Anti-Tick Microbiota Vaccine Impacts Ixodes ricinus Performance during Feeding
Abstract
:1. Introduction
2. Results
2.1. Enterobacteriaceae Is a Keystone Bacterial Family in Ixodes Gut Microbiota
2.2. α1,3-Galactosyltransferase Genes Are Broadly Distributed in the Tick Gut Microbiome
2.3. Anti-α-Gal Immunity and Host Genetic Background Influence the Impact of Live E. coli Vaccination on Tick Performance
2.4. Live E. coli Vaccination in α1,3GT KO Mice Is Associated with Decreased Relative Abundance of Enterobacteriaceae in I. ricinus
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Screenings of Central Bacteria in Tick Gut Microbiota of I. scapularis and I. ricinus Nymphs
5.1.1. Original 16S Data Sets
- (i)
- The I. scapularis data set was described by Abraham et al. [32]. They studied the changes in gut microbiota composition and biofilms of nymphs of I. scapularis fed on A. phagocytophilum-infected or not infected C3H/HeJ mice housed in laboratory conditions at Yale University, USA. From this data set we used only the samples from nymph fed on uninfected mice (n = 10).
- (ii)
- The I. ricinus 16S data set was described by Aivelo et al. [33]. They collected free-living ticks from different life stages at three locations in the Swiss Alps, Kanton Graubünden, Switzerland, encompassing a gradient of three heights above sea level. From this data set we only considered the samples representing nymphs (n = 10).
5.1.2. Processing of Original Raw Sequences
5.1.3. Bacterial Co-Occurrence Networks
5.1.4. Prediction of Functional Traits in Tick Microbiome
5.1.5. Identification of α-1,3-Galactosyltransferase Genes in Tick Microbiota Bacteria
5.2. Experimental Procedures
5.2.1. Ethics Statement
5.2.2. Mice and Housing Conditions
6. Bacteria Culture and Life Bacteria Immunization
7. Sera Collection and Preparation
8. Tick Infestation
9. Protein Extraction
10. Indirect ELISA for Anti-α-Gal and Anti-BL21 Protein Antibodies
11. Relative Quantification of Enterobacteriaceae by qPCR
11.1. DNA Extraction
11.2. qPCR
12. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Duron, O.; Morel, O.; Bouchez, O.; Buysse, M.; Binetruy, F.; Lancelot, R.; Loire, E.; Ménard, C.; Bouchez, O.; Vavre, F.; et al. Tick-Bacteria Mutualism Depends on B Vitamin Article Tick-Bacteria Mutualism Depends on B Vitamin Synthesis Pathways. Curr. Biol. 2018, 28, 1896–1902. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Narasimhan, S.; Fikrig, E. Tick microbiome: The force within. Trends Parasitol. 2015, 31, 315–323. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Smith, T.A.; Driscoll, T.; Gillespie, J.J.; Raghavan, R.A. Coxiella-like endosymbiontis a potential vitamin source for the lone star tick. Genome Biol. Evol. 2015, 7, 831–838. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Obregón, D.; Bard, E.; Abrial, D.; Cabezas-Cruz, A. Sex-Specific Linkages between Taxonomic and Functional Profiles of Tick Gut Microbiomes. Front. Cell Infect. Microbiol. 2019, 9, 298. [Google Scholar] [CrossRef][Green Version]
- Estrada-Peña, A.; Cabezas-Cruz, A.; Obregón, D. Resistance of tick gut microbiome to anti-tick vaccines, pathogen infection and antimicrobial peptides. Pathogens 2020, 9, 309. [Google Scholar] [CrossRef]
- Díaz-Sánchez, S.; Estrada-Peña, A.; Cabezas-Cruz, A.; de la Fuente, J. Evolutionary Insights into the Tick Hologenome. Trends Parasitol. 2019, 35, 725–737. [Google Scholar] [CrossRef]
- Banerjee, S.; Schlaeppi, K.; van der Heijden, M.G.A. Keystone taxa as drivers of microbiome structure and functioning. Nat. Rev. Microbiol. 2018, 16, 567–576. [Google Scholar] [CrossRef]
- Weiss, S.; Van Treuren, W.; Lozupone, C.; Faust, K.; Friedman, J.; Deng, Y.; Xia, L.C.; Xu, Z.Z.; Ursell, L.; Alm, E.J.; et al. Correlation detection strategies in microbial data sets vary widely in sensitivity and precision. ISME J. 2016, 10, 1669–1681. [Google Scholar] [CrossRef]
- Herren, C.M.; McMahon, K.D. Keystone taxa predict compositional change in microbial communities. Environ. Microbiol. 2018, 20, 2207–2217. [Google Scholar] [CrossRef][Green Version]
- Galili, U.; Mandrell, R.E.; Hamadeh, R.M.; Shohet, S.B.; Griffiss, J.M. Interaction between human natural anti-alpha-galactosyl immunoglobulin G and bacteria of the human flora. Infect. Immun. 1988, 56, 1730–1737. [Google Scholar] [CrossRef][Green Version]
- Hamadeh, R.M.; Jarvis, G.A.; Zhou, P.; Griffiss, J.M. Bacterial enzymes can add galactose alpha 1,3 to human erythrocytes and creates a senescence-associated epitope. Infect. Immun. 1996, 64, 528–534. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Chen, C.; Liu, B.; Xu, Y.; Utkina, N.; Zhou, D.; Danilov, L.; Torgov, V.; Veselovsky, V.; Feng, L. Biochemical characterization of the novel α-1, 3-galactosyltransferase WclR from Escherichia coli O3. Carbohydr. Res. 2016, 430, 36–43. [Google Scholar] [CrossRef] [PubMed]
- Pradel, E.; Parker, C.T.; Schnaitman, C.A. Structures of the rfaB, rfaI, rfaJ, and rfaS genes of Escherichia coli K-12 and their roles in assembly of the lipopolysaccharide core. J. Bacteriol. 1992, 174, 4736–4745. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ohashi, T.; Fujiyama, K.; Takegawa, K. Identification of novel α1,3-galactosyltransferase and elimination of α-galactose-containing glycans by disruption of multiple α-galactosyltransferase genes in Schizosaccharomyces pombe. J. Biol. Chem. 2012, 287, 38866–38875. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Mateos-Hernández, L.; Risco-Castillo, V.; Torres-Maravilla, E.; Bermúdez-Humarán, L.G.; Alberdi, P.; Hodžić, A.; Hernández-Jarguin, A.; Rakotobe, S.; Galon, C.; Devillers, E.; et al. Gut Microbiota Abrogates Anti-α-Gal IgA Response in Lungs and Protects against Experimental Aspergillus Infection in Poultry. Vaccines 2020, 8, 285. [Google Scholar] [CrossRef]
- Hodžić, A.; Mateos-Hernández, L.; Fréalle, E.; Román-Carrasco, P.; Alberdi, P.; Pichavant, M.; Risco-Castillo, V.; Le Roux, D.; Vicogne, J.; Hemmer, W.; et al. Infection with Toxocara canis Inhibits the Production of IgE Antibodies to α-Gal in Humans: Towards a Conceptual Framework of the Hygiene Hypothesis? Vaccines 2020, 8, 167. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Galili, U.; Shohet, S.B.; Kobrin, E.; Stults, C.L.; Macher, B.A. Man, apes, and Old World monkeys differ from other mammals in the expression of alpha-galactosyl epitopes on nucleated cells. J. Biol. Chem. 1988, 263, 17755–17762. [Google Scholar] [PubMed]
- Hennet, T. The galactosyltransferase family. Cell Mol. Life Sci. 2002, 59, 1081–1095. [Google Scholar] [CrossRef]
- Cabezas-Cruz, A.; Espinosa, P.J.; Alberdi, P.; Šimo, L.; Valdés, J.J.; Mateos-Hernández, L.; Contreras, M.; Villar Rayo, M.; de la Fuente, J. Tick galactosyltransferases are involved in α-Gal synthesis and play a role during Anaplasma phagocytophilum infection and Ixodes scapularis tick vector development. Sci. Rep. 2018, 8, 1–18. [Google Scholar] [CrossRef]
- Jennings, M.P.; Virji, M.; Evans, D.; Srikhanta, Y.N.; Steeghs, L.; van der Ley, P.; Moxon, E.R. Identification of a novel gene involved in pilin glycosylation in Neisseria meningitidis. Mol. Microbiol. 1998, 29, 975–984. [Google Scholar] [CrossRef]
- Yilmaz, B.; Portugal, S.; Tran, T.M.; Gozzelino, R.; Ramos, S.; Gomes, J.; Regalado, A.; Cowan, P.J.; d’Apice, A.J.F.; Chong, A.S.; et al. Gut microbiota elicits a protective immune response against malaria transmission. Cell 2014, 159, 1277–1289. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Galili, U. Evolution in primates by “Catastrophic-selection” interplay between enveloped virus epidemics, mutated genes of enzymes synthesizing carbohydrate antigens, and natural anti-carbohydrate antibodies. Am. J. Phys. Anthropol. 2019, 168, 352–363. [Google Scholar] [CrossRef] [PubMed]
- Pacheco, I.; Contreras, M.; Villar, M.; Risalde, M.A.; Alberdi, P.; Cabezas-Cruz, A.; Gortázar, C.; de la Fuente, J. Vaccination with Alpha-Gal Protects Against Mycobacterial Infection in the Zebrafish Model of Tuberculosis. Vaccines 2020, 8, 195. [Google Scholar] [CrossRef] [PubMed]
- Montassier, E.; Al-Ghalith, G.A.; Mathé, C.; Le Bastard, Q.; Douillard, V.; Garnier, A.; Guimon, R.; Raimondeau, B.; Touchefeu, Y.; Duchalais, E.; et al. Distribution of Bacterial α1,3-Galactosyltransferase Genes in the Human Gut Microbiome. Front. Immunol. 2020, 10, 3000. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Galili, U.; Clark, M.R.; Shohet, S.B.; Buehler, J.; Macher, B.A. Evolutionary relationship between the natural anti-Gal antibody and the Gal alpha 1-3Gal epitope in primates. Proc. Natl. Acad. Sci. USA 1987, 84, 1369–1373. [Google Scholar] [CrossRef][Green Version]
- Macher, B.A.; Galili, U. The Galalpha1,3Galbeta1,4GlcNAc-R (alpha-Gal) epitope: A carbohydrate of unique evolution and clinical relevance. Biochim. Biophys. Acta 2008, 1780, 75–88. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Van Nunen, S.; O’Connor, K.S.; Clarke, L.R.; Clarke, L.R.; Boyle, R.X. The association between Ixodes holocyclus tick bite reactions and red meat allergy. Intern. Med. J. 2007, 39, A132. [Google Scholar]
- Cabezas-Cruz, A.; Hodžić, A.; Román-Carrasco, P.; Mateos-Hernández, L.; Duscher, G.G.; Sinha, D.K.; Hemmer, W.; Swoboda, I.; Estrada-Peña, A.; de la Fuente, J. Environmental and Molecular Drivers of the α-Gal Syndrome. Front. Immunol. 2019, 10, 1210. [Google Scholar] [CrossRef][Green Version]
- Platts-Mills, T.A.E.; Commins, S.P.; Biedermann, T.; van Hage, M.; Levin, M.; Beck, L.A.; Diuk-Wasser, M.; Jappe, U.; Apostolovic, D.; Minnicozzi, M.; et al. On the cause and consequences of IgE to galactose-α-1,3-galactose: A report from the National Institute of Allergy and Infectious Diseases Workshop on Understanding IgE-Mediated Mammalian Meat Allergy. J. Allergy Clin. Immunol. 2020, 145, 1061–1071. [Google Scholar] [CrossRef]
- Mateos-Hernández, L.; Villar, M.; Moral, A.; García Rodríguez, C.; Alfaya Arias, T.; de la Osa, V.; Feo Brito, F.; Fernández de Mera, I.G.; Alberdi, P.; Ruiz-Fons, F.; et al. Tick-host conflict: Immunoglobulin E antibodies to tick proteins in patients with anaphylaxis to tick bite. Oncotarget 2017, 8, 20630–20644. [Google Scholar] [CrossRef]
- Park, Y.; Kim, D.; Boorgula, G.D.; De Schutter, K.; Smagghe, G.; Šimo, L.; Archer-Hartmann, S.A.; Azadi, P. Alpha-Gal and Cross-Reactive Carbohydrate Determinants in the N-Glycans of Salivary Glands in the Lone Star Tick, Amblyomma americanum. Vaccines 2020, 8, 18. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Abraham, N.M.; Liu, L.; Lyon, B.; Yadav, A.K.; Narasimhan, S.; Gopalakrishnan, V.; Ansari, J.M.; Jefferson, K.K.; Cava, F.; Jacobs-Wagner, C.; et al. Pathogen-mediated manipulation of arthropod microbiota to promote infection. Proc. Natl. Acad. Sci. USA 2017, 114, E781–E790. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Aivelo, T.; Norberg, A.; Tschirren, B. Bacterial microbiota composition of Ixodes ricinus ticks: The role of environmental variation, tick characteristics and microbial interactions. PeerJ 2019, 2019, e8217. [Google Scholar] [CrossRef][Green Version]
- Newman, M.E.J. The mathematics of networks. New Palgrave Encycl. Econ. 2008, 2, 1–12. [Google Scholar]
- Endo, A.; Rothfieldt, L. Studies of a Phospholipid-Requiring Bacterial Enzyme. I. Purification and properties of uridine diphosphate galactose: Lipopolysaccharide alpha-3-galactosyl transferase. Biochemistry 1969, 8, 3500–3507. [Google Scholar] [CrossRef] [PubMed]
- Douglas, G.M.; Maffei, V.J.; Zaneveld, J.; Yurgel, N.S.; Brown, J.R.; Taylor, C.M.; Huttenhower, C.; Langille, M.G.I. PICRUSt2: An improved and extensible approach for metagenome inference. BioRxiv 2019, 672295. [Google Scholar] [CrossRef][Green Version]
- Krzywinski, M.; Schein, J.; Birol, I.; Connors, J.; Gascoyne, R.; Horsman, D.; Jones, S.J.; Marra, M.A. Circos: An information aesthetic for comparative genomics. Genome Res. 2009, 19, 1639–1645. [Google Scholar] [CrossRef][Green Version]
- Cabezas-Cruz, A.; Pollet, T.; Estrada-Peña, A.; Allain, E.; Bonnet, S.I.; Moutailler, S. Handling the microbial complexity associated to ticks. In Ticks and Tick-Borne Pathogens; Abubakar, D.M., Ed.; InTechOpen: London, UK, 2018; pp. 1–36. [Google Scholar]
- Degli Esposti, M.; Martinez Romero, E. The functional microbiome of arthropods. PLoS ONE 2017, 12, e0176573. [Google Scholar] [CrossRef]
- Fierer, N. Embracing the unknown: Disentangling the complexities of the soil microbiome. Nat. Rev. Microbiol. 2017, 15, 579–590. [Google Scholar] [CrossRef]
- Faust, K.; Raes, J. Microbial interactions: From networks to models. Nat. Rev. Microbiol. 2012, 10, 538–550. [Google Scholar] [CrossRef]
- Cagua, E.F.; Wootton, K.L.; Stouffer, D.B. Keystoneness, centrality, and the structural controllability of ecological networks. J. Ecol. 2019, 107, 1779–1790. [Google Scholar] [CrossRef]
- Van der Heijden, M.G.A.; Hartmann, M. Networking in the Plant Microbiome. PLoS Biol. 2016, 14, e1002378. [Google Scholar] [CrossRef] [PubMed]
- Estrada-Peña, A.; Villar, M.; Artigas-Jerónimo, S.; López, V.; Alberdi, P.; Cabezas-Cruz, A.; de la Fuente, J. Use of graph theory to characterize human and arthropod vector cell protein response to infection with Anaplasma phagocytophilum. Front. Cell Infect. Microbiol. 2018, 8, 265. [Google Scholar] [CrossRef][Green Version]
- Poudel, R.; Jumpponen, A.; Schlatter, D.C.; Paulitz, T.C.; McSpadden Gardener, B.B.; Kinkel, L.L.; Garrett, K.A. Microbiome networks: A systems framework for identifying candidate microbial assemblages for disease management. Phytopathology 2016, 106, 1083–1096. [Google Scholar] [CrossRef]
- Agler, M.T.; Ruhe, J.; Kroll, S.; Morhenn, C.; Kim, S.T.; Weigel, D.; Kemen, E.M. Microbial hub taxa link host and abiotic factors to plant microbiome variation. PLoS Biol. 2016, 14, e1002352. [Google Scholar] [CrossRef][Green Version]
- Ruhnau, B. Eigenvector-centrality—A node-centrality? Soc. Netw. 2000, 22, 357–365. [Google Scholar] [CrossRef]
- Velazquez, E.M.; Nguyen, H.; Heasley, K.T.; Saechao, C.H.; Gil, L.M.; Rogers, A.W.L.; Miller, B.M.; Rolston, M.R.; Lopez, C.A.; Litvak, Y.; et al. Endogenous Enterobacteriaceae underlie variation in susceptibility to Salmonella infection. Nat. Microbiol. 2019, 4, 1057–1064. [Google Scholar] [CrossRef]
- Litvak, Y.; Mon, K.K.Z.; Nguyen, H.; Chanthavixay, G.; Liou, M.; Velazquez, E.M.; Kutter, L.; Alcantara, M.A.; Byndloss, M.X.; Tiffany, C.R.; et al. Commensal Enterobacteriaceae Protect against Salmonella Colonization through Oxygen Competition. Cell Host Microbe 2019, 25, 128–139. [Google Scholar] [CrossRef][Green Version]
- Macedo-Raygoza, G.M.; Valdez-Salas, B.; Prado, F.M.; Prieto, K.R.; Yamaguchi, L.F.; Kato, M.J.; Canto-Canché, B.B.; Carrillo-Beltrán, M.; Di Mascio, P.; White, J.F.; et al. Enterobacter cloacae, an Endophyte That Establishes a Nutrient-Transfer Symbiosis with Banana Plants and Protects Against the Black Sigatoka Pathogen. Front. Microbiol. 2019, 10, 804. [Google Scholar] [CrossRef][Green Version]
- Liu, Y.; Zhu, A.; Tan, H.; Cao, L.; Zhang, R. Engineering banana endosphere microbiome to improve Fusarium wilt resistance in banana. Microbiome 2019, 7, 74. [Google Scholar] [CrossRef]
- Narasimhan, S.; Rajeevan, N.; Liu, L.; Zhao, Y.O.; Heisig, J.; Pan, J.; Eppler-Epstein, R.; Deponte, K.; Fish, D.; Fikrig, E. Gut microbiota of the tick vector Ixodes scapularis modulate colonization of the Lyme disease spirochete. Cell Host Microbe 2014, 15, 58–71. [Google Scholar] [CrossRef][Green Version]
- Korach-Rechtman, H.; Freilich, S.; Gerassy-Vainberg, S.; Buhnik-Rosenblau, K.; Danin-Poleg, Y.; Bar, H.; Kashi, Y. Murine Genetic Background Has a Stronger Impact on the Composition of the Gut Microbiota than Maternal Inoculation or Exposure to Unlike Exogenous Microbiota. Appl. Environ. Microbiol. 2019, 85, e00826-19. [Google Scholar] [CrossRef][Green Version]
- Villarino, N.F.; LeCleir, G.R.; Denny, J.E.; Dearth, S.P.; Harding, C.L.; Sloan, S.S.; Gribble, J.L.; Campagna, S.R.; Wilhelm, S.W.; Schmidt, N.W. Composition of the gut microbiota modulates the severity of malaria. Proc. Natl. Acad. Sci. USA 2016, 113, 2235–2240. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Rathinavelu, S.; Broadwater, A.; de Silva, A.M. Does host complement kill Borrelia burgdorferi within ticks? Infect. Immun. 2003, 71, 822–829. [Google Scholar] [CrossRef][Green Version]
- Commins, S.P.; James, H.R.; Kelly, L.A.; Pochan, S.L.; Workman, L.J.; Perzanowski, M.S.; Kocan, K.M.; Fahy, J.V.; Nganga, L.W.; Ronmark, E.; et al. The relevance of tick bites to the production of IgE antibodies to the mammalian oligosaccharide galactose-α-1,3-galactose. J. Allergy Clin. Immunol. 2011, 127, 1286–1293. [Google Scholar] [CrossRef][Green Version]
- Hamsten, C.; Starkhammar, M.; Tran, T.A.; Johansson, M.; Bengtsson, U.; Ahlén, G.; Sällberg, M.; Grönlund, H.; van Hage, M. Identification of galactose-α-1,3-galactose in the gastrointestinal tract of the tick Ixodes ricinus; possible relationship with red meat allergy. Allergy 2013, 68, 549–552. [Google Scholar] [CrossRef]
- Crispell, G.; Commins, S.P.; Archer-Hartman, S.A.; Choudhary, S.; Dharmarajan, G.; Azadi, P.; Karim, S. Discovery of Alpha-Gal-Containing Antigens in North American Tick species believed to induce red meat allergy. Front. Immunol. 2019, 10, 1056. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Chinuki, Y.; Ishiwata, K.; Yamaji, K.; Takahashi, H.; Morita, E. Haemaphysalis longicornis tick bites are a possible cause of red meat allergy in Japan. Allergy 2016, 71, 421–425. [Google Scholar] [CrossRef] [PubMed]
- Araujo, R.N.; Franco, P.F.; Rodrigues, H.; Santos, L.C.B.; McKay, C.S.; Sanhueza, C.A.; Brito, C.R.N.; Azevedo, M.A.; Venuto, A.P.; Cowan, P.J.; et al. Amblyomma sculptum tick saliva: α-Gal identification, antibody response and possible association with red meat allergy in Brazil. Int. J. Parasitol. 2016, 46, 213–220. [Google Scholar] [CrossRef][Green Version]
- Villar, M.; Pacheco, I.; Merino, O.; Contreras, M.; Mateos-Hernández, L.; Prado, E.; Barros-Picanco, D.K.; Lima-Barbero, F.J.; Artigas-Jerónimo, S.; Alberdi, P.; et al. Tick and host derived compounds modulate the biochemical properties of the cement complex substance. Biomolecules 2020, 10, 555. [Google Scholar] [CrossRef][Green Version]
- Cabezas-Cruz, A.; Valdés, J.; de la Fuente, J. Cancer research meets tick vectors for infectious diseases. Lancet Infect. Dis. 2014, 14, 916–917. [Google Scholar] [CrossRef][Green Version]
- Leinonen, R.; Sugawara, H.; Shumway, M. The sequence read archive. Nucleic Acids Res. 2011, 39, 2010–2012. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Blankenberg, D.; Gordon, A.; Von Kuster, G.; Coraor, N.; Taylor, J.; Nekrutenko, A.; Galaxy Team. Manipulation of FASTQ data with galaxy. Bioinformatics 2010, 26, 1783–1785. [Google Scholar] [CrossRef] [PubMed]
- Bolyen, E.; Dillon, M.; Bokulich, N.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; Bai, Y.; et al. Reproducible, interactive, scalable, and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef] [PubMed]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Katoh, K.; Misawa, K.; Kuma, K.I.; Miyata, T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef][Green Version]
- Price, M.N.; Dehal, P.S.; Arkin, A.P. FastTree 2—Approximately maximum-likelihood trees for large alignments. PLoS ONE 2010, 5, e9490. [Google Scholar] [CrossRef]
- Bokulich, N.A.; Kaehler, B.D.; Rideout, J.R.; Dillon, M.; Bolyen, E.; Knight, R.; Huttley, G.A.; Gregory Caporaso, J. Optimizing taxonomic classification of marker-gene amplicon sequences with QIIME 2′s q2-feature-classifier plugin. Microbiome 2018, 6, 90. [Google Scholar] [CrossRef]
- Yarza, P.; Yilmaz, P.; Pruesse, E.; Glöckner, F.O.; Ludwig, W.; Schleifer, K.H.; Whitman, W.B.; Euzéby, J.; Amann, R.; Rosselló-Móra, R. Uniting the classification of cultured and uncultured bacteria and archaea using 16S rRNA gene sequences. Nat. Rev. Microbiol. 2014, 12, 635–645. [Google Scholar] [CrossRef]
- Werner, J.J.; Koren, O.; Hugenholtz, P.; DeSantis, T.Z.; Walters, W.A.; Caporaso, J.G.; Angenent, L.T.; Knight, R.; Ley, R.E. Impact of training sets on classification of high-throughput bacterial 16s rRNA gene surveys. ISME J. 2012, 6, 94–103. [Google Scholar] [CrossRef][Green Version]
- Ren, T.; Wu, M. PhyloCore: A phylogenetic approach to identifying core taxa in microbial communities. Gene 2016, 593, 330–333. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Friedman, J.; Alm, E.J. Inferring Correlation Networks from Genomic Survey Data. PLoS Comput. Biol. 2012, 8, e1002687. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Bastian, M.; Jacomy, M. Gephi: An open source software for exploring and manipulating networks. In Proceedings of the Third International Conference on Weblogs and Social Media (ICWSM 2009), San Jose, CA, USA, 17–20 May 2009; pp. 4–6. [Google Scholar]
- Kanehisa, M.; Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef] [PubMed]
- Moura, A.P.V.; Santos, L.C.B.; Brito, C.R.N.; Valencia, E.; Junqueira, C.; Filho, A.A.P.; Sant’Anna, M.R.V.; Gontijo, N.F.; Bartholomeu, D.C.; Fujiwara, R.T.; et al. Virus-like particle display of the α-Gal carbohydrate for vaccination against Leishmania Infection. ACS Cent. Sci. 2017, 3, 1026–1031. [Google Scholar] [CrossRef][Green Version]
- Iniguez, E.; Schocker, N.S.; Subramaniam, K.; Portillo, S.; Montoya, A.L.; Al-Salem, W.S.; Torres, C.L.; Rodriguez, F.; Moreira, O.C.; Acosta-Serrano, A.; et al. An α-Gal-containing neoglycoprotein-based vaccine partially protects against murine cutaneous leishmaniasis caused by Leishmania major. PLoS Negl. Trop. Dis. 2017, 11, e0006039. [Google Scholar] [CrossRef]
- Mateos-Hernández, L.; Rakotobe, S.; Defaye, B.; Cabezas-Crus, A.; Simo, L. A Capsule-based model for immature hard tick stages infestation on laboratory mice. J. Vis. Exp. 2020, 161. [Google Scholar] [CrossRef]
- Castillo, M.; Martín-Orúe, S.M.; Manzanilla, E.G.; Badiola, I.; Martín, M.; Gasa, J. Quantification of total bacteria, enterobacteria and lactobacilli populations in pig digesta by real-time PCR. Vet. Microbiol. 2006, 114, 165–170. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 9, e45. [Google Scholar] [CrossRef]
Ubiquitous Bacterial Families | Eigencentrality * | Relative Abundance * | ||
---|---|---|---|---|
I. scapularis | I. ricinus | I. scapularis | I. ricinus | |
Enterobacteriaceae | 0.69 | 0.69 | 17.83 | 5.36 |
Corynebacteriaceae | 0.79 | 0.85 | 5.76 | 2.04 |
Pseudomonadaceae | 0.42 | 0.67 | 5.66 | 19.42 |
Sphingomonadaceae | 0.71 | 0.40 | 0.96 | 9.61 |
Gene Names (Reference Accessions) | Primer Sequences (5′–3′) | Annealing Temperature (°C) | Fragment Length (bp) |
---|---|---|---|
gspA (K02450) | 1. reaction gspA_F: GTTGGGTGAGGCTGGAAGTG gspA_R: TGCGATCCAGGGCAAATTCTG | 60 | 958 |
2. reaction (nested) gspAnest_F: TGAATCACCGCCGCATACT gspAnest_R: CTCATCACCACGGCAAGCT | 58 | 406 | |
waaL, rfaL (K02847) | waaL_F: CAATGCATATCGTGGCCCAA waaL_R: CCGACTGAAGTTCTGGTGTT | 58 | 573 |
waaO, rfaI (K03275) | waaO_F: GAACGGCTTAAGGCATTACC waaO_R: CTTGGCGCAATAACGAGCA | 56 | 654 |
waaR, waaT and rfaJ (K03276) | waaR_F: GTACACAGGTCTGGTCAAGA waaR_R: CAGACTCCTGCTATAATTCCTG | 56 | 685 |
waaJ and rfaJ (K03279) | waaJ_F: CCGTTAAACTTGATGAACGGGAA waaJ_R: TAGTTCGCCCAATCATGCCA | 60 | 748 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mateos-Hernández, L.; Obregón, D.; Maye, J.; Borneres, J.; Versille, N.; de la Fuente, J.; Estrada-Peña, A.; Hodžić, A.; Šimo, L.; Cabezas-Cruz, A. Anti-Tick Microbiota Vaccine Impacts Ixodes ricinus Performance during Feeding. Vaccines 2020, 8, 702. https://doi.org/10.3390/vaccines8040702
Mateos-Hernández L, Obregón D, Maye J, Borneres J, Versille N, de la Fuente J, Estrada-Peña A, Hodžić A, Šimo L, Cabezas-Cruz A. Anti-Tick Microbiota Vaccine Impacts Ixodes ricinus Performance during Feeding. Vaccines. 2020; 8(4):702. https://doi.org/10.3390/vaccines8040702
Chicago/Turabian StyleMateos-Hernández, Lourdes, Dasiel Obregón, Jennifer Maye, Jeremie Borneres, Nicolas Versille, José de la Fuente, Agustín Estrada-Peña, Adnan Hodžić, Ladislav Šimo, and Alejandro Cabezas-Cruz. 2020. "Anti-Tick Microbiota Vaccine Impacts Ixodes ricinus Performance during Feeding" Vaccines 8, no. 4: 702. https://doi.org/10.3390/vaccines8040702