Correction: Zhang et al. Expression Profiling and Functional Analysis of Candidate Odorant Receptors in Galeruca daurica. Insects 2022, 13, 563
| Name | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
|---|---|---|
| dsGdauOR4 | TAATACGACTCACTATAGGATGATGATGCATATTTCTC | TAATACGACTCACTATAGGTCACATCATTTGTGTTAATAG |
| dsGdauOR11 | TAATACGACTCACTATAGGGAGCGAAGAAATACGAAGTGCCT | TAATACGACTCACTATAGGGATGTTGTTCCCTGAACGCTTCT |
| dsGdauOR15 | TAATACGACTCACTATAGGGGTTGTAAGTGCCCAACTGTATA | TAATACGACTCACTATAGGGCACGTTGTGAAGAGTTCAGTTA |
| dsGdauORco | TAATACGACTCACTATAGGATTAAATACTGGGTCGAAAGAC | TAATACGACTCACTATAGGGAAATAGGTAACTACAGCACC |
| dsGFP | TAATACGACTCACTATAGGGCACAAGTTCAGCGTGTCCG | TAATACGACTCACTATAGGGTTCACCTTGATGCCGTTC |
Reference
- Zhang, J.-H.; Li, L.; Li, N.; Li, Y.-Y.; Pang, B.-P. Expression Profiling and Functional Analysis of Candidate Odorant Receptors in Galeruca daurica. Insects 2022, 13, 563. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, J.-H.; Li, L.; Li, N.; Li, Y.-Y.; Pang, B.-P. Correction: Zhang et al. Expression Profiling and Functional Analysis of Candidate Odorant Receptors in Galeruca daurica. Insects 2022, 13, 563. Insects 2025, 16, 672. https://doi.org/10.3390/insects16070672
Zhang J-H, Li L, Li N, Li Y-Y, Pang B-P. Correction: Zhang et al. Expression Profiling and Functional Analysis of Candidate Odorant Receptors in Galeruca daurica. Insects 2022, 13, 563. Insects. 2025; 16(7):672. https://doi.org/10.3390/insects16070672
Chicago/Turabian StyleZhang, Jing-Hang, Ling Li, Na Li, Yan-Yan Li, and Bao-Ping Pang. 2025. "Correction: Zhang et al. Expression Profiling and Functional Analysis of Candidate Odorant Receptors in Galeruca daurica. Insects 2022, 13, 563" Insects 16, no. 7: 672. https://doi.org/10.3390/insects16070672
APA StyleZhang, J.-H., Li, L., Li, N., Li, Y.-Y., & Pang, B.-P. (2025). Correction: Zhang et al. Expression Profiling and Functional Analysis of Candidate Odorant Receptors in Galeruca daurica. Insects 2022, 13, 563. Insects, 16(7), 672. https://doi.org/10.3390/insects16070672
