcus capitis Bloodstream Isolates: Investigation of Clonal Relationship, Resistance Profile, Virulence and Biofilm Formation. Antibiotics, 13(2), 147. https://doi.org/10.3390/antibiotics13020147