Next Article in Journal
Development of a Stage- and Species-Specific RNAi System for Molecular Insights in Trichogramma Wasps
Previous Article in Journal
Effects of Sitobion avenae Treated with Sublethal Concentrations of Dinotefuran on the Predation Function and Enzyme Activity of Harmonia axyridis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Correction

Correction: Zhang et al. Expression Profiling and Functional Analysis of Candidate Odorant Receptors in Galeruca daurica. Insects 2022, 13, 563

1
Research Center for Grassland Entomology, Inner Mongolia Agricultural University, Hohhot 010018, China
2
Erdos City Extension Center for Agriculture and Animal Husbandry Technology, Erdos 017200, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Insects 2025, 16(7), 672; https://doi.org/10.3390/insects16070672
Submission received: 23 June 2025 / Accepted: 25 June 2025 / Published: 27 June 2025
(This article belongs to the Section Insect Physiology, Reproduction and Development)
In the original publication [1], there was a mistake in Table S2. The dsGFP primers were listed incorrectly. The corrected Table S2 appears below. The authors state that the scientific conclusions are unaffected. This correction was approved by the Academic Editor. The original publication has also been updated.
Table S2. List of primers used in dsRNA synthesis.
Table S2. List of primers used in dsRNA synthesis.
NameForward Primer (5′ to 3′)Reverse Primer (5′ to 3′)
dsGdauOR4TAATACGACTCACTATAGGATGATGATGCATATTTCTCTAATACGACTCACTATAGGTCACATCATTTGTGTTAATAG
dsGdauOR11TAATACGACTCACTATAGGGAGCGAAGAAATACGAAGTGCCTTAATACGACTCACTATAGGGATGTTGTTCCCTGAACGCTTCT
dsGdauOR15TAATACGACTCACTATAGGGGTTGTAAGTGCCCAACTGTATATAATACGACTCACTATAGGGCACGTTGTGAAGAGTTCAGTTA
dsGdauORcoTAATACGACTCACTATAGGATTAAATACTGGGTCGAAAGACTAATACGACTCACTATAGGGAAATAGGTAACTACAGCACC
dsGFPTAATACGACTCACTATAGGGCACAAGTTCAGCGTGTCCGTAATACGACTCACTATAGGGTTCACCTTGATGCCGTTC
The underlined parts are the T7 promoter sequences.

Reference

  1. Zhang, J.-H.; Li, L.; Li, N.; Li, Y.-Y.; Pang, B.-P. Expression Profiling and Functional Analysis of Candidate Odorant Receptors in Galeruca daurica. Insects 2022, 13, 563. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, J.-H.; Li, L.; Li, N.; Li, Y.-Y.; Pang, B.-P. Correction: Zhang et al. Expression Profiling and Functional Analysis of Candidate Odorant Receptors in Galeruca daurica. Insects 2022, 13, 563. Insects 2025, 16, 672. https://doi.org/10.3390/insects16070672

AMA Style

Zhang J-H, Li L, Li N, Li Y-Y, Pang B-P. Correction: Zhang et al. Expression Profiling and Functional Analysis of Candidate Odorant Receptors in Galeruca daurica. Insects 2022, 13, 563. Insects. 2025; 16(7):672. https://doi.org/10.3390/insects16070672

Chicago/Turabian Style

Zhang, Jing-Hang, Ling Li, Na Li, Yan-Yan Li, and Bao-Ping Pang. 2025. "Correction: Zhang et al. Expression Profiling and Functional Analysis of Candidate Odorant Receptors in Galeruca daurica. Insects 2022, 13, 563" Insects 16, no. 7: 672. https://doi.org/10.3390/insects16070672

APA Style

Zhang, J.-H., Li, L., Li, N., Li, Y.-Y., & Pang, B.-P. (2025). Correction: Zhang et al. Expression Profiling and Functional Analysis of Candidate Odorant Receptors in Galeruca daurica. Insects 2022, 13, 563. Insects, 16(7), 672. https://doi.org/10.3390/insects16070672

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop