Next Article in Journal
Courtship and Reproduction of the Whitetip Reef Shark Triaenodon obesus (Carcharhiniformes: Carcharhinidae) in an Ex Situ Environment, with a Description of the Late Embryonic Developmental Stage
Next Article in Special Issue
Daily Rhythms in the IGF-1 System in the Liver of Goldfish and Their Synchronization to Light/Dark Cycle and Feeding Time
Previous Article in Journal
A Qualitative Exploration of Challenges and Opportunities for Dog Welfare in Ireland Post COVID-19, as Perceived by Dog Welfare Organisations
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Interplay between Central and Peripheral Systems in Feed Intake Regulation in European Seabass (Dicentrarchus labrax) Juveniles

1
Departamento de Biologia, Faculdade de Ciências da Universidade do Porto, Rua do Campo Alegre s/n, Edifício FC4, 4169-007 Porto, Portugal
2
CIIMAR, Centro Interdisciplinar de Investigação Marinha e Ambiental, Universidade do Porto, Terminal de Cruzeiros do Porto de Leixões, Avenida General Norton de Matos s/n 289, 4450-208 Matosinhos, Portugal
3
FLATLANTIC—Atividades Piscícolas, S.A., Rua do Aceiros s/n, 3070-732 Praia de Mira, Portugal
*
Author to whom correspondence should be addressed.
Animals 2022, 12(23), 3287; https://doi.org/10.3390/ani12233287
Submission received: 31 October 2022 / Revised: 21 November 2022 / Accepted: 23 November 2022 / Published: 25 November 2022
(This article belongs to the Special Issue Factors Affecting Fish Food Intake)

Abstract

:

Simple Summary

The effect of feeding and feed deprivation on the regulation of feed intake in European seabass was evaluated. European seabass possess feed intake regulation mechanisms similar to those found in mammals and fish. Fasting and feeding conditions induce different responses in feed intake regulation mechanisms in European seabass. The present results are important to identify and understand the mechanisms of appetite regulation of European seabass, and therefore contribute to feeding optimization processes, ensuring the growth and sustainability of the aquaculture industry.

Abstract

The present study aimed to evaluate the effects of feeding or feed deprivation on the orexigenic and anorexigenic responses at the central (whole brain) and peripheral (anterior and posterior intestine, stomach, and liver) system levels in European seabass. For this purpose, a group of fish (208 g) was fed a single meal daily for 8 days (fed group) and another group was feed-deprived for 8 days (unfed group). Compared to the fed group, in the whole brain, feed deprivation did not induce changes in npy, agrp1, and cart2 expression, but increased agrp2 and pomc1 expression. In the anterior intestine, feed deprivation increased cck expression, while in the posterior intestine, the npy expression increased and pyyb decreased. In the stomach, the ghr expression decreased regardless of the feeding status. The hepatic lep expression increased in the unfed fish. The present results suggest a feed intake regulation mechanism in European seabass similar to that observed in other teleosts.

1. Introduction

Feeding is one of the most important practices in the aquaculture industry, ensuring the good development, growth performance, and welfare of the cultured species. Nowadays, aquaculture mainly relies on the production of fed species, implying the use of aquafeeds [1]. However, aquafeeds represent 50–70% of variable costs [2]. Therefore, understanding the feed intake regulation is of high relevance for the adequate management feeding the profitability of aquaculture.
As in other vertebrates, feed intake regulation mechanisms in fish present a complex interaction between the central nervous system, the peripheral systems, and the environment [3,4,5,6]. Furthermore, the animal’s nutritional status provides an important stimulus for the regulation of feed intake mechanisms [5]. Under satiation or fasting, different peripheral peptides and hormones, namely leptin, ghrelin, cholecystokinin, and neuropeptide Y-related peptides, are produced and released into the bloodstream and directed to the hypothalamus. In the hypothalamus, information is integrated and induces changes in the production of orexigenic or anorexigenic neuropeptides that stimulate or suppress appetite [3,6,7] (Figure 1).
The Neuropeptide Y family involves structurally related peptides comprising neuropeptide y (npy), peptide YYa (pyya), peptide YYb (pyyb), and tetrapod pancreatic polypeptide (pp) [8,9]. Npy is considered one of the most potent orexigenic agents in mammals [10]. In fish, npy is found in the central and peripheral systems and has also been described as having potent orexigenic action [4,7]. Npy is regulated by the nutritional status of fish and variations in npy expression were reported in several fish species in response to fasting and refeeding [11,12,13,14,15,16]. For instance, in goldfish (Carassius auratus), npy intracerebroventricular injection resulted in an increase in feed intake followed by a decrease in npy mRNA levels after feeding [17]. Additionally, in olive flounder (Paralichthys olivaceus), the intraperitoneal injection of npy increased feed intake and growth rate [18].
Pyy is a hormone with a structure similar to that of npy, mostly produced in the intestine L-cells, and has been described as an anorexigenic peptide in mammals [19,20]. In fish, pyy was described to be widely present in both the central and peripheral systems, and to also have anorexigenic functions [9]. Accordingly, in rainbow trout (Oncorhynchus mykiss) and Nile tilapia (Oreochromis niloticus), the intracerebroventricular injection of pyy decreased feed intake [21,22]. Previous studies also reported that pyy expression is affected by feeding or feed deprivation, increasing after a meal and decreasing during fasting, further supporting its anorectic effect in fish [23,24,25,26,27,28].
In mammals, agouti-related protein (agrp) is co-expressed in the hypothalamus along with npy, and also has an orexigenic effect by antagonizing central melanocortin receptors [29]. In fish, two isoforms of the agrp (1 and 2) gene have been identified, and both appear to play a role in the feed intake control by inducing appetite. Accordingly, it was shown that agrp1 and agrp2 mRNA levels increased during fasting, in goldfish (Carassius auratus), [30], zebrafish (Danio renio) [31], and Atlantic salmon (Salmo salar) [32]
Cocaine-and amphetamine-regulated transcript (cart) is a peptide with neurotransmitter and neuroendocrine functions with numerous key roles in pituitary hormone secretion, and energy metabolism, acting as an anorexigenic agent across the vertebrate phyla [4,6,7,33]. In goldfish, it was shown that intracerebroventricular cart injections decreased feed intake and growth rates [34]. Additionally, fasting decreased brain cart expression in several fish species, further supporting its anorexigenic action [11,14,35,36,37].
Proopiomelanocortin (pomc) is a precursor peptide that is post-transcriptionally processed into melanocortins, including melanocyte-stimulating hormones (a-, b- and c-MSH) and adrenocorticotropic hormone (ACTH). In mammals, pomc neurons produce α-MSH and cart, both inducing a decrease in feed intake [38]. As in mammals, fish hypothalamus co-expresses pomc and cart. However, the pomc role in feed intake regulation still needs to be clarified. For instance, in Atlantic halibut (Hippoglossus hippoglossus), pomc expression was higher half an hour after feeding but no differences were observed in the following hours [25]. On the contrary, in olive flounder (Paralichthys olivaceus), fasting increased pomc expression [39].
In mammals, cholecystokinin (cck) produced and released by the gastrointestinal tract endocrine cells acts as a satiety signal, reducing feed intake. In fish, cck is widely expressed both in the brain and gastrointestinal tract, and it was also shown to have an anorexigenic action in winter skate (Raja ocellata) [40], blunt snout bream (Megalobrama amblycephala) [41], white sea bream (Diplodus sargus) [42], channel catfish (Ictalurus punctatus) [13], and Ya fish (Schizothorax prenanti) [16].
In fish, as in mammals, ghrelin (ghr) is mainly synthesized in the stomach and is considered the most potent orexigenic hormone produced in the gastrointestinal tract [43]. Supporting its orexigenic action, it was shown that ghr increased after feed intake in goldfish [44,45], brown trout (Salmo truta) [46], cavefish (Astyanax fasciatus mexicanus) [47], and blunt snout bream [41]. However, in rainbow trout, contradictory results were obtained, as it was suggested that ghr might have orexigenic [48] and anorexigenic [49] functions.
Leptin (lep) is an anorexigenic hormone with several physiological functions in energy balance, fat deposition, and feed intake regulation, and in mammals, it is synthesized in the adipose tissue [50]. In contrast, in fish, even though adipose tissues also produce lep [51], the main lep producer is the liver. As in mammals, lep was also described as having a potent anorexigenic function in fish. Accordingly, it was shown that fasting led to a decrease in lep mRNA levels in striped bass (Morone saxatilis) [52], common carp (Cyprinus carpio) [53], and Ya fish [16].
European seabass (Dicentrarchus labrax) is a well-established species in European aquaculture, with a production of 84.430 tonnes in 2019 [54]. Thus, optimizing feeding without compromising the growth performance and health of European seabass is of great interest to the aquaculture industry. However, feeding optimization implies a deep knowledge of feeding control mechanisms and how feeding status affects feed intake. Thus, this study aimed to contribute to the understanding of the response mechanisms involved in feed intake regulation in European seabass juveniles.

2. Materials and Methods

2.1. Experimental Conditions

The trial was carried out at the Marine Zoological Station, Porto University, in a thermoregulated recirculation water system equipped with 8 cylindrical fiberglass tanks of 100 L capacity and supplied with a continuous seawater flow (3 L min−1). The trial was performed by accredited scientists according to FELASA category C recommendations and approved by the CIIMAR ethical committee for Managing Animal Welfare (ORBEA), in conformity with the European Union directive 2010/63/EU and the Portuguese Law (DL 113/2013).
European seabass was obtained from a commercial farm (Acuinuga S.L., Bertamiráns, Ames, Spain) and submitted to a quarantine period of one month before the trial. Then, fish with an average body weight of 208.0 ± 0.3 g were randomly distributed to 8 tanks (6 fish/tank) and two groups were randomly established as fed and unfed (four tanks per group). Both groups were fed once daily until apparent satiation with a commercial diet (Aquasoja Sustainable Feed-Standart Orange 4 MEO4; Sorgal, Ovar, Portugal) for 16 days, and then, the fed group continued to be fed for 8 days as above while the unfed group was kept without feeding during the while period.
During the trial, the water temperature was maintained at 23 ± 1 °C, salinity at 35 ± 1‰, dissolved oxygen was kept near saturation, ammonia and nitrites levels were kept around zero mg L−1, and a photoperiod of 12 h light:12 h dark was adopted.
At the end of the trial, both groups were sampled before (0 h) and at 3, 9, and 12 h hours after the feeding time. To prevent stress due to manipulation, a different tank of each group was sampled at each sampling time. The blood of six fish per treatment and sampling time was collected from the caudal vein using a heparinized syringe, placed in heparinized tubes, and centrifuged at 6800× g for 10 min at room temperature. The aliquots of the resultant plasma were stored at −20 °C for further analysis. After blood collection, the fish were euthanized with a sharp blow to the head and whole brain, and samples of the posterior and anterior intestine, stomach, and liver were collected, kept in RNA later (1:10) at 4 °C for 24 h, and then stored at −80 °C until RNA extraction.

2.2. Plasma Metabolites

Commercial kits from Spinreact, S.A. (Gerona, Spain) were used for plasma glucose (Kit cod. 1001191), triglycerides (Kit cod. 1001312), cholesterol (Kit cod. 1001092), and phospholipids (Kit cod. 1001140) analysis. All plasmatic parameters were analyzed using colorimetric reactions and absorbance was read in a Multiskan GO microplate reader (Model5111 9200; Thermo Scientific, Nanjing, China).

2.3. Gene Expression

The RNA of each tissue was isolated through homogenization in a Precellys evolution apparatus (Bertin Instruments, Montigny-le-Bretonneux, France) with TRIzol reagent (Direct-zolTM RNA Miniprep, Zymo Research) and following manufacturer recommendations. The RNA quality was assessed by electrophoresis on 1% agarose gel and the RNA quantity was checked by spectrophotometry (µDrop™ plate, ThermoScientific, Waltham, VA, USA). RNA concentration was adjusted to 0.5 µg/8 µL H2O for complementary DNA synthesis, utilizing the NZY First-Strand cDNA Synthesis Kit (NZYTech. MB12502, Lisbon, Portugal).
Gene expression was determined by real-time quantitative PCR analysis (CFX Connect™ Real-Time System, Bio-Rad, Hercules, CA, USA). The analysis mixture contains 0.4 µL diluted cDNA (1:1), 0.2 µL of each primer (10 µΜ), 5 µL SsoAdvanced Universal SYBR® Green supermix (Bio-Rad), and 4.2 µL DNase/RNASE/Protease-free water, in a total volume of 10 µL. The sequences of primers used are presented in Table 1. The pair of primers’ quality was analyzed with the Beacon Designer Program. Primer efficiency was validated with serial two-fold dilutions of cDNA and determined from the slope of the regression line of the quantification cycle (Ct) versus the relative concentration of cDNA [55]. Primer efficiency among 90 and 110% (slope −3.5 and 3.1, r2 = 0.99) were accepted. For agrp1, agrp2, npy, pomc1, cart2, cck, ghr, and lep primers pairs, the annealing temperature was determined through a temperature gradient. The reaction was initiated with incubation at 95 °C for 30 s for hot-start iTaqΤΜ DNA polymerase activation. A total of forty PCR cycles were performed, each consisting of heating at 95 °C for 15 s for denaturing, and 30 s for annealing and extension. The annealing temperature of each primer pair is presented in Table 1. Melting curves were systematically monotonized (60 °C temperature 0.5 °C 10 s−1 from 60 to 95 °C). Each PCR run included triplicates of reverse transcription for each sample and negative controls (reverse transcriptase-free samples, RNA-free samples). To normalize the results, previously validated reference genes, namely elongation factor 1α (ef1α) and 18S ribosomal RNA (18s), were used. The expression levels are given as the mean normalized values ± standard error (SE) corresponding to the ratio between copy numbers of the target gene transcripts and the geometric mean of copy numbers of the reference genes [56].

2.4. Statistical Analysis

All data were tested for normality and homogeneity of variances by the Shapiro–Wilk and Levene tests, respectively, and, when necessary, were log-transformed. Statistical analysis was performed by two-way ANOVA with feeding status (fed and unfed) and sampling times (0, 3, 9, and 12 h) as the main factors. When significant interaction between the main factors was observed, one-way ANOVA was used for each factor. Significant differences between the means were determined by Tukey’s multiple range test. The level of significance used was p < 0.05 for all statistical tests. All the statistical analysis was performed using the SPSS version 27 software package for Windows (IBM® SPSS® Statistics, Armonk, NY, USA).

3. Results

Plasmatic glucose levels were higher in the fed than in the unfed group, except at 12 h where the opposite was observed. No statistically significant differences in plasma glucose were observed with time in the fed group, while in the unfed group the highest glucose levels were observed at 3 and 12 h, and the lowest at 9 h (Figure 2a). Plasma cholesterol levels were not affected by feeding status or postprandial delay (Figure 2b). Plasma triglyceride levels were much higher in the fed (1000–1200 mg dL−1) than in the unfed (200–300 mg dL−1) group and were higher at 9 and 12 h than at the other sampling times, regardless of feeding status (Figure 2c). Plasma phospholipid levels were also higher in the fed (1400 mg dL−1) than in the unfed group (1200 mg dL−1) and no differences between sampling times were observed, regardless of the feeding status (Figure 2d).
In the brain, npy and cart2 expression were not affected by the feeding status or sampling times (Figure 3a,b, respectively). Differently, the agrp1 expression was 1-fold higher in the unfed than in the fed group and was not affected by sampling times (Figure 3a). The expression of agrp2 was not affected by sampling time except in the unfed group, where it peaked at 9 h (Figure 3a). The expression of pomc1 was not affected with time in the fed group, while in the unfed group, it increased from 9 h onwards, and at 12 h, it was 30-fold higher than in the fed group (Figure 3b). The Cck expression was not detected in the brain, either in the unfed or the fed fish.
In the anterior intestine, npy expression at 9 h it was 9-fold higher in the unfed than in the fed group, while at 12 h npy expression, it was 5-fold higher in the fed group than the unfed group, although differences between groups were not statistically significant (Figure 4a). The expression of pyyb was not affected by the feeding status and was higher at 3 and 9 h than at the other sampling times (Figure 4a). In contrast, the cck expression was not affected by the sampling time but was higher in the fed than in the unfed group (Figure 4a).
In the posterior intestine, the npy expression was lower in the fed than in the unfed group and, regardless of feeding status, it was higher at 0 h and 12 h than at the other sampling times (Figure 4b). The pyyb expression was not affected by the feeding status, but it was higher at 3 and 9 h than at the other sampling times (Figure 4b). The cck expression was not affected by feeding status or sampling times (Figure 4b).
In the stomach, the grh expression decreased with time in the unfed group while in the fed group it was not affected by the sampling time, and at 3 and 12 h, was 2-fold higher than in the unfed group (Figure 4c). Liver lep expression was not affected by feeding status and decreased with time from 0 to 9 in both groups (Figure 4c).

4. Discussion

Previous studies in European seabass have already reported the presence of some peptides and hormones that are known to be involved in feed intake regulation. However, their specific role in feed intake regulation in this species was not confirmed [57,58,59,60,61,62]. Thus, the present study aimed to elucidate the anorexigenic or orexigenic responses of some of these peptides and hormones in the central and peripheral systems of European seabass. As plasmatic biochemistry parameters are affected by feeding conditions, in this study, we also assessed the specific plasmatic metabolites that are known to be good indicators of the nutritional condition of European seabass [63].
In the present study, plasma glucose levels after 8 days of feed deprivation were circa 30% lower than that of fed fish. This is in agreement with the results of Pérez-Jiménez et al. (2007), also in this species, which reported a significant drop in plasma glucose on the first day of feed deprivation, with values remaining stable thereafter for at least 8 days. In contrast, Peres et al. (2014) reported that glucose levels were maintained for starvation period of at least 7 days. In the present study, no statistical differences in plasma glucose were noticed with time in the fed group. However, in absolute values, plasma glucose levels were higher at 3 h post-feeding (hpf) and decreased thereafter. Similarly, in a glucose tolerance test with European seabass, Peres et al. (1999) also observed that plasma glucose levels peaked at 3–6 h, decreasing thereafter.
In the present study, plasma triglyceride levels were nearly 80% lower in unfed fish compared to fed fish, while total cholesterol and phospholipids were not affected by feeding status. Peres et al. (2014) also reported a significant decrease in plasma triglyceride levels after 7 days of starvation while the total cholesterol levels were unaffected. Similarly, Pérez-Jiménez et al. (2007) observed a decrease in plasmatic triglycerides levels after 9 days of starvation. However, in contrast with the present study and that of Peres et al. (2014), these authors also reported a reduction in cholesterol levels after 9 days of starvation.
Npy is a potent orexigenic peptide in fish, mainly expressed in the brain and intestine [7,9,64]. Npy expression is known to vary with diet composition, meal frequency, and ration size, and circadian rhythm and feed deprivation are major inducers of npy expression [9,65,66]. On the contrary, during feeding, npy discharge usually occurs near feeding time and then it progressively decreases as feed ingestion proceeds [9]. In the present study, npy expression in the brain was similar in fed and unfed fish, suggesting that npy may not have an orexigenic role in European seabass. These results agree with those observed in Atlantic halibut [25], Atlantic salmon [35], and Atlantic cod (Gadus morhua) [11] but are contradictory to those observed in other fish species. For instance, in blunt snout bream [41], yellowtail [15], Nile tilapia [22], and channel catfish [13] npy expression in the brain increased through fasting, and decreased during feeding. Additionally, on the contrary to present results, other studies have reported a pre and postprandial variation of npy expression in response to a meal. For instance, in goldfish, npy expression increased 1–3 h before the meal and decreased 1–3 hpf [17]. Similarly, in Brazilian flounder (Paralichthys orbignyanus), the npy expression was elevated at mealtime and reduced at 2 hpf [67], and in fed Ya-fish, the npy expression decreased at 0.5, 1.5, 3, and 9 hpf [16].
It is known that the npy expression may differ in the different regions of the brain and analyzing the expression in the whole brain may not be sensitive sufficiently sensitive to detect differences in expression in the different brain regions. For instance, in goldfish, [17] observed a higher npy expression in telencephalon-preoptic than in the hypothalamus. In contrast, in winter skate, hypothalamic npy expression was not affected by feeding or fasting, while in the telencephalon, it was higher in fasted animals [14]. In Atlantic cod, the npy expression was higher in the telencephalon than in the hypothalamus and optic tectum, regardless of feeding status [11]. Further studies in European seabass should analyze the npy expression in different regions of the brain to further elucidate the role of npy in feed intake regulation.
In mammals, npy acts as a brain–gut peptide influencing gastrointestinal processes at the peripheral system level [20], and in fish, it was shown that it inhibits the contractile activity of the stomach in elasmobranchs [68,69,70], and induces vasorelaxation and intestinal contractions in Atlantic cod [71]. In the present study, fasting increases npy expression in anterior and posterior intestines, suggesting that, as in mammals, npy may act as a brain–gut peptide in European seabass. This agrees with what was observed in other fish species, including Atlantic cod [11], grass carp (Ctenopharyngodon idellus), [72] winter skate [14], winter flounder (Pseudopleuronectes americanus) [40], and yellowtail [15].
Peptide YY (pyy) and peptide Y (py) are npy-related peptides that have been described as important gut peptides in feed intake regulation and energy homeostasis [10]. There is, however, some controversy regarding the exact function and the evolutionary relationship of these peptides with the peptides of the npy-family. Previously, it was suggested that European seabass has orthologues of npy and pyy as well as py [73]. Py seems to be a pancreatic peptide present in fish instead of the pancreatic polypeptide (pp) that is found in mammals. Cerdá-Reverter et al. (2000) proposed that py arose from a copy of pyy after gene duplication and besides the pancreas, it is expressed in the brain and intestine, which are the main feed intake control areas. Upon reevaluating the phylogenetic evolution of the neuropeptide Y family, Sundström et al. (2008) concluded that py emerged as a duplicate of the pyy gene and should hence be called pyyb. The pyy gene (either pyya or pyyb, according to Sundström et al. (2008) was identified in several fish species, including Atlantic salmon [32], goldfish [23], Ya-fish [24], zebrafish, and pufferfish [74], and Nile tilapia [22], and was shown to have an anorexigenic function. In the present study, the pyyb expression was not affected by feeding status. However, it increased at 3hpf and then decreased with sampling time both in the anterior and posterior intestines, suggesting that it may have an anorexigenic function, as in other fish species. Further studies are, however, necessary to better elucidate the role of pyy in the feed-intake regulation in European seabass.
The neuropeptides agrp1 and agrp2 are involved in energy regulation, and their orexigenic role in feed intake regulation was confirmed in several fish species, including Atlantic salmon [35,75], zebrafish [31,76], goldfish [77], Ya fish [16], and Arctic Charr (Salvelinus alpinus) [78]. Both agrp isoforms were previously confirmed in European seabass and were shown to be mainly expressed in the brain, ovary, posterior kidney, pineal organ, and ventral skin [58]. It was also observed that agrp1 expression increased during a long-term fasting period (8–29 days), while agrp2 decreased after 15 days of fasting [58]. This suggests that agrp1 and agrp2 may have different mechanisms of action in the feed intake regulation of European seabass. Accordingly, in the present study, agrp1 expression was affected by the feeding status being higher in the unfed fish, while agrp2 expression was similar in both groups, except at 9 h, at which it peaked in the unfed fish. Further studies are needed to better understand the specific role of agrp1 and agrp2 in the feed intake regulation of European seabass.
The cart gene is strongly conserved within vertebrates, and conserves several physiological functions in different species [33]. In fish, several cart isoforms have been described, possibly due to the genome duplication that fish experienced [4]. For instance, seven cart isoforms were identified in Senegalese sole (Solea senegalensis). However, only three isoforms (cart1a, cart2a, and cart4) have been shown to respond to feeding, being up-regulated in the post-feeding period [37]. To date, only one cart isoform, cart2 was identified in European seabass [79]. In the present study, cart2 expression was similar in fed and unfed European seabass. The absence of cart2 response to feeding could be related to the isoform evaluated, which may not be the one involved in feed intake regulation. Accordingly, Bonacic et al. (2015) identified two cart2 isoforms in Senegalese sole, but only cart2a responded to feeding. Thus, further studies are necessary to establish the possible existence of cart isoforms in European seabass.
Although the presence of several cart isoforms is well established in fish, in some species, the existence of only one cart isoform was reported. In such cases, and similarly to what was observed in the present study, there was no modulation in cart expression in fed or unfed fish. [14,25].
In European seabass, only one functional pomc isoform (pomc1) was identified, and it was mainly expressed in the central system [59]. In the present study, pomc1 expression in the whole brain was very low, and almost undetected in the fed European seabass. In the unfed group, an increase in pomc1 expression was observed between 9 and 12 h, suggesting an orexigenic role of pomc1 in feed intake regulation in European seabass. In fish, the role of pomc in feed intake regulation is still largely unexplored and seems to be dependent on the pomc isoform, fish species, and fish nutritional status. For instance, in olive flounder, three pomc isoforms were identified, while the pomc1 and pomc3 expressions were not affected by feeding status, the pomc2 expression increased during fasting, suggesting that it has an orexigenic role in this species [39]. In Atlantic salmon, four functional pomc isoforms were identified (pomca1/a2/a2s/b), but only pomca1 expression was affected by feeding, increasing at 3 hpf, and indicating that it had an anorexigenic role [80]. In rainbow trout, 14 days of feed deprivation did not affect hypothalamic pomca1, pomca2, pomca2s, or pomcb expression, but a 50% reduction in pomca1 expression was observed after 28 days of fasting [81].
Cck is an important gut hormone, previously described as having a potent anorexigenic function in European seabass [82]. The authors showed that the oral administration of cck decreased the appetite of European seabass. Accordingly, in the present study, in the fed group, an increase in cck expression was observed at 3 and 12 hpf, while in the unfed group, the cck expression was lower and similar along the sampling times. In contrast, in the posterior intestine, no effects of feeding or fasting were observed in the cck expression. These results further support an anorexigenic action of cck in European seabass and are in line with the results observed in other fish species, such as yellowtail [83,84], blunt snout bream [41], cunner [85], zebrafish [86], winter flounder [40], Atlantic salmon [80], and channel catfish [13].
In fish, the role of grh in feed-intake control is still controversial. For example, an orexigenic action of ghr was reported in grass carp [87], blunt snout bream [41], zebrafish [88], goldfish [44], while an anorexigenic function was reported in Atlantic salmon [89] and rainbow trout [49]. In European seabass, ghr was reported as a potent orexigenic hormone, being up-regulated under starvation and downregulated during refeeding [61]. In the present study, in the fed group, ghr expression was higher—up to 3 h and 12 h after the meal. On the contrary, in the unfed group, ghr expression was higher at 0 h and then decreased until null expression was observed at 12 h. This supports the orexigenic action of ghr in European seabass, although it also indicates that even after 8 days of fasting, fish still seem to respond to the previously circadian feeding conditioning.
As in mammals, lep is involved in the regulation of energy balance in fish [90], interacting with different peptides and hormones, such as agrp, npy, and pomc in a feedback manner, decreasing the expression of orexigenic genes and up-regulating anorexigenic genes [51,53]. Previous studies reported an anorexigenic action of lep in fish [91]. In European seabass, lep appears to act differently. According to Gambardella et al. (2012), lep expression increased during fasting and decreased after refeeding, and in the present study, no significant differences in lep expression were observed between the fed and unfed fish. Further studies are needed to confirm the role of lep in the feed intake regulation of European seabass.

5. Conclusions

In conclusion, the present study shows that in European seabass, feeding did not induce significant changes in orexigenic and anorexigenic peptides and hormones at the central and peripheral levels. Feeding deprivation increased the agrp2 expression in whole-brain and npy in posterior intestine suggesting an orexigenic action. Further studies are necessary to further understand the role of the different neuropeptides and hormones in the feed intake regulation of European seabass and the specific mechanisms of action.

Author Contributions

Conceptualization, N.M., C.C., A.O.-T. and H.P.; methodology, N.M. and C.C.; validation, A.O.-T., C.C. and H.P.; formal analysis, N.M. and C.C.; investigation, N.M. and C.C.; writing—original draft preparation, N.M.; writing—C.C., H.P. and A.O.-T.; supervision, C.C., H.P. and A.O.-T.; funding acquisition, H.P., A.O.-T. and C.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the project R&D&I project “ATLANTIDA—Platform for the monitoring of the North Atlantic Ocean and tools for the sustainable exploitation of the marine resources”, reference NORTE-01-0145-FEDER-000040, funded by the North Portugal Regional Operational Program for Norte’s Regional Operational Program (NORTE2020); and Ocean3R (NORTE-01-0145-FEDER-000064), supported by the North Portugal Regional Operational Programme (NORTE2020), under the PORTUGAL 2020 Partnership Agreement and through the European Regional Development Fund (ERDF). Nicole Martins was supported by an FCT grant (SFRH/BD/137919/2018).

Institutional Review Board Statement

The experiment was conducted by accredited scientists following FELASA category C recommendations and approved by the CIIMAR ethical committee for Managing Animal Welfare (ORBEA), in compliance with the European Union directive 2010/63/EU and the Portuguese Law (DL 113/2013).

Informed Consent Statement

Not Applicable.

Data Availability Statement

Not Applicable.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Food and Agriculture Organization of the United Nations. The State of the World Fisheries and Aquaculture-Meeting the Sustainable Development Goals; FAO: Rome, Italy, 2022; Volume 50, pp. 50–5350. [Google Scholar] [CrossRef] [Green Version]
  2. Hasan, M.R. Feeding Global Aquaculture Growth. FAO Aquac. Newsl. 2017, 56, 2–3. [Google Scholar]
  3. Soengas, J.L.; Cerdá-Reverter, J.M.; Delgado, M.J. Central Regulation of Food Intake in Fish: An Evolutionary Perspective. J. Mol. Endocrinol. 2018, 60, R171–R199. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Volkoff, H.; Canosa, L.F.F.; Unniappan, S.; Cerdá-Reverter, J.M.M.; Bernier, N.J.J.; Kelly, S.P.P.; Peter, R.E.E. Neuropeptides and the Control of Food Intake in Fish. In General, and Comparative Endocrinology; Academic Press Inc.: Cambridge, MA, USA, 15 May 2005; Volume 142, pp. 3–19. [Google Scholar]
  5. Volkoff, H. The Neuroendocrine Regulation of Food Intake in Fish: A Review of Current Knowledge. Front. Neurosci. 2016, 10, 540. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Delgado, M.J.; Cerdá-Reverter, J.M.; Soengas, J.L. Hypothalamic Integration of Metabolic, Endocrine, and Circadian Signals in Fish: Involvement in the Control of Food Intake. Front. Neurosci. 2017, 11, 354. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Rønnestad, I.; Gomes, A.S.; Murashita, K.; Angotzi, R.; Jönsson, E.; Volkoff, H. Appetite-Controlling Endocrine Systems in Teleosts. Front. Endocrinol. 2017, 8, 73. [Google Scholar] [CrossRef] [Green Version]
  8. Sundström, G.; Larsson, T.A.; Brenner, S.; Venkatesh, B.; Larhammar, D. Evolution of the Neuropeptide Y Family: New Genes by Chromosome Duplications in Early Vertebrates and in Teleost Fishes. Gen. Comp. Endocrinol. 2008, 155, 705–716. [Google Scholar] [CrossRef]
  9. Assan, D.; Mustapha, U.F.; Chen, H.; Li, Z.; Peng, Y.; Li, G. The Roles of Neuropeptide Y (Npy) and Peptide YY (Pyy) in Teleost Food Intake: A Mini Review. Life 2021, 11, 547. [Google Scholar] [CrossRef]
  10. Loh, K.; Herzog, H.; Shi, Y.C. Regulation of Energy Homeostasis by the NPY System; Elsevier Current Trends: Amsterdam, The Netherlands, 2015; Volume 26, pp. 125–135. [Google Scholar]
  11. Kehoe, A.S.; Volkoff, H. Cloning and Characterization of Neuropeptide Y (NPY) and Cocaine and Amphetamine Regulated Transcript (CART) in Atlantic Cod (Gadus morhua). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2007, 146, 451–461. [Google Scholar] [CrossRef]
  12. Narnaware, Y.K.; Peter, R.E. Effects of Food Deprivation and Refeeding on Neuropeptide Y (NPY) MRNA Levels in Goldfish. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2001, 129, 633–637. [Google Scholar] [CrossRef]
  13. Peterson, B.C.; Waldbieser, G.C.; Riley, L.G.; Upton, K.R.; Kobayashi, Y.; Small, B.C. Pre- and Postprandial Changes in Orexigenic and Anorexigenic Factors in Channel Catfish (Ictalurus punctatus). Gen. Comp. Endocrinol. 2012, 176, 231–239. [Google Scholar] [CrossRef]
  14. MacDonald, E.; Volkoff, H. Neuropeptide Y (NPY), Cocaine- and Amphetamine-Regulated Transcript (CART) and Cholecystokinin (CCK) in Winter Skate (Raja ocellata): CDNA Cloning, Tissue Distribution and MRNA Expression Responses to Fasting. Gen. Comp. Endocrinol. 2009, 161, 252–261. [Google Scholar] [CrossRef]
  15. Hosomi, N.; Furutani, T.; Takahashi, N.; Masumoto, T.; Fukada, H. Yellowtail Neuropeptide Y: Molecular Cloning, Tissue Distribution, and Response to Fasting. Fish Sci. 2014, 80, 483–492. [Google Scholar] [CrossRef]
  16. Wei, R.; Zhou, C.; Yuan, D.; Wang, T.; Lin, F.; Chen, H.; Wu, H.; Xin, Z.; Yang, S.; Wang, Y.; et al. Characterization, Tissue Distribution and Regulation of NeuropeptideY in Schizothorax Prenanti. J. Fish Biol. 2014, 85, 278–291. [Google Scholar] [CrossRef]
  17. Narnaware, Y.K.; Peyon, P.P.; Lin, X.; Peter, R.E.C.N.-C. Regulation of Food Intake by Neuropeptide Y in Goldfish. Am. J. Physiol. Reg. I 2000, 279, R1025–R1034. [Google Scholar] [CrossRef] [Green Version]
  18. Li, M.; Tan, X.; Sui, Y.; Jiao, S.; Wu, Z.; Wang, L.; You, F. The Stimulatory Effect of Neuropeptide Y on Growth Hormone Expression, Food Intake, and Growth in Olive Flounder (Paralichthys olivaceus). Fish Physiol. Biochem. 2017, 43, 11–18. [Google Scholar] [CrossRef]
  19. Valassi, E.; Scacchi, M.; Cavagnini, F. Neuroendocrine Control of Food Intake. Nutr. Metab. Cardiovasc. Dis. 2008, 18, 158–168. [Google Scholar] [CrossRef]
  20. Holzer, P.; Reichmann, F.; Farzi, A. Neuropeptide Y, Peptide YY and Pancreatic Polypeptide in the Gut-Brain Axis. Neuropeptides 2012, 46, 261–274. [Google Scholar] [CrossRef] [Green Version]
  21. Velasco, C.; Blanco, A.M.; Unniappan, S.; Soengas, J.L. The Anorectic Effect of Central PYY1-36 Treatment in Rainbow Trout (Oncorhynchus mykiss) Is Associated with Changes in MRNAs Encoding Neuropeptides and Parameters Related to Fatty Acid Sensing and Metabolism. Gen. Comp. Endocrinol. 2018, 267, 137–145. [Google Scholar] [CrossRef]
  22. Yan, P.; Jia, J.; Yang, G.; Wang, D.; Sun, C.; Li, W. Duplication of Neuropeptide Y and Peptide YY in Nile Tilapia Oreochromis Niloticus and Their Roles in Food Intake Regulation. Peptides 2017, 88, 97–105. [Google Scholar] [CrossRef] [Green Version]
  23. Gonzalez, R.; Unniappan, S. Molecular Characterization, Appetite Regulatory Effects and Feeding Related Changes of Peptide YY in Goldfish. Gen. Comp. Endocrinol. 2010, 166, 273–279. [Google Scholar] [CrossRef]
  24. Yuan, D.; Zhou, C.; Wang, T.; Lin, F.; Chen, H.; Wu, H.; Wei, R.; Xin, Z.; Liu, J.; Gao, Y.; et al. Molecular Characterization and Tissue Expression of Peptide YY in Schizothorax Prenanti: Effects of Periprandial Changes and Fasting on Expression in the Hypothalamus. Regul. Pept. 2014, 190–191, 32–38. [Google Scholar] [CrossRef] [PubMed]
  25. Gomes, A.S.; Jordal, A.-E.O.; Olsen, K.; Harboe, T.; Power, D.M.; Rønnestad, I. Neuroendocrine Control of Appetite in Atlantic Halibut (Hippoglossus hippoglossus): Changes during Metamorphosis and Effects of Feeding. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2015, 183, 116–125. [Google Scholar] [CrossRef] [PubMed]
  26. Chen, H.; Zhang, X.; Hao, J.; Chen, D.; Liu, J.; Gao, Y.; Zhu, J.; Wu, H.; Lin, F.; Pu, Y.; et al. Molecular Cloning, Expression Analysis, and Appetite Regulatory Effect of Peptide YY in Siberian Sturgeon (Acipenser baerii). Gene 2015, 563, 172–179. [Google Scholar] [CrossRef]
  27. Wall, A.; Volkoff, H. Effects of Fasting and Feeding on the Brain MRNA Expressions of Orexin, Tyrosine Hydroxylase (TH), PYY and CCK in the Mexican Blind Cavefish (Astyanax fasciatus mexicanus). Gen. Comp. Endocrinol. 2013, 183, 44–52. [Google Scholar] [CrossRef] [PubMed]
  28. Volkoff, H. Appetite Regulating Peptides in Red-Bellied Piranha, Pygocentrus Nattereri: Cloning, Tissue Distribution and Effect of Fasting on MRNA Expression Levels. Peptides 2014, 56, 116–124. [Google Scholar] [CrossRef]
  29. Ollmann, M.M.; Wilson, B.D.; Yang, Y.; Kerns, J.A.; Gantz, I.; Barsh, G.S.; Ollmann, M.M.; Wilson, B.D.; Yang, Y.; Kerns, J.A.; et al. Antagonism of Central Melanocortin Receptores in Vitro and in Vivo by Agouti-Related Protein. Science 1997, 278, 135–138. [Google Scholar] [CrossRef]
  30. Cerda, M.; Peter, R.E. Endogenous Melanocortin Antagonist in Fish: Structure, Brain Mapping, and Regulation by Fasting of the Goldfish Agouti-Related Protein Gene. Endocrinology 2003, 144, 4552–4561. [Google Scholar] [CrossRef] [Green Version]
  31. Song, Y.; Golling, G.; Thacker, T.L.; Cone, R.D. Agouti-Related Protein (AGRP) Is Conserved and Regulated by Metabolic State in the Zebrafish, Danio rerio. Endocrine 2003, 22, 257–265. [Google Scholar] [CrossRef]
  32. Murashita, K.; Kurokawa, T.; Nilsen, T.O.; Rønnestad, I. Ghrelin, Cholecystokinin, and Peptide YY in Atlantic Salmon (Salmo salar): Molecular Cloning and Tissue Expression. Gen. Comp. Endocrinol. 2009, 160, 223–235. [Google Scholar] [CrossRef]
  33. Lau, J.; Herzog, H. CART in the Regulation of Appetite and Energy Homeostasis. Front. Neurosci. 2014, 8, 313. [Google Scholar] [CrossRef]
  34. Volkoff, H.; Peter, R.E. Effects of CART Peptides on Food Consumption, Feeding and Associated Behaviors in the Goldfish, Carassius auratus: Actions on Neuropeptide Y- and Orexin A-Induced Feeding. Brain Res. 2000, 887, 125–133. [Google Scholar] [CrossRef]
  35. Murashita, K.; Kurokawa, T.; Ebbesson, L.O.E.; Stefansson, S.O.; Rønnestad, I. Characterization, Tissue Distribution, and Regulation of Agouti-Related Protein (AgRP), Cocaine- and Amphetamine-Regulated Transcript (CART) and Neuropeptide Y (NPY) in Atlantic Salmon (Salmo salar). Gen. Comp. Endocrinol. 2009, 162, 160–171. [Google Scholar] [CrossRef]
  36. Fukada, H.; Murashita, K.; Senzui, A.; Masumoto, T. Multiple Cocaine- and Amphetamine-Regulated Transcript Genes in Yellowtail Seriola quinqueradiata: Cloning, Tissue Distribution in the Brain, and Response to Fasting and Fish Meal Soluble Fraction. Fish. Sci. 2021, 87, 55–64. [Google Scholar] [CrossRef]
  37. Bonacic, K.; Martínez, A.; Martín-Robles, Á.J.; Muñoz-Cueto, J.A.; Morais, S. Characterization of Seven Cocaine- and Amphetamine-Regulated Transcripts (CARTs) Differentially Expressed in the Brain and Peripheral Tissues of Solea senegalensis (Kaup). Gen. Comp. Endocrinol. 2015, 224, 260–272. [Google Scholar] [CrossRef]
  38. Coll, A.P.; Farooqi, I.S.; Challis, B.G.; Yeo, G.S.H.; O’Rahilly, S. Proopiomelanocortin and Energy Balance: Insights from Human and Murine Genetics. J. Clin. Endocrinol. Metab. 2004, 89, 2557–2562. [Google Scholar] [CrossRef] [Green Version]
  39. Kang, D.Y.; Kim, H.C. Functional Relevance of Three Proopiomelanocortin (POMC) Genes in Darkening Camouflage, Blind-Side Hypermelanosis, and Appetite of Paralichthys olivaceus. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2015, 179, 44–56. [Google Scholar] [CrossRef]
  40. MacDonald, E.; Volkoff, H. Cloning, Distribution and Effects of Season and Nutritional Status on the Expression of Neuropeptide Y (NPY), Cocaine and Amphetamine Regulated Transcript (CART) and Cholecystokinin (CCK) in Winter Flounder (Pseudopleuronectes Americanus). Horm. Behav. 2009, 56, 58–65. [Google Scholar] [CrossRef]
  41. Ji, W.; Ping, H.C.; Wei, K.J.; Zhang, G.R.; Shi, Z.C.; Yang, R.B.; Zou, G.W.; Wang, W.M. Ghrelin, Neuropeptide Y (NPY) and Cholecystokinin (CCK) in Blunt Snout Bream (Megalobrama amblycephala): CDNA Cloning, Tissue Distribution and MRNA Expression Changes Responding to Fasting and Refeeding. Gen. Comp. Endocrinol. 2015, 223, 108–119. [Google Scholar] [CrossRef]
  42. Micale, V.; Campo, S.; D’Ascola, A.; Guerrera, M.C.; Levanti, M.B.; Germanà, A.; Muglia, U. Cholecystokinin in White Sea Bream: Molecular Cloning, Regional Expression, and Immunohistochemical Localization in the Gut after Feeding and Fasting. PLoS ONE 2012, 7, e52428. [Google Scholar] [CrossRef] [Green Version]
  43. Unniappan, S.; Peter, R.E. Structure, Distribution and Physiological Functions of Ghrelin in Fish. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2005, 140, 396–408. [Google Scholar] [CrossRef]
  44. Unniappan, S.; Canosa, L.F.; Peter, R.E. Orexigenic Actions of Ghrelin in Goldfish: Feeding-Induced Changes in Brain and Gut MRNA Expression and Serum Levels, and Responses to Central and Peripheral Injections. Neuroendocrinology 2004, 79, 100–108. [Google Scholar] [CrossRef] [PubMed]
  45. Miura, T.; Maruyama, K.; Shimakura, S.I.; Kaiya, H.; Uchiyama, M.; Kangawa, K.; Shioda, S.; Matsuda, K. Neuropeptide Y Mediates Ghrelin-Induced Feeding in the Goldfish, Carassius auratus. Neurosci. Lett. 2006, 407, 279–283. [Google Scholar] [CrossRef] [PubMed]
  46. Tinoco, A.B.; Näslund, J.; Delgado, M.J.; de Pedro, N.; Johnsson, J.I.; Jönsson, E. Ghrelin Increases Food Intake, Swimming Activity and Growth in Juvenile Brown Trout (Salmo trutta). Physiol. Behav. 2014, 124, 15–22. [Google Scholar] [CrossRef] [PubMed]
  47. Penney, C.C.; Volkoff, H. Peripheral Injections of Cholecystokinin, Apelin, Ghrelin and Orexin in Cavefish (Astyanax fasciatus mexicanus): Effects on Feeding and on the Brain Expression Levels of Tyrosine Hydroxylase, Mechanistic Target of Rapamycin and Appetite-Related Hormones. Gen. Comp. Endocrinol. 2014, 196, 34–40. [Google Scholar] [CrossRef] [PubMed]
  48. Velasco, C.; Librán-Pérez, M.; Otero-Rodiño, C.; López-Patiño, M.A.; Míguez, J.M.; Cerdá-Reverter, J.M.; Soengas, J.L. Ghrelin Modulates Hypothalamic Fatty Acid-Sensing and Control of Food Intake in Rainbow Trout. J. Endocrinol. 2016, 228, 25–37. [Google Scholar] [CrossRef] [Green Version]
  49. Jönsson, E.; Kaiya, H.; Björnsson, B.T. Ghrelin Decreases Food Intake in Juvenile Rainbow Trout (Oncorhynchus mykiss) through the Central Anorexigenic Corticotropin-Releasing Factor System. Gen. Comp. Endocrinol. 2010, 166, 39–46. [Google Scholar] [CrossRef]
  50. Houseknecht, K.L.; Baile, C.A.; Matteri, R.L.; Spurlock, M.E. The Biology of Leptin: A Review. J. Anim. Sci. 1998, 76, 1405–1420. [Google Scholar] [CrossRef] [Green Version]
  51. Copeland, D.L.; Duff, R.J.; Liu, Q.; Prokop, J.; Londraville, R.L. Leptin in Teleost Fishes: An Argument for Comparative Study. Front. Physiol. 2011, 2, 26. [Google Scholar] [CrossRef] [Green Version]
  52. Heo, W.S.; Kim, Y.R.; Kim, E.Y.; Bai, S.C.; Kong, I.S. Effects of Dietary Probiotic, Lactococcus Lactis Subsp. Lactis I2, Supplementation on the Growth and Immune Response of Olive Flounder (Paralichthys olivaceus). Aquaculture 2013, 376–379, 20–24. [Google Scholar] [CrossRef]
  53. Huising, M.O.; Geven, E.J.W.; Kruiswijk, C.P.; Nabuurs, S.B.; Stolte, E.H.; Spanings, F.A.T.; Lidy Verburg-Van Kemenade, B.M.; Flik, G. Increased Leptin Expression in Common Carp (Cyprinus carpio) after Food Intake but Not after Fasting or Feeding to Satiation. Endocrinology 2006, 147, 5786–5797. [Google Scholar] [CrossRef]
  54. EUMOFA European Seabass (Dicentrarchus labrax)—Species Profile. Available online: https://www.eumofa.eu/documents/20178/137160/European+seabass_31-1.pdf (accessed on 30 August 2021).
  55. Pfaffl, M.W. A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
  56. Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate Normalization of Real-Time Quantitative RT-PCR Data by Geometric Averaging of Multiple Internal Control Genes. Genome Biol. 2002, 3, 1–12. [Google Scholar] [CrossRef] [Green Version]
  57. Cerdá-Reverter, J.M.; Anglade, I.; Martínez-Rodríguez, G.; Mazurais, D.; Muñoz-Cueto, J.A.; Carrillo, M.; Kah, O.; Zanuy, S. Characterization of Neuropeptide Y Expression in the Brain of a Perciform Fish, the Sea Bass (Dicentrarchus labrax). J. Chem. Neuroanat. 2000, 19, 197–210. [Google Scholar] [CrossRef]
  58. Agulleiro, M.J.; Cortés, R.; Leal, E.; Ríos, D.; Sánchez, E.; Cerdá-Reverter, J.M. Characterization, Tissue Distribution and Regulation by Fasting of the Agouti Family of Peptides in the Sea Bass (Dicentrarchus labrax). Gen. Comp. Endocrinol. 2014, 205, 251–259. [Google Scholar] [CrossRef]
  59. Varsamos, S.; Wendelaar Bonga, S.E.; Flik, G.; Queré, R.; Commes, T. Cloning of a Proopiomelanocortin CDNA from the Pituitary Gland of the Sea Bass (Dicentrarchus labrax) and Assessment of MRNA Expression in Different Tissues by Means of Real-Time PCR. J. Endocrinol. 2003, 176, 405–414. [Google Scholar] [CrossRef] [Green Version]
  60. Gambardella, C.; Gallus, L.; Amaroli, A.; Terova, G.; Masini, M.A.; Ferrando, S. Fasting and Re-Feeding Impact on Leptin and Aquaglyceroporin 9 in the Liver of European Sea Bass (Dicentrarchus labrax). Aquaculture 2012, 354–355, 1–6. [Google Scholar] [CrossRef]
  61. Terova, G.; Rimoldi, S.; Bernardini, G.; Gornati, R.; Saroglia, M. Sea Bass Ghrelin: Molecular Cloning and MRNA Quantification during Fasting and Refeeding. Gen. Comp. Endocrinol. 2008, 155, 341–351. [Google Scholar] [CrossRef]
  62. Tillner, R.; Rønnestad, I.; Dhert, P.; Ueberschär, B. The Regulatory Loop between Gut Cholecystokinin and Tryptic Enzyme Activitcxuy in Sea Bass (Dicentrarchus labrax) Larvae Is Influenced by Different Feeding Regimes and Trigger Substances. Aquaculture 2014, 420–421, 139–146. [Google Scholar] [CrossRef]
  63. Peres, H.; Santos, S.; Oliva-Teles, A. Blood Chemistry Profile as Indicator of Nutritional Status in European Seabass (Dicentrarchus labrax). Fish Physiol. Biochem. 2014, 40, 1339–1347. [Google Scholar] [CrossRef]
  64. Volkoff, H. The Role of Neuropeptide Y, Orexins, Cocaine and Amphetamine-Related Transcript, Cholecystokinin, Amylin and Leptin in the Regulation of Feeding in Fish. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2006, 144, 325–331. [Google Scholar] [CrossRef]
  65. Hoskins, L.J.; Volkoff, H. Daily Patterns of MRNA Expression of Two Core Circadian Regulatory Proteins, Clock2 and Per1, and Two Appetite-Regulating Peptides, OX and NPY, in Goldfish (Carassius auratus). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2012, 163, 127–136. [Google Scholar] [CrossRef] [PubMed]
  66. Narnaware, Y.K.; Peter, R.E. Influence of Diet Composition on Food Intake and Neuropeptide Y (NPY) Gene Expression in Goldfish Brain. Regul. Pept. 2002, 103, 75–83. [Google Scholar] [CrossRef] [PubMed]
  67. Campos, V.F.; Robaldo, R.B.; Deschamps, J.C.; Seixas, F.K.; McBride, A.J.A.; Marins, L.F.; Okamoto, M.; Sampaio, L.A.; Collares, T. Neuropeptide Y Gene Expression around Mealtime in the Brazilian Flounder Paralichthys orbignyanus. J. Biosci. 2012, 37, 227–232. [Google Scholar] [CrossRef] [PubMed]
  68. Bjenning, C.; Holmgren, S.; Farrell, A.P. Neuropeptide Y Potentiates Contractile Response to Norepinephrine in Skate Coronary Artery. Am. J. Physiol. Hear. Circ. Physiol. 1993, 265, H661–H665. [Google Scholar] [CrossRef] [PubMed]
  69. Bjenning, C.; Hazon, N.; Balasubramaniam, A.; Holmgren, S.; Conlon, J.M. Distribution and Activity of Dogfish NPY and Peptide YY in the Cardiovascular System of the Common Dogfish. Am. J. Physiol. Regul. Integr. Comp. Physiol. 1993, 264, 1119. [Google Scholar] [CrossRef]
  70. Preston, E.; Jonsson, A.C.; McManus, C.D.; Conlon, J.M.; Courtice, G.P. Comparative Vascular Responses in Elasmobranchs to Different Structures of Neuropeptide Y and Peptide YY. Regul. Pept. 1998, 78, 57–67. [Google Scholar] [CrossRef]
  71. Shahbazi, F.; Holmgren, S.; Larhammar, D.; Jensen, J. Neuropeptide Y Effects on Vasorelaxation and Intestinal Contraction in the Atlantic Cod Gadus morhua. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2002, 282, 1414–1421. [Google Scholar] [CrossRef] [Green Version]
  72. Zhou, Y.; Liang, X.F.; Yuan, X.; Li, J.; He, Y.; Fang, L.; Guo, X.; Liu, L.; Li, B.; Shen, D. Neuropeptide Y Stimulates Food Intake and Regulates Metabolism in Grass Carp, Ctenopharyngodon idellus. Aquaculture 2013, 380–383, 52–61. [Google Scholar] [CrossRef]
  73. Cerdá-Reverter, J.M.; Martínez-Rodríguez, G.; Zanuy, S.; Carrillo, M.; Larhammar, D. Molecular Evolution of the Neuropeptide Y (NPY) Family of Peptides: Cloning of Three NPY-Related Peptides from the Sea Bass (Dicentrarchus labrax). Regul. Pept. 2000, 95, 25–34. [Google Scholar] [CrossRef]
  74. Sundström, G.; Larsson, T.A.; Brenner, S.; Venkatesh, B.; Larhammar, D. Ray-Fin Fish Tetraploidization Gave Rise to Pufferfish Duplicates of NPY and PYY, but Zebrafish NPY Duplicate Was Lost. Ann. N. Y. Acad. Sci. 2005, 1040, 476–478. [Google Scholar] [CrossRef]
  75. Kalananthan, T.; Murashita, K.; Rønnestad, I.; Ishigaki, M.; Takahashi, K.; Silva, M.S.; Wakabayashi, Y.; Lai, F.; Shimizu, M.; Nilsen, T.O.; et al. Hypothalamic Agrp and Pomc MRNA Responses to Gastrointestinal Fullness and Fasting in Atlantic Salmon (Salmo salar, L.). Front. Physiol. 2020, 11, 61. [Google Scholar] [CrossRef] [Green Version]
  76. Drew, R.E.; Rodnick, K.J.; Settles, M.; Wacyk, J.; Churchill, E.; Powell, M.S.; Hardy, R.W.; Murdoch, G.K.; Hill, R.A.; Robison, B.D. Effect of Starvation on Transcriptomes of Brain and Liver in Adult Female Zebrafish (Danio rerio). Physiol. Genomics 2008, 35, 283–295. [Google Scholar] [CrossRef] [Green Version]
  77. Striberny, A.; Ravuri, C.S.; Jobling, M.; Jørgensen, E.H.; Fuentes, J. Seasonal Differences in Relative Gene Expression of Putative Central Appetite Regulators in Arctic Charr (Salvelinus alpinus) Do Not Reflect Its Annual Feeding Cycle. PLoS ONE 2015, 10, 1–13. [Google Scholar] [CrossRef] [Green Version]
  78. Basto, A.; Valente, L.M.P.; Conde-Sieira, M.; Soengas, J.L. Central Regulation of Food Intake Is Not Affected by Inclusion of Defatted Tenebrio Molitor Larvae Meal in Diets for European Sea Bass (Dicentrarchus labrax). Aquaculture 2021, 544, 737088. [Google Scholar] [CrossRef]
  79. Valen, R.; Jordal, A.E.O.; Murashita, K.; Rønnestad, I. Postprandial Effects on Appetite-Related Neuropeptide Expression in the Brain of Atlantic salmon, Salmo salar. Gen. Comp. Endocrinol. 2011, 171, 359–366. [Google Scholar] [CrossRef]
  80. Leder, E.H.; Silverstein, J.T. The Pro-Opiomelanocortin Genes in Rainbow Trout (Oncorhynchus mykiss): Duplications, Splice Variants, and Differential Expression. J. Endocrinol. 2006, 188, 355–363. [Google Scholar] [CrossRef]
  81. Rubio, V.C.C.; Sánchez-Vázquez, F.J.J.; Madrid, J.A.A. Role of Cholecystokinin and Its Antagonist Proglumide on Macronutrient Selection in European Sea Bass Dicentrarchus labrax, L. Physiol. Behav. 2008, 93, 862–869. [Google Scholar] [CrossRef]
  82. Murashita, K.; Fukada, H.; Hosokawa, H.; Masumoto, T. Changes in Cholecystokinin and Peptide Y Gene Expression with Feeding in Yellowtail (Seriola quinqueradiata): Relation to Pancreatic Exocrine Regulation. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2007, 146, 318–325. [Google Scholar] [CrossRef]
  83. Murashita, K.; Fukada, H.; Rønnestad, I.; Kurokawa, T.; Masumoto, T. Nutrient Control of Release of Pancreatic Enzymes in Yellowtail (Seriola quinqueradiata): Involvement of CCK and PY in the Regulatory Loop. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2008, 150, 438–443. [Google Scholar] [CrossRef]
  84. Babichuk, N.A.; Volkoff, H. Changes in Expression of Appetite-Regulating Hormones in the Cunner (Tautogolabrus Adspersus) during Short-Term Fasting and Winter Torpor. Physiol. Behav. 2013, 120, 54–63. [Google Scholar] [CrossRef]
  85. Koven, W.; Schulte, P. The Effect of Fasting and Refeeding on MRNA Expression of PepT1 and Gastrointestinal Hormones Regulating Digestion and Food Intake in Zebrafish (Danio rerio). Fish Physiol. Biochem. 2012, 38, 1565–1575. [Google Scholar] [CrossRef] [PubMed]
  86. Feng, K.; Zhang, G.R.; Wei, K.J.; Xiong, B.X. Molecular Cloning, Tissue Distribution, and Ontogenetic Expression of Ghrelin and Regulation of Expression by Fasting and Refeeding in the Grass Carp (Ctenopharyngodon idellus). J. Exp. Zool. Part A Ecol. Genet. Physiol. 2013, 319, 202–212. [Google Scholar] [CrossRef] [PubMed]
  87. Eom, J.; Hong, M.; Cone, R.D.; Song, Y. Zebrafish Ghrelin Is Expressed in Pancreatic Endocrine Cells and Regulated by Metabolic State. Biochem. Biophys. Res. Commun. 2013, 439, 115–120. [Google Scholar] [CrossRef]
  88. Hevrøy, E.M.; Waagbø, R.; Torstensen, B.E.; Takle, H.; Stubhaug, I.; Jørgensen, S.M.; Torgersen, T.; Tvenning, L.; Susort, S.; Breck, O.; et al. Ghrelin Is Involved in Voluntary Anorexia in Atlantic salmon Raised at Elevated Sea Temperatures. Gen. Comp. Endocrinol. 2012, 175, 118–134. [Google Scholar] [CrossRef] [PubMed]
  89. Blanco, A.M.; Soengas, J.L. Leptin Signalling in Teleost Fish with Emphasis in Food Intake Regulation. Mol. Cell. Endocrinol. 2021, 526, 111209. [Google Scholar] [CrossRef]
  90. Won, E.T.; Baltzegar, D.A.; Picha, M.E.; Borski, R.J. Cloning and Characterization of Leptin in a Perciform Fish, the Striped Bass (Morone saxatilis): Control of Feeding and Regulation by Nutritional State. Gen. Comp. Endocrinol. 2012, 178, 98–107. [Google Scholar] [CrossRef]
  91. Yuan, D.; Wang, T.; Zhou, C.; Lin, F.; Chen, H.; Wu, H.; Wei, R.; Xin, Z.; Li, Z. Leptin and Cholecystokinin in Schizothorax Prenanti: Molecular Cloning, Tissue Expression, and MRNA Expression Responses to Periprandial Changes and Fasting. Gen. Comp. Endocrinol. 2014, 204, 13–24. [Google Scholar] [CrossRef]
Figure 1. Diagram showing the interaction of peptides and hormones at the central level (brain) and peripheral levels (intestine, liver, and stomach) involved in the regulation of food intake in fish and how they can be affected by feeding deprivation and feeding. agrp: Agouti-related peptide; cart: cocaine- and amphetamine-regulated transcript; cck: cholecystokinin; npy: neuropeptide Y; pomc: proopiomelanocortin; pyy: peptide YY; ghr: ghrelin.
Figure 1. Diagram showing the interaction of peptides and hormones at the central level (brain) and peripheral levels (intestine, liver, and stomach) involved in the regulation of food intake in fish and how they can be affected by feeding deprivation and feeding. agrp: Agouti-related peptide; cart: cocaine- and amphetamine-regulated transcript; cck: cholecystokinin; npy: neuropeptide Y; pomc: proopiomelanocortin; pyy: peptide YY; ghr: ghrelin.
Animals 12 03287 g001
Figure 2. Plasma glucose (a), total cholesterol (b), triglyceride (c), and phospholipid (d) levels of European seabass juveniles after 8 days pf feed deprivation (unfed) or continuous feeding (fed). Values are presented as means (n = 6) and standard error (SE). Small letters denote significant differences in sampling times regardless of feeding conditions and capital letters denote significant differences in sampling times between feeding conditions.
Figure 2. Plasma glucose (a), total cholesterol (b), triglyceride (c), and phospholipid (d) levels of European seabass juveniles after 8 days pf feed deprivation (unfed) or continuous feeding (fed). Values are presented as means (n = 6) and standard error (SE). Small letters denote significant differences in sampling times regardless of feeding conditions and capital letters denote significant differences in sampling times between feeding conditions.
Animals 12 03287 g002
Figure 3. Orexigenic (a) and anorexigenic (b) expressions in the central system of European seabass juveniles after 8 days of feed deprivation (unfed) or continuous feeding (fed). Data were normalized with two housekeeping genes, ribosomal 18S (18S) and α-elongation factor (ef1), according to [56]. Values are presented as means and standard error (SE). Small letters denote significant differences in sampling time under the same feeding conditions and capital letters denote significant differences in sampling times regardless of the feeding conditions. py: neuropeptide Y; agrp: Agouti-related protein; cart: cocaine-and amphetamine-regulated transcript; pomc: proopiomelanocortin.
Figure 3. Orexigenic (a) and anorexigenic (b) expressions in the central system of European seabass juveniles after 8 days of feed deprivation (unfed) or continuous feeding (fed). Data were normalized with two housekeeping genes, ribosomal 18S (18S) and α-elongation factor (ef1), according to [56]. Values are presented as means and standard error (SE). Small letters denote significant differences in sampling time under the same feeding conditions and capital letters denote significant differences in sampling times regardless of the feeding conditions. py: neuropeptide Y; agrp: Agouti-related protein; cart: cocaine-and amphetamine-regulated transcript; pomc: proopiomelanocortin.
Animals 12 03287 g003
Figure 4. mRNA relative expression of main hormones and peptides in the peripheral systems anterior intestine (a), posterior intestine (b), liver and stomach (c) of European seabass days after feed deprivation (unfed) or continuous feeding (fed). Data were normalized with two housekeeping genes, ribosomal 18S (18S) and α-elongation factor (ef1), according to [56]. Values are presented as means and standard error (SE). Small letters denote significant differences in sampling time under the same feeding conditions and capital letters denote significant differences in sampling times regardless of feeding conditions. npy: neuropeptide Y; pyyb: peptide YYb; cck: cholecystokinin; lep: leptin; ghr: ghrelin.
Figure 4. mRNA relative expression of main hormones and peptides in the peripheral systems anterior intestine (a), posterior intestine (b), liver and stomach (c) of European seabass days after feed deprivation (unfed) or continuous feeding (fed). Data were normalized with two housekeeping genes, ribosomal 18S (18S) and α-elongation factor (ef1), according to [56]. Values are presented as means and standard error (SE). Small letters denote significant differences in sampling time under the same feeding conditions and capital letters denote significant differences in sampling times regardless of feeding conditions. npy: neuropeptide Y; pyyb: peptide YYb; cck: cholecystokinin; lep: leptin; ghr: ghrelin.
Animals 12 03287 g004aAnimals 12 03287 g004b
Table 1. Sequences of primers used for real-time quantitative PCR determination of several genes involved in the feed-intake regulation mechanism in European seabass (Dicentrarchus labrax) 1.
Table 1. Sequences of primers used for real-time quantitative PCR determination of several genes involved in the feed-intake regulation mechanism in European seabass (Dicentrarchus labrax) 1.
GeneSequence (5′-3′)Ta (°C)Efficiency Accession Number
Central
agrp1F: TCTGCTGCGTCTCTCTTCTT62.02.01HE660086
R: TCTCTCCAGGTCAGACAGGT
agrp2F: GGGCAGAGGACACAAAGAAA62.02.01HE660087
R: TGTGACTTTCCTGTGGTGGA
cart2F: CCGAACCTGACCAGCGAGAA61.01.92MZ441181
R: GCTCCCCGACATCACACGTT
npyF: ACTCAGCCCTGAGACACTACA50.82.01AJ005378
R: ACTGTGGAAGCTGGTCTGTG
pomc1F: TCCCTGTTCTCTTCCTCCTC57.62.01AY691808
R: CTCTGCCGCTATAATCTCGC
Peripheral
cckF: TTCTCCTCCCAGCTCTTTGA60.01.92DLA_LG9_001730
R: GGAGTCTGCATCCTCCTCAG
ghrF: TTGCTGGTGGTTCTGTTGTG61.01.95DQ665912
R: TTGCCTCTGCTCTGAGGTTT
lepF: TCAGTCAGTGGAGGCAAGAG60.01.92KJ934254
R: TTTCAGCAGCAGATTGAGGA
pyybF: GGTGTGTTTGAGCAGCTTCG60.01.92AJ005380
R: CAGCGTCTTGGCTTGAATCG
Housekeeping
ef1αF: GCTTCGAGGAAATCACCAAG60.01.97AJ866727
R: CAACCTTCCATCCCTTGAAC
18sF: GGAGGTTCGAAGACGATCAG63.02.01AY831388.1
R: GAGGTTTCCCGTGTTGAGTC
1 agrp1, agouti-related peptide 1; agrp2, agouti-related peptide 2; cart2, cocaine-and-amphetamine-regulated transcript; npy, neuropeptide Y; pomc1, proopiomelanocortin 1; cck, cholecystokinin; ghr, ghrelin; lep, leptin; py, peptide Y; ef1α, elongation factor 1α; 18s, 18S ribosomal rRNA; Ta, annealing temperature.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Martins, N.; Castro, C.; Oliva-Teles, A.; Peres, H. The Interplay between Central and Peripheral Systems in Feed Intake Regulation in European Seabass (Dicentrarchus labrax) Juveniles. Animals 2022, 12, 3287. https://doi.org/10.3390/ani12233287

AMA Style

Martins N, Castro C, Oliva-Teles A, Peres H. The Interplay between Central and Peripheral Systems in Feed Intake Regulation in European Seabass (Dicentrarchus labrax) Juveniles. Animals. 2022; 12(23):3287. https://doi.org/10.3390/ani12233287

Chicago/Turabian Style

Martins, Nicole, Carolina Castro, Aires Oliva-Teles, and Helena Peres. 2022. "The Interplay between Central and Peripheral Systems in Feed Intake Regulation in European Seabass (Dicentrarchus labrax) Juveniles" Animals 12, no. 23: 3287. https://doi.org/10.3390/ani12233287

APA Style

Martins, N., Castro, C., Oliva-Teles, A., & Peres, H. (2022). The Interplay between Central and Peripheral Systems in Feed Intake Regulation in European Seabass (Dicentrarchus labrax) Juveniles. Animals, 12(23), 3287. https://doi.org/10.3390/ani12233287

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop