Metabolic Disruption of Gold Nanospheres, Nanostars and Nanorods in Human Metastatic Prostate Cancer Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Synthesis of AuNP
2.2.1. Synthesis of AuNPsp-PEG
2.2.2. Synthesis of AuNPst-PEG
2.2.3. Synthesis of AuNPr-PEG
2.3. Characterization Methods of AuNPs
2.3.1. UV-Visible
2.3.2. Transmission Electron Microscopy
2.3.3. Scanning Electron Microscope
2.3.4. Dynamic Light Scattering and Zeta Potential
2.4. AuNPs-Cells In Vitro Assays
2.4.1. Cell Culture
2.4.2. Qualitative Analysis of the Cellular Uptake of AuNPs
2.4.3. Cellular Viability
2.4.4. Cellular Proliferation
2.4.5. Reactive Oxygen Species (ROS)
2.4.6. RNA Isolation and Gene Expression
2.5. Statistical Analysis
3. Results
3.1. Characterization of Different Shapes of AuNP
3.2. Qualitative Analysis of the Cellular Uptake of AuNPs-PEG
3.3. AuNPs Decrease Prostate Cancer Cells Viability
3.4. AuNPs Modulate Prostate Cancer Cell Proliferation
3.5. Cellular Internalization of AuNPs
3.6. Intracellular ROS Levels Depend on AuNPs-PEG Shape Treatment
3.7. AuNPs-PEG Shape Affects Mitochondria Biogenesis and Metabolic Function
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Khalid, K.; Tan, X.; Mohd Zaid, H.F.; Tao, Y.; Lye Chew, C.; Chu, D.-T.; Lam, M.K.; Ho, Y.-C.; Lim, J.W.; Chin Wei, L. Advanced in developmental organic and inorganic nanomaterial: A review. Bioengineered 2020, 11, 328–355. [Google Scholar] [CrossRef] [Green Version]
- Singh, P.; Pandit, S.; Mokkapati, V.; Garg, A.; Ravikumar, V.; Mijakovic, I. Gold Nanoparticles in Diagnostics and Therapeutics for Human Cancer. Int. J. Mol. Sci. 2018, 19, 1979. [Google Scholar] [CrossRef] [PubMed]
- Artiga, Á.; Serrano-Sevilla, I.; Matteis, L.D.; Mitchell, S.G.; Fuente, J.M.d.l. Current status and future perspectives of gold nanoparticle vectors for siRNA delivery. J. Mater. Chem. B 2019, 7, 876–896. [Google Scholar] [CrossRef]
- Hu, X.; Zhang, Y.; Ding, T.; Liu, J.; Zhao, H. Multifunctional Gold Nanoparticles: A Novel Nanomaterial for Various Medical Applications and Biological Activities. Front. Bioeng. Biotechnol. 2020, 8, 990. [Google Scholar] [CrossRef] [PubMed]
- Kawamura, G.; Nogami, M.; Matsuda, A. Shape-controlled metal nanoparticles and their assemblies with optical functionalities. J. Nanomater. 2013, 2013, 2. [Google Scholar] [CrossRef] [Green Version]
- Grzelczak, M.; Perez-Juste, J.; Mulvaney, P.; Liz-Marzan, L.M. Shape control in gold nanoparticle synthesis. Chem. Soc. Rev. 2008, 37, 1783–1791. [Google Scholar] [CrossRef] [PubMed]
- Langille, M.R.; Personick, M.L.; Zhang, J.; Mirkin, C.A. Defining Rules for the Shape Evolution of Gold Nanoparticles. J. Am. Chem. Soc. 2012, 134, 14542–14554. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.J.; Ahn, E.-Y.; Park, Y. Shape-dependent cytotoxicity and cellular uptake of gold nanoparticles synthesized using green tea extract. Nanoscale Res. Lett. 2019, 14, 129. [Google Scholar] [CrossRef] [Green Version]
- Chithrani, B.D.; Ghazani, A.A.; Chan, W.C. Determining the size and shape dependence of gold nanoparticle uptake into mammalian cells. Nano Lett. 2006, 6, 662–668. [Google Scholar] [CrossRef]
- Guerrini, L.; Alvarez-Puebla, R.A.; Pazos-Perez, N. Surface Modifications of Nanoparticles for Stability in Biological Fluids. Mater. 2018, 11, 1154. [Google Scholar] [CrossRef] [Green Version]
- Nakazawa, M.; Paller, C.; Kyprianou, N. Mechanisms of Therapeutic Resistance in Prostate Cancer. Curr. Oncol. Rep. 2017, 19, 13. [Google Scholar] [CrossRef] [Green Version]
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Powers, E.; Karachaliou, G.S.; Kao, C.; Harrison, M.R.; Hoimes, C.J.; George, D.J.; Armstrong, A.J.; Zhang, T. Novel therapies are changing treatment paradigms in metastatic prostate cancer. J. Hematol. Oncol. 2020, 13, 144. [Google Scholar] [CrossRef]
- Turkevich, J.; Stevenson, P.C.; Hillier, J. A study of the nucleation and growth processes in the synthesis of colloidal gold. Discuss. Faraday Soc. 1951, 11, 55–75. [Google Scholar] [CrossRef]
- Tian, Y.; Luo, S.; Yan, H.; Teng, Z.; Pan, Y.; Zeng, L.; Wu, J.; Li, Y.; Liu, Y.; Wang, S.; et al. Gold nanostars functionalized with amine-terminated PEG for X-ray/CT imaging and photothermal therapy. J. Mater. Chem. B 2015, 3, 4330–4337. [Google Scholar] [CrossRef]
- Scarabelli, L.; Sánchez-Iglesias, A.; Pérez-Juste, J.; Liz-Marzán, L.M. A “Tips and Tricks” Practical Guide to the Synthesis of Gold Nanorods. J. Phys. Chem. Lett. 2015, 6, 4270–4279. [Google Scholar] [CrossRef] [Green Version]
- ATCC. PC-3—CRL-1435|ATCC. 2022. Available online: https://www.atcc.org/products/crl-1435 (accessed on 11 January 2023).
- ATCC. A.T.C.C. LNCaP Clone FGC, ATCC® CRL-1740. Available online: https://www.atcc.org/products/crl-1740 (accessed on 11 January 2023).
- ATCC. DU 145—HTB-81|ATCC. 2022. Available online: https://www.atcc.org/products/htb-81 (accessed on 11 January 2023).
- Lall, N.; Henley-Smith, C.J.; De Canha, M.N.; Oosthuizen, C.B.; Berrington, D. Viability Reagent, PrestoBlue, in Comparison with Other Available Reagents, Utilized in Cytotoxicity and Antimicrobial Assays. Int. J. Microbiol. 2013, 2013, 420601. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sigma-Aldrich. Cell Proliferation ELISA BrdU (Colorimetric) Roche. Available online: http://www.sigmaaldrich.com/ (accessed on 11 January 2023).
- Ma, N.; Wu, F.-G.; Zhang, X.; Jiang, Y.-W.; Jia, H.-R.; Wang, H.-Y.; Li, Y.-H.; Liu, P.; Gu, N.; Chen, Z. Shape-Dependent Radiosensitization Effect of Gold Nanostructures in Cancer Radiotherapy: Comparison of Gold Nanoparticles, Nanospikes, and Nanorods. ACS Appl. Mater. Interfaces 2017, 9, 13037–13048. [Google Scholar] [CrossRef] [PubMed]
- Malugin, A.; Ghandehari, H. Cellular uptake and toxicity of gold nanoparticles in prostate cancer cells: A comparative study of rods and spheres. J. Appl. Toxicol. 2010, 30, 212–217. [Google Scholar] [CrossRef] [PubMed]
- Enea, M.; Pereira, E.; Costa, J.; Soares, M.E.; Dias da Silva, D.; Bastos, M.d.L.; Carmo, H.F. Cellular uptake and toxicity of gold nanoparticles on two distinct hepatic cell models. Toxicol. Vitr. 2021, 70, 105046. [Google Scholar] [CrossRef]
- Donahue, N.D.; Acar, H.; Wilhelm, S. Concepts of nanoparticle cellular uptake, intracellular trafficking, and kinetics in nanomedicine. Adv. Drug Deliv. Rev. 2019, 143, 68–96. [Google Scholar] [CrossRef] [PubMed]
- Amendola, V.; Meneghetti, M. Size Evaluation of Gold Nanoparticles by UV−vis Spectroscopy. J. Phys. Chem. C 2009, 113, 4277–4285. [Google Scholar] [CrossRef]
- Shard, A.G.; Wright, L.; Minelli, C. Robust and accurate measurements of gold nanoparticle concentrations using UV-visible spectrophotometry. Biointerphases 2018, 13, 061002. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fang, C.; Zhang, M. Nanoparticle-based theragnostics: Integrating diagnostic and therapeutic potentials in nanomedicine. J. Control. Release 2010, 146, 2–5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rahman, A.; Rahman, A.; Ghann, W.; Kang, H.-G.; Uddin, J. Terahertz multispectral imaging for the analysis of gold nanoparticles’ size and the number of unit cells in comparison with other techniques. Int. J. Biosens. Bioelectron. 2018, 4, 159–164. [Google Scholar] [CrossRef] [Green Version]
- Eaton, P.; Quaresma, P.; Soares, C.; Neves, C.; de Almeida, M.P.; Pereira, E.; West, P. A direct comparison of experimental methods to measure dimensions of synthetic nanoparticles. Ultramicroscopy 2017, 182, 179–190. [Google Scholar] [CrossRef]
- Cui, Z.; Huang, L.; Sun, M.; Gao, S.-t.; Cai, J.-h.; Li, W.; Shi, Y.-s.; Li, Q. Precise measurement of gold nanorods by using depolarized dynamic light scattering apparatus. Optoelectron. Lett. 2021, 17, 170–175. [Google Scholar] [CrossRef]
- Naha, P.C.; Chhour, P.; Cormode, D.P. Systematic in vitro toxicological screening of gold nanoparticles designed for nanomedicine applications. Toxicol. Vitr. 2015, 29, 1445–1453. [Google Scholar] [CrossRef] [Green Version]
- Woźniak, A.; Malankowska, A.; Nowaczyk, G.; Grześkowiak, B.F.; Tuśnio, K.; Słomski, R.; Zaleska-Medynska, A.; Jurga, S. Size and shape-dependent cytotoxicity profile of gold nanoparticles for biomedical applications. Journal of Materials Science. J. Mater. Sci. Mater. Med. 2017, 28, 92. [Google Scholar] [CrossRef]
- Hoang Thi, T.T.; Pilkington, E.H.; Nguyen, D.H.; Lee, J.S.; Park, K.D.; Truong, N.P. The Importance of Poly(ethylene glycol) Alternatives for Overcoming PEG Immunogenicity in Drug Delivery and Bioconjugation. Polymers 2020, 12, 298. [Google Scholar] [CrossRef] [Green Version]
- Arvizo, R.; Bhattacharya, R.; Mukherjee, P. Gold nanoparticles: Opportunities and Challenges in Nanomedicine. Expert Opin. Drug Deliv. 2010, 7, 753–763. [Google Scholar] [CrossRef] [Green Version]
- Jia, Y.-P.; Ma, B.-Y.; Wei, X.-W.; Qian, Z.-Y. The in vitro and in vivo toxicity of gold nanoparticles. Chin. Chem. Lett. 2017, 28, 691–702. [Google Scholar] [CrossRef]
- Ye, H.; Shen, Z.; Yu, L.; Wei, M.; Li, Y. Manipulating nanoparticle transport within blood flow through external forces: An exemplar of mechanics in nanomedicine. Proc. Math. Phys. Eng. Sci. 2018, 474, 20170845. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fytianos, K.; Rodriguez-Lorenzo, L.; Clift, M.J.D.; Blank, F.; Vanhecke, D.; Garnier, C.v.; Petri-Fink, A.; Rothen-Rutishauser, B.; Martin, C. Uptake efficiency of surface modified gold nanoparticles does not correlate with functional changes and cytokine secretion in human dendritic cells in vitro. Nanomed. Nanotechnol. Biol. Med. 2015, 11, 633–644. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Parsons, B.L. Many different tumor types have polyclonal tumor origin: Evidence and implications. Mutat. Res. 2008, 659, 232–247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lima, A.R.; Araújo, A.M.; Pinto, J.; Jerónimo, C.; Henrique, R.; Bastos, M.d.L.; Carvalho, M.; Guedes de Pinho, P. Discrimination between the human prostate normal and cancer cell exometabolome by GC-MS. Sci. Rep. 2018, 8, 5539. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sampson, N.; Neuwirt, H.; Puhr, M.; Klocker, H.; Eder, I.E. In vitro model systems to study androgen receptor signaling in prostate cancer. Endocr. Relat. Cancer 2013, 20, R49–R64. [Google Scholar] [CrossRef] [Green Version]
- Ravenna, L.; Principessa, L.; Verdina, A.; Salvatori, L.; Russo, M.A.; Petrangeli, E. Distinct phenotypes of human prostate cancer cells associate with different adaptation to hypoxia and pro-inflammatory gene expression. PLoS ONE 2014, 9, e96250. [Google Scholar] [CrossRef]
- Mironava, T.; Hadjiargyrou, M.; Simon, M.; Jurukovski, V.; Rafailovich, M.H. Gold nanoparticles cellular toxicity and recovery: Effect of size, concentration and exposure time. Nanotoxicology 2010, 4, 120–137. [Google Scholar] [CrossRef]
- Steckiewicz, K.P.; Barcinska, E.; Malankowska, A.; Zauszkiewicz–Pawlak, A.; Nowaczyk, G.; Zaleska-Medynska, A.; Inkielewicz-Stepniak, I. Impact of gold nanoparticles shape on their cytotoxicity against human osteoblast and osteosarcoma in in vitro model. Evaluation of the safety of use and anti-cancer potential. J. Mater. Sci. Mater. Med. 2019, 30, 22. [Google Scholar] [CrossRef] [Green Version]
- Tarantola, M.; Pietuch, A.; Schneider, D.; Rother, J.; Sunnick, E.; Rosman, C.; Pierrat, S.; Sönnichsen, C.; Wegener, J.; Janshoff, A. Toxicity of gold-nanoparticles: Synergistic effects of shape and surface functionalization on micromotility of epithelial cells. Nanotoxicology 2010, 5, 254–268. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.D.; Wu, D.; Shen, X.; Chen, J.; Sun, Y.M.; Liu, P.X.; Liang, X.J. Size-dependent radiosensitization of PEG-coated gold nanoparticles for cancer radiation therapy. Biomaterials 2012, 33, 6408–6419. [Google Scholar] [CrossRef] [Green Version]
- Shahhoseini, E.; Feltis, B.N.; Nakayama, M.; Piva, T.J.; Pouniotis, D.; Alghamdi, S.S.; Geso, M. Combined Effects of Gold Nanoparticles and Ionizing Radiation on Human Prostate and Lung Cancer Cell Migration. Int. J. Mol. Sci. 2019, 20, 4488. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Connor, E.E.; Mwamuka, J.; Gole, A.; Murphy, C.J.; Wyatt, M.D. Gold nanoparticles are taken up by human cells but do not cause acute cytotoxicity. Small 2005, 1, 325–327. [Google Scholar] [CrossRef] [PubMed]
- Chuang, S.M.; Lee, Y.H.; Liang, R.Y.; Roam, G.D.; Zeng, Z.M.; Tu, H.F.; Wang, S.K.; Chueh, P.J. Extensive evaluations of the cytotoxic effects of gold nanoparticles. Biochim. Biophys. Acta 2013, 1830, 4960–4973. [Google Scholar] [CrossRef]
- Favi, P.M.; Gao, M.; Johana Sepúlveda Arango, L.; Ospina, S.P.; Morales, M.; Pavon, J.J.; Webster, T.J. Shape and surface effects on the cytotoxicity of nanoparticles: Gold nanospheres versus gold nanostars. J. Biomed. Mater. Res. A 2015, 103, 3449–3462. [Google Scholar] [CrossRef]
- Favi, P.M.; Valencia, M.M.; Elliott, P.R.; Restrepo, A.; Gao, M.; Huang, H.; Pavon, J.J.; Webster, T.J. Shape and surface chemistry effects on the cytotoxicity and cellular uptake of metallic nanorods and nanospheres. J. Biomed. Mater. Res. A 2015, 103, 3940–3955. [Google Scholar] [CrossRef]
- Oliveira, A.B.; de Moraes, F.R.; Candido, N.M.; Sampaio, I.; Paula, A.S.; de Vasconcellos, A.; Silva, T.C.; Miller, A.H.; Rahal, P.; Nery, J.G.; et al. Metabolic Effects of Cobalt Ferrite Nanoparticles on Cervical Carcinoma Cells and Nontumorigenic Keratinocytes. J. Proteome Res. 2016, 15, 4337–4348. [Google Scholar] [CrossRef]
- Bo, Y.; Jin, C.; Liu, Y.; Yu, W.; Kang, H. Metabolomic analysis on the toxicological effects of TiO2 nanoparticles in mouse fibroblast cells: From the perspective of perturbations in amino acid metabolism. Toxicol. Mech. Methods 2014, 24, 461–469. [Google Scholar] [CrossRef]
- Garcia-Contreras, R.; Sugimoto, M.; Umemura, N.; Kaneko, M.; Hatakeyama, Y.; Soga, T.; Tomita, M.; Scougall-Vilchis, R.J.; Contreras-Bulnes, R.; Nakajima, H.; et al. Alteration of metabolomic profiles by titanium dioxide nanoparticles in human gingivitis model. Biomaterials 2015, 57, 33–40. [Google Scholar] [CrossRef]
- Warburg, O.; Wind, F.; Negelein, E. The Metabolism of Tumors in the Body. J. Gen. Physiol 1927, 8, 519–530. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Daemen, A.; Peterson, D.; Sahu, N.; McCord, R.; Du, X.; Liu, B.; Kowanetz, K.; Hong, R.; Moffat, J.; Gao, M.; et al. Metabolite profiling stratifies pancreatic ductal adenocarcinomas into subtypes with distinct sensitivities to metabolic inhibitors. Proc. Natl. Acad. Sci. USA 2015, 112, E4410–E4417. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, M.J.; Lee, S.J.; Yun, S.J.; Jang, J.Y.; Kang, H.; Kim, K.; Choi, I.H.; Park, S. Silver nanoparticles affect glucose metabolism in hepatoma cells through production of reactive oxygen species. Int. J. Nanomed. 2016, 11, 55–68. [Google Scholar] [CrossRef] [Green Version]
- Filippi, C.; Pryde, A.; Cowan, P.; Lee, T.; Hayes, P.; Donaldson, K.; Plevris, J.; Stone, V. Toxicology of ZnO and TiO2 nanoparticles on hepatocytes: Impact on metabolism and bioenergetics. Nanotoxicology 2015, 9, 126–134. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Lü, X.; Chen, R.; Chen, Y. Comparative study of the effects of gold and silver nanoparticles on the metabolism of human dermal fibroblasts. Regen. Biomater. 2020, 7, 221–232. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Primer Forward | Primer Reverse |
---|---|---|
HK2 | GGCAATGAAACCAAAGCCAG | CAAACTAAAAACTCCCCCTTCC |
G6Pase | CTCCTCTATCACATTACATCATCC | GAAACATACAAAAGCACCACC |
PKM | ATTCACCACCCATCACAGCC | CAGACGAGCCACATTCATTCC |
PCX | CATCCCCAACATCCCTTTCC | CCACTTCACAGAACTTGAAGAC |
ACADS | AGTGTCAACAACTCTCTCTACC | AAGCAGCCAATTTTGTCACC |
FIS1 | TGTCCTTTCCCTGTTCTCC | AGCCCCGTTTTATTTACACTC |
GAPDH | TCAAGATCATCAGCAATGCC | TGAGTCCTTCCACGATACC |
Sample | Hydrodynamic Diameter (nm) | Polydispersity Index (PDI) | Zeta Potential (mV) |
---|---|---|---|
AuNPsp-PEG | 47.31 ± 0.46 | 0.3 ± 0.01 | 6.7 ± 7.9 |
AuNPst-PEG | 109.61 ± 1.27 | 0.14± 0.01 | 33.1 ± 12.0 |
AuNPr-PEG | 54.58 ± 0.34 | 0.45 ± 0.01 | 11.0 ± 18.9 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Soares, S.; Pereira, C.; Sousa, A.P.; Oliveira, A.C.; Sales, M.G.; Correa-Duarte, M.A.; Guerreiro, S.G.; Fernandes, R. Metabolic Disruption of Gold Nanospheres, Nanostars and Nanorods in Human Metastatic Prostate Cancer Cells. Cells 2023, 12, 787. https://doi.org/10.3390/cells12050787
Soares S, Pereira C, Sousa AP, Oliveira AC, Sales MG, Correa-Duarte MA, Guerreiro SG, Fernandes R. Metabolic Disruption of Gold Nanospheres, Nanostars and Nanorods in Human Metastatic Prostate Cancer Cells. Cells. 2023; 12(5):787. https://doi.org/10.3390/cells12050787
Chicago/Turabian StyleSoares, Sílvia, Cláudia Pereira, André P. Sousa, Ana Catarina Oliveira, Maria Goreti Sales, Miguel A. Correa-Duarte, Susana G. Guerreiro, and Rúben Fernandes. 2023. "Metabolic Disruption of Gold Nanospheres, Nanostars and Nanorods in Human Metastatic Prostate Cancer Cells" Cells 12, no. 5: 787. https://doi.org/10.3390/cells12050787
APA StyleSoares, S., Pereira, C., Sousa, A. P., Oliveira, A. C., Sales, M. G., Correa-Duarte, M. A., Guerreiro, S. G., & Fernandes, R. (2023). Metabolic Disruption of Gold Nanospheres, Nanostars and Nanorods in Human Metastatic Prostate Cancer Cells. Cells, 12(5), 787. https://doi.org/10.3390/cells12050787