Screening of Deletion Variants within the Goat PRDM6 Gene and Its Effects on Growth Traits
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Goat Ear Tissues and Collection of Growth Trait Data
2.3. Primer Design and PCR Amplification
2.4. Statistical Analyses
3. Results
3.1. Identification of Insertion/Deletion Polymorphisms within the PRDM6 Gene
3.2. Genotyping and Genetic Parameters of Genetic Variations of the PRDM6 Gene
3.3. Correlations of the 12 bp Deletion within PRDM6 with Goat Growth Traits
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Van Heerden, S.M.; Strydom, P.E. Nutrient retention values and cooking yield factors for three South African lamb and mutton cuts. J. Sci. Food Agric. 2017, 97, 5037–5042. [Google Scholar] [CrossRef] [Scilit]
- Flakemore, A.R.; Malau-Aduli, B.S.; Nichols, P.D.; Malau-Aduli, A. Omega-3 fatty acids, nutrient retention values, and sensory meat eating quality in cooked and raw Australian lamb. Meat Sci. 2017, 123, 79–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coelho, T.; Braga, F.; Silva, N.; Dantas, C.; Lopes, J.C.; de Sousa, S.; Vieira, E.C. Optimization of the protein extraction method of goat meat using factorial design and response surface methodology. Food Chem 2019, 281, 63–70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, W.; Zhong, T.; Wang, L.J.; Li, L.; Zhang, H.P. Extensive female-mediated gene flow and low phylogeography among seventeen goat breeds in southwest China. Biochem. Genet. 2014, 52, 355–364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Yang, Q.; Wang, K.; Zhang, S.; Pan, C.; Chen, H.; Qu, L.; Yan, H.; Lan, X. A novel 12-bp indel polymorphism within the GDF9 gene is significantly associated with litter size and growth traits in goats. Anim. Genet. 2017, 48, 735–736. [Google Scholar] [CrossRef] [Scilit]
- La, Y.F.; Liu, Q.Y.; Zhang, L.P.; Chu, M.X. Single nucleotide polymorphisms in SLC5A1, CCNA1, and ABCC1 and the association with litter size in Small-tail han sheep. Animals 2019, 9, 432. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Liu, D.; Tang, S.; Li, D.; Han, R.; Tian, Y.; Li, H.; Li, G.; Li, W.; Liu, X.; et al. A multiallelic indel in the promoter region of the Cyclin-dependent kinase inhibitor 3 gene is significantly associated with body weight and carcass traits in chickens. Poult. Sci. 2019, 98, 556–565. [Google Scholar] [CrossRef] [Scilit]
- Van Laere, A.S.; Nguyen, M.; Braunschweig, M.; Nezer, C.; Collette, C.; Moreau, L.; Archibald, A.L.; Haley, C.S.; Buys, N.; Tally, M.; et al. A regulatory mutation in IGF2 causes a major QTL effect on muscle growth in the pig. Nature 2003, 425, 832–836. [Google Scholar] [CrossRef] [Scilit]
- Knorst, V.; Byrne, S.; Yates, S.; Asp, T.; Widmer, F.; Studer, B.; Kolliker, R. Pooled DNA sequencing to identify SNPs associated with a major QTL for bacterial wilt resistance in Italian ryegrass (Lolium multiflorum Lam.). Theor. Appl. Genet. 2019, 132, 947–958. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Yang, Q.; Wang, K.; Yan, H.; Pan, C.; Chen, H.; Liu, J.; Zhu, H.; Qu, L.; Lan, X. Two strongly linked single nucleotide polymorphisms (Q320P and V397I) in GDF9 gene are associated with litter size in cashmere goats. Theriogenology 2019, 125, 115–121. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Zhang, X.; Jiang, E.; Yan, H.; Zhu, H.; Chen, H.; Liu, J.; Qu, L.; Pan, C.; Lan, X. InDels within Caprine IGF2BP1 intron 2 and the 3’-untranslated regions are associated with goat growth traits. Anim. Genet. 2019, 51, 117–121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, Y.; Tan, L.J.; Chen, X.D.; Liu, Z.; Min, S.S.; Zeng, Q.; Shen, H.; Deng, H.W. Identification of novel potentially pleiotropic variants associated with osteoporosis and obesity using the cFDR method. J. Clin. Endocrinol. Metab. 2017, 103, 125–138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Riveros-McKay, F.; Mistry, V.; Bounds, R.; Hendricks, A.; Keogh, J.M.; Thomas, H.; Henning, E.; Corbin, L.J.; Understanding Society Scientific Group; O’Rahilly, S.; et al. Genetic architecture of human thinness compared to severe obesity. PLoS Genet. 2019, 15, e1007603. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jung, K.Y.; Kim, K.M.; Ku, E.J.; Kim, Y.J.; Lee, D.H.; Choi, S.H.; Jang, H.C.; Shin, C.S.; Park, K.S.; Lim, S. Age-and sex-specific association of circulating osteocalcin with dynamic measures of glucose homeostasis. Osteoporos. Int. 2016, 27, 1021–1029. [Google Scholar] [CrossRef] [Scilit]
- Boskey, A.L.; Imbert, L. Bone quality changes associated with aging and disease: A review. Ann. N. Y. Acad. Sci. 2017, 1410, 93–106. [Google Scholar] [CrossRef] [Scilit]
- Yang, Q.; Yan, H.; Li, J.; Xu, H.; Wang, K.; Zhu, H.; Chen, H.; Qu, L.; Lan, X. A novel 14-bp duplicated deletion within goat GHR gene is significantly associated with growth traits and litter size. Anim. Genet. 2017, 48, 499. [Google Scholar] [CrossRef] [Scilit]
- Zhang, S.; Jiang, E.; Wang, K.; Zhang, Y.; Yan, H.; Qu, L.; Chen, H.; Lan, X.; Pan, C. Two Insertion/Deletion Variants within SPAG17 Gene Are Associated with Goat Body Measurement Traits. Animals 2019, 9, 379. [Google Scholar] [CrossRef] [Scilit]
- Aljanabi, S.M.; Martinez, I. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques. Nucleic Acids Res. 1997, 25, 4692–4693. [Google Scholar] [CrossRef] [Scilit]
- Chen, M.; Wang, J.; Liu, N.; Cui, W.; Dong, W.; Xing, B.; Pan, C. SOX9: Expression profiles of sertoli cell (SCs) and a functional 18 bp indel affecting testis weight. Theriogenology 2019, 138, 94–101. [Google Scholar] [CrossRef]
- Zhu, H.; Zhang, Y.; Bai, Y.; Yang, H.; Yan, H.; Liu, J.; Shi, L.; Song, X.; Li, L.; Dong, S.; et al. Relationship between SNPs of POU1F1 gene and litter size and growth traits in Shaanbei white cashmere goats. Animals 2019, 9, 114. [Google Scholar] [CrossRef] [Scilit]
- Chen, M.; Yan, H.; Wang, K.; Cui, Y.; Chen, R.; Liu, W.; Zhu, H.; Qu, L.; Pan, C. Goat SPEF2: Expression profile, indel variants identification and association analysis with litter size. Theriogenology 2019, 139, 147–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, H.; Wu, X.; Cai, H.; Pan, C.; Lei, C.; Chen, H.; Lan, X. Genetic variants and effects on milk traits of the caprine paired-like homeodomain transcription factor 2 (PITX2) gene in dairy goats. Gene 2013, 532, 203–210. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, X.; Jia, W.; Zhang, J.; Li, X.; Pan, C.; Lei, C.; Chen, H.; Dang, R.; Lan, X. Determination of the novel genetic variants of goat STAT5A gene and their effects on body measurement traits in two Chinese native breeds. Small Ruminant Res. 2014, 121, 232–243. [Google Scholar] [CrossRef] [Scilit]
- Chen, F.; Shi, J.; Luo, Y.Q.; Sun, S.Y.; Pu, M. Genetic characterization of the gypsy moth from China (Lepidoptera, Lymantriidae) using inter simple sequence repeats markers. PLoS ONE 2013, 8, e73017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kang, Z.; Zhang, S.; He, L.; Zhu, H.; Wang, Z.; Yan, H.; Huang, Y.; Dang, R.; Lei, C.; Chen, H.; et al. A 14-bp functional deletion within the CMTM2 gene is significantly associated with litter size in goat. Theriogenology 2019, 139, 49–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gewies, A.; Castineiras-Vilarino, M.; Ferch, U.; Jährling, N.; Heinrich, K.; Hoeckendorf, U.; Przemeck, G.K.; Munding, M.; Groß, O.; Schroeder, T.; et al. Prdm6 is essential for cardiovascular development in vivo. PLoS ONE 2013, 8, e81833. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, N.; Subrahmanyan, L.; Smith, E.; Yu, X.; Zaidi, S.; Choi, M.; Mane, S.; Nelson-Williams, C.; Behjati, M.; Kazemi, M.; et al. Mutations in the histone modifier PRDM6 are associated with isolated nonsyndromic patent ductus arteriosus. Am. J. Hum. Genet. 2016, 98, 1082–1091. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; Ferguson, J.E.; Wang, H.; Kelley, R.; Ren, R.; McDonough, H.; Meeker, J.; Charles, P.C.; Wang, H.; Patterson, C. PRDM6 is enriched in vascular precursors during development and inhibits endothelial cell proliferation, survival, and differentiation. J. Mol. Cell Cardiol. 2008, 44, 47–58. [Google Scholar] [CrossRef] [Scilit]
- Fellous, A.; Earley, R.L.; Silvestre, F. The Kdm/Kmt gene families in the self-fertilizing mangrove rivulus fish, Kryptolebias marmoratus, suggest involvement of histone methylation machinery in development and reproduction. Gene 2019, 687, 173–187. [Google Scholar] [CrossRef] [Scilit]
- Kitsiou-Tzeli, S.; Tzetis, M. Maternal epigenetics and fetal and neonatal growth. Curr. Opin. Endocrinol. Diabetes Obes. 2017, 24, 43–46. [Google Scholar] [CrossRef] [Scilit]
- Gan, Y.M.; Zhou, J.; Quan, R.; Hong, L.J.; Li, Z.C.; Zheng, E.Q.; Liu, W.; Wu, Z.F.; Cai, G.Y.; Gu, T. Histone H3K27me3 in the regulation of skeletal muscle development. Hereditas 2019, 41, 285–292. [Google Scholar] [CrossRef] [PubMed]
- Martínez, J.A.; Milagro, F.I.; Claycombe, K.J.; Schalinske, K.L. Epigenetics in adipose tissue, obesity, weight loss, and diabetes. Adv. Nutr. 2014, 5, 71–81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marco, A.; Kisliouk, T.; Tabachnik, T.; Weller, A.; Meiri, N. DNA CpG methylation (5-methylcytosine) and its derivative (5-hydroxymethylcytosine) alter histone posttranslational modifications at the Pomc promoter, affecting the impact of perinatal diet on leanness and obesity of the offspring. Diabetes 2016, 65, 2258–2267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pigeyre, M.; Yazdi, F.T.; Kaur, Y.; Meyre, D. Recent progress in genetics, epigenetics and metagenomics unveils the pathophysiology of human obesity. Clin. Sci. 2016, 130, 943–986. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chi, J.; Cohen, P. The multifaceted roles of PRDM16: Adipose biology and beyond. Trends Endocrinol. Metab. 2016, 27, 11–23. [Google Scholar] [CrossRef] [Scilit]
- Xiang, G.; Ren, J.; Hai, T.; Fu, R.; Yu, D.; Wang, J.; Li, W.; Wang, H.; Zhou, Q. Editing porcine IGF2 regulatory element improved meat production in Chinese Bama pigs. Cell Mol. Life Sci. 2018, 75, 4619–4628. [Google Scholar] [CrossRef] [Scilit]
- Khalid, A.B.; Krum, S.A. Estrogen receptors alpha and beta in bone. Bone 2016, 87, 130–135. [Google Scholar] [CrossRef] [Scilit]
- Iravani, M.; Lagerquist, M.; Ohlsson, C.; Sävendahl, L. Regulation of bone growth via ligand-specific activation of estrogen receptor alpha. J. Endocrinol. 2017, 232, 403–410. [Google Scholar] [CrossRef] [Scilit]
- Mandon-Pépin, B.; Oustry-Vaiman, A.; Vigier, B.; Piumi, F.; Cribiu, E.; Cotinot, C. Expression profiles and chromosomal localization of genes controlling meiosis and follicular development in the sheep ovary. Biol. Reprod. 2003, 68, 985–995. [Google Scholar] [CrossRef] [Scilit]






| Primers | Sequences (5’-3’) | Position | RS Number | Length (bp) |
|---|---|---|---|---|
| PRDM6-P1 | F: GTTGATGAGGCAGGAGCCTT | upstream | rs656578433 | 126 |
| R: GATGCCAGTTTTGTGCCTGG | ||||
| PRDM6-P2 | F: GGATACAGGACAGTGTGGGC | Intron 1 | rs651603667 | 287/275 |
| R: CAACTCACTGAGCAAGGGGT |
| Traits | Yearling Population | Sizes | Adult Population | Sizes |
|---|---|---|---|---|
| heart girth (cm) | 73.12 | 529 | 83.48 | 421 |
| cannon circumference (cm) | 7.45 | 530 | 8.21 | 421 |
| chest depth (cm) | 25.89 | 530 | 29.46 | 421 |
| chest width (cm) | 18.94 | 530 | 20.99 | 421 |
| body height (cm) | 53.02 | 567 | 54.65 | 470 |
| body length (cm) | 62.30 | 566 | 68.04 | 470 |
| Hip-width (cm) | 13.03 | 530 | 14.99 | 421 |
| height at hip cross (cm) | 55.28 | 530 | 57.66 | 418 |
| body weight (kg) | 33.84 | 161 | 41.51 | 452 |
| Period | Genotypes | Frequency | Ho | He | PIC | χ2 (p Values) | |
|---|---|---|---|---|---|---|---|
| Genotypes | Alleles | ||||||
| Yearling | wt/wt (n = 321) | 0.566 | 0.752 (I) | 0.627 | 0.373 | 0.303 | 0.002 |
| (18 months old) | wt/del (n = 211) | 0.372 | 0.248 (D) | (p = 0.967) | |||
| del/del (n = 35) | 0.062 | ||||||
| Adult | wt/wt (n = 220) | 0.461 | 0.667 (I) | 0.556 | 0.444 | 0.346 | 2.717 |
| (36 months old) | wt/del (n = 196) | 0.411 | 0.333 (D) | (p = 0.099) | |||
| del/del (n = 61) | 0.128 | ||||||
| Sum sample | wt/wt (n = 541) | 0.518 | 0.713 (I) | 0.591 | 0.409 | 0.325 | 2.326 |
| wt/del (n = 407) | 0.390 | 0.287 (D) | (p = 0.127) | ||||
| del/del (n = 96) | 0.092 | ||||||
| Growth Traits | wt/wt (n = 321) | wt/del (n = 211) | del/del (n = 35) | p-Values |
|---|---|---|---|---|
| HG (cm) | 72.27 c ± 0.37 (n = 304) | 73.86 b ± 0.50 (n = 195) | 76.82 a ± 1.59 (n = 30) | 0.027 |
| CC (cm) | 7.37 C ± 0.04 (n = 305) | 7.54 B ± 0.05 (n = 195) | 7.65 A ± 0.15 (n = 30) | 0.008 |
| CD (cm) | 25.39 C ± 0.15 (n = 305) | 26.50 B ± 0.22 (n = 195) | 26.98 A ± 0.54 (n = 30) | 2.10 × 10−5 |
| CW (cm) | 18.62 C ± 0.14 (n = 305) | 19.27 B ± 0.19 (n = 195) | 20.05 A ± 0.49 (n = 30) | 0.004 |
| BH (cm) | 53.27 a ± 0.19 (n = 321) | 52.61 b ± 0.25 (n = 211) | 53.28 ab ± 0.48 (n = 35) | 0.032 |
| BL (cm) | 61.93 b ± 0.24 (n = 321) | 62.71 a ± 0.29 (n = 210) | 63.31 ab ± 0.86 (n = 35) | 0.044 |
| HW (cm) | 12.81 b ± 0.09 (n = 305) | 13.29 a ± 0.15 (n = 195) | 13.63 ab ± 0.41 (n = 30) | 0.014 |
| HHC (cm) | 55.40 ± 0.20 (n = 305) | 55.02 ± 0.26 (n = 195) | 55.86 ± 0.54 (n = 30) | 0.223 |
| BWT (kg) | 33.86 ± 1.08 (n = 58) | 33.49 ± 0.81 (n = 85) | 35.39 ± 1.64 (n = 18) | 0.345 |
| Growth Traits | wt/wt (n = 220) | wt/del (n = 196) | del/del (n = 61) | p-Values |
|---|---|---|---|---|
| HG (cm) | 83.16 ± 0.64 (n = 192) | 83.28 ± 0.64 (n = 173) | 85.21 ± 1.25 (n = 56) | 0.121 |
| CC (cm) | 8.18 ± 0.05 (n = 191) | 8.24 ± 0.06 (n = 173) | 8.21 ± 0.10 (n = 57) | 0.421 |
| CD (cm) | 29.51 ± 0.25 (n = 193) | 29.50 ± 0.25 (n = 172) | 29.19 ± 0.44 (n = 56) | 0.531 |
| CW (cm) | 21.05 ± 0.28 (n = 193) | 20.84 ± 0.29 (n = 172) | 21.27 ± 0.53 (n = 56) | 0.472 |
| BH (cm) | 54.24 ± 0.29 (n = 217) | 54.95 ± 0.33 (n = 193) | 55.19 ± 0.49 (n = 60) | 0.102 |
| BL (cm) | 68.05 ± 0.37 (n = 217) | 67.87 ± 0.43 (n = 193) | 68.55 ± 0.74 (n = 60) | 0.423 |
| HW (cm) | 14.87 ± 0.13 (n = 191) | 14.99 ± 0.16 (n = 173) | 15.39 ± 0.31 (n = 57) | 0.085 |
| HHC (cm) | 57.41 ± 0.30 (n = 192) | 57.68 ± 0.40 (n = 171) | 58.45 ± 0.50 (n = 55) | 0.280 |
| BWT (kg) | 40.85 ± 0.74 (n = 205) | 41.63 ± 0.80 (n = 186) | 43.39 ± 1.59 (n = 61) | 0.112 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Z.; Wang, C.; Guo, Y.; She, S.; Wang, B.; Jiang, Y.; Bai, Y.; Song, X.; Li, L.; Shi, L.; et al. Screening of Deletion Variants within the Goat PRDM6 Gene and Its Effects on Growth Traits. Animals 2020, 10, 208. https://doi.org/10.3390/ani10020208
Wang Z, Wang C, Guo Y, She S, Wang B, Jiang Y, Bai Y, Song X, Li L, Shi L, et al. Screening of Deletion Variants within the Goat PRDM6 Gene and Its Effects on Growth Traits. Animals. 2020; 10(2):208. https://doi.org/10.3390/ani10020208
Chicago/Turabian StyleWang, Zhen, Congliang Wang, Yongni Guo, Shuaishuai She, Baojing Wang, Yuru Jiang, Yangyang Bai, Xiaoyue Song, Longping Li, Lei Shi, and et al. 2020. "Screening of Deletion Variants within the Goat PRDM6 Gene and Its Effects on Growth Traits" Animals 10, no. 2: 208. https://doi.org/10.3390/ani10020208
APA StyleWang, Z., Wang, C., Guo, Y., She, S., Wang, B., Jiang, Y., Bai, Y., Song, X., Li, L., Shi, L., Qu, L., Lan, X., & Zhu, H. (2020). Screening of Deletion Variants within the Goat PRDM6 Gene and Its Effects on Growth Traits. Animals, 10(2), 208. https://doi.org/10.3390/ani10020208

