Abstract
Grapevine (Vitis vinifera) is an important and popular perennial fruit tree cultivated worldwide. Grapevine ripening is affected by flowering time, and although members of the MADS-box protein family play vital roles in regulating flowering in plants, the functions of MADS-box proteins in grapevine remain largely unknown. AGAMOUS-LIKE 11 (VvAGL11), a MADS-box gene in grapevine, was reported to be a regulator of seed morphogenesis. In this study, heterologous overexpression of VvAGL11 was found to significantly promote flowering in Arabidopsis, suggesting that its active expression in grapevine may induce early flowering and ripening. Transcriptome analysis showed that VvAGL11 overexpression affected the expression of genes involved in stress responses, hormonal signaling responses, and flowering regulation. Notably, VvAGL11 significantly increased the expression of key flowering genes such as FLOWERING LOCUS T (FT), APETALA3 (AP3), and SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 5 (SPL5), which might have contributed to the early flowering in Arabidopsis. In summary, we characterized a novel flowering regulator, VvAGL11, which could be a potential target for early ripening breeding in grapevine.
1. Introduction
Flowering is a critical developmental process in plants involving the transition from the vegetative to the reproductive growth phase, which is essential for seed and fruit production [1]. Throughout their evolutionary history, plants have evolved a complex and sophisticated flowering regulatory network. This network harmonizes external environmental factors with internal physiological signals, ensuring that plants flower at the most favorable time to maximize reproductive success [2,3,4]. A comprehensive understanding of this regulation is crucial for the precise control of flowering timing, which is important for crop quality and yield improvement.
Six primary pathways that influence the plant flowering time have been identified, including the photoperiod, gibberellin, vernalization, autonomous, age, and ambient temperature pathways [5,6,7,8,9,10]. These pathways can function independently or synergistically by activating floral integrators, forming a precise flowering control network. The floral integrators include the FLOWERING LOCUS T (FT), SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1), and LEAFY (LFY) genes [8,11]. The FT gene is activated in the leaves under appropriate light conditions and transported via the phloem to the shoot apical meristem (SAM) to induce flowering [12,13]. Additionally, FT serves as a downstream target of CONSTANS (CO) (photoperiod pathway) [14], FLOWERING LOCUS M (FLM) (ambient temperature pathway) [15], SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 3 (SPL3) (age pathway) [16], and FLOWERING LOCUS C (FLC) (vernalization and autonomous pathways) [17], which can also be activated by gibberellins [18]. Thus, FT plays a central role in integrating flowering signals and regulating the flowering time and the formation of floral structures. SPL transcription factors represent a unique gene family in plants, which regulate flowering time through various pathways. For instance, SPL3/4/5 can directly bind the promoters of APETALA1 (AP1), LFY, and FRUITFULL (FUL) to activate the FT-FD complex and induce flowering [19]. Moreover, SPL9 can recruit DELLA proteins to the regulatory region of AP1, where the proteins, together with LEAFY, upregulate the expression of AP1, thus influencing the flowering process [20].
The MADS-box family genes encode transcription factors with a conserved MADS-box domain that is essential for developmental and signaling processes in plants, animals, and fungi [21,22,23,24]. These genes play a central role in shaping plant floral organogenesis and regulating flowering time [21,25,26,27,28]. For example, FLC is a crucial inhibitory regulator that integrates the autonomous and vernalization pathways during the flowering process by binding to CArG boxes in the SOC1 promoter and in the intronic regions of the FT gene to repress their activity, thus delaying flowering [29,30]. SOC1 is another important MADS-box gene for the transition of plants from vegetative to reproductive growth. It functions as a positive regulator that integrates signals from various pathways, such as photoperiod, vernalization, and autonomous pathways, to activate the expression of floral initiation genes to promote flowering [8,31,32,33,34]. AGAMOUS-LIKE 24 (AGL24), a member of the MADS-box gene family, is regulated by several floral induction pathways. Overexpression of AGL24 promotes early flowering similar to SOC1 [35]. Interestingly, AGL24 and SOC1 can mutually upregulate each other’s expression by directly acting on their respective promoters, thereby forming a positive feedback loop that integrates flowering signals [36,37]. In the ABCDE model of flowering, the A, B, C, D, and E class genes collectively govern the formation and differentiation of floral organs. Among these, class B genes, including APETALA3 (AP3) and PISTILLATA (PI), are pivotal in specifying the identity and development of petals in the second whorl and stamens in the third whorl. Mutations in these genes can lead to the conversion of petals and stamens into sepals and carpels [38,39,40,41,42].
AGL11, a class D gene within the MADS-box family, plays a crucial role in plant reproductive development, particularly influencing fruit development, seed formation, and overall plant morphology. In Arabidopsis thaliana, AGL11 works in conjunction with SHP1 and SHP2 to regulate ovule formation, and its ectopic expression can trigger the conversion of sepals into carpeloid structures bearing ovules [43]. In Petunia hybrida, FBP11, the AGL11 homolog, is involved in ovule development, and its ectopic expression induces ovule formation on both sepals and petals [44,45]. Similarly, in Brassica napus, BnaAGL11, the Arabidopsis AGL11 homolog has been found to accelerate leaf senescence when ectopically expressed [46]. The grapevine is an important fruit cultivated globally, and understanding its flowering mechanisms is crucial for the breeding of early ripening cultivars. Previous studies have shown that the grapevine gene VvAGL11 is a regulator of seed morphogenesis and determines the seedless phenotype [47,48]. However, its role in flowering regulation has not yet been explored. In this study, we investigated the novel role of VvAGL11 in the regulation of flowering.
By heterologous overexpression of VvAGL11, we observed a significant acceleration of the flowering process in Arabidopsis. Transcriptome and qRT-PCR analyses revealed that overexpression of VvAGL11 altered the expression of several genes involved in stress responses, hormone signaling pathways, and flowering regulation, with marked upregulation of key flowering genes such as FT, AP3, and SPL5. This study identifies VvAGL11 as a novel regulator of flowering and highlights its potential application in the breeding of early-ripening grape varieties. These results not only improve our understanding of the molecular mechanisms underlying flowering in grapevine but also provide a valuable molecular target for the development of early-ripening grape varieties.
2. Materials and Methods
2.1. Plant Material and Growth Conditions
The seeds of Arabidopsis thaliana ecotype Columbia-0 (Col-0) were obtained from the Arabidopsis Biological Resource Center (http://abrc.osu.edu/ (accessed on 22 October 2024)). The seeds were surface-sterilized with 75% v/v ethanol for 3 min, treated with 95% v/v ethanol for 1 min, and air-dried. The sterilized seeds were then plated on solidified (0.7% w/v agar) half-strength Murashige and Skoog medium (1/2 MS) (Coolaber, Beijing, China) and kept in the dark at 4 °C for 3 days. Thereafter, the seeds were transferred to a growth chamber under 16-h light (100 μmol m−2 s−1, 23 ± 1 °C)/8-h darkness (17 ± 3 °C) photoperiod for about 5–7 days. The seedlings were then transferred into soil for continued growth in the chamber.
2.2. Generation of the AGL11-Overexpressing Transgenic Plants
The coding sequence of VvAGL11 (VIT_218s0041g01880) was obtained from the Phytozome Plant Genome Database (https://phytozome-next.jgi.doe.gov (accessed on 22 October 2024)) [49]. We have opted to retain the established name of the VvAGL11 gene, drawing on the studies by Royo [47] and Ocarez [48] for reference. To generate the AGL11-overespressing transgenic plants, we amplified the full-length cDNA sequence of VvAGL11 from ‘Cabernet Franc’ genomic DNA using the primer pairs VvAGL11-1300-F/R (forward primer: CAAATCGACTCTAGAATGGGGAGAGGAAAGATCGAGATC and reverse primer: CATGGTACCGGATCCCCCGAGATGGAGGACCTTCTTAT). The amplicon was inserted into the pSuper1300-GFP vector to obtain the p35S::AGL11 construct, which was transferred into Agrobacterium tumefaciens strain GV3101 for transformation into Arabidopsis (Col-0) using the floral dip technique [50]. Additionally, the empty pSuper1300-GFP vector was transformed into Arabidopsis thaliana as a negative control. Positive plants were selected using 1/2 MS solid medium containing 40 mg/L hygromycin. The VvAGL11-overexpressing transgenic plants generated from Col-0 denoted OE-1 and OE-2.
2.3. Flowering Time Determination
Seedlings were grown in the soil/vermiculite (2:1 (v/v) mixture in the growth chamber under 16-h-light (100 μmol m−2 s−1, 23 ± 1 °C)/8-h-dark (17 ± 3 °C) photoperiod. The total number of rosette leaves was counted at the bolting stage, and the number of days from germination to flowering was recorded. The experiment was conducted in three biological replicates, with six plants measured per biological replicate.
2.4. RNA Isolation and Library Construction
Two-week-old Col-0, VvAGL11 OE-1, and VvAGL11 OE-2 seedlings grown on 1/2 MS agar medium were sampled and frozen in liquid nitrogen. Total RNA was extracted using TRIzol reagent (Sigma–Aldrich, St. Louis, MO, USA), according to the manufacturer’s protocol. The RNA purity and quantification were determined using the NanoDrop 2000 spectrophotometer (Thermo, Waltham, MA, USA), while the RNA integrity was evaluated using the Agilent 2100 Bioanalyzer from Agilent Technologies (Santa Clara, CA, USA). The transcriptome library was constructed employing the VAHTS Universal V6 RNA-seq Library Prep Kit (Thermo, Waltham, MA, USA), as per the provided guidelines. The sequencing and subsequent transcriptome data analysis were conducted by OE Biotech Co., Ltd. (Shanghai, China).
2.5. RNA Sequencing and Differentially Expressed Genes (DEGs) Analysis
Library sequencing was performed on the Illumina NovaSeq 6000 platform, and the raw reads in the fastq format were processed using the fastp software (version 0.20.1) to remove low-quality reads and obtain clean reads for subsequent data analysis. The HISAT2 [51] software (version 2.1.0) was used for reference genome alignment and calculating gene expression levels (FPKM), while HTSeq-count [52] was employed to obtain counts of reads for each gene. Principal component analysis (PCA) of genes (counts) was conducted using R (version 3.2.0) to assess the biological replicability of the samples.
Differential gene expression analysis was conducted using the DESeq2 [53] software (version 1.22.2), where genes with a q-value of <0.05 and either a fold change of >2 or <0.5 were considered differentially expressed genes (DEGs). Subsequently, the DEGs were subjected to gene ontology (GO) [54] and KEGG [55] pathway enrichment analyses based on the hypergeometric distribution algorithm to identify the significantly enriched functional categories.
2.6. qRT-PCR
Total RNA was extracted from 2-week-old seedlings using the FastPure® Universal Plant Total RNA Isolation Kit (Vazyme, Nanjing, China) and reverse-transcribed into cDNA using a HiScript III RT SuperMix (containing Random primers/Oligo (dT)20 VN primer mix) for qPCR (+gDNA wiper) (Vazyme, Nanjing, China) according to the manufacturer’s protocol. The qRT-PCR assay was performed using the ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) on the Bio-Rad Real-Time PCR system. The relative expression levels of VvAGL11 and the flowering-related genes were determined using the delta-delta (2−△△Ct) method, with AtACTIN2 as the internal reference. The primers were VvAGL11-qRT-F/R (forward primer: GCAGAAGTTGCCCTCATCGT; reverse primer: AAGCCAAGGAATCACCCATT), AtFT-qRT-F/R (forward primer: CCAAGTCCTAGCAACCCTCA; reverse primer: TACACTGTTTGCCTGCCAAG), AtAP3-qRT-F/R (forward primer: CGAATGCAAGAAACCAAGAGG; reverse primer: CTCGTCCAAACACTCACCTAG), AtSPL5-qRT-F/R (forward primer: TGGTGACAGTTTTGGAGAAGG; reverse primer: AGTTTCCTGTCTACCCTGTTTC), AtFLC-qRT-F/R (forward primer: ACAAGTCACCTTCTCCAAACG; reverse primer: TGCGTCACAGAGAACAGAAAG), AtSOC1-qRT-F/R (forward primer: CAGTGCTTTGTGATGCTGAAG; reverse primer: GTGCTGACTCGATCCTTAGTATG), AtLFY-qRT-F/R (forward primer: TTCACGAGTGGCTTATTCCG; reverse primer: CCGAATAGTCCCTCTAAACCAC), AtCO-qRT-F/R (forward primer: GGGACTCACTACAACGACAATG; reverse primer: TGTTGCTCTACTGTCCCTTTG), AtSVP (SHORT VEGETATIVE PHASE)-qRT-F/R (forward primer: TCACGCCCGAATGAGTAAAG; reverse primer: TCTTTGTTTCAATCACACGCG). The experiment was conducted in three independent biological replicates, with each biological replicate further comprising three technical replicates.
2.7. Statistical Analysis
Statistical analysis was conducted using SigmaPlot 10 software, and Student’s t-test was used for statistical analysis.
3. Results
3.1. VvAGL11 Promotes Flowering
It has been demonstrated that genes from the MADS-box family play a crucial role in regulating flowering in plants [8,31,32,33,34]. In this study, we overexpressed the VvAGL11 gene in Arabidopsis (Figure 1a) and then analyzed the flowering time and the number of rosette leaves of VvAGL11-overexpressing Arabidopsis at the flowering stage. We found that the VvAGL11-overexpressing lines flowered significantly earlier (Figure 1b,c), with fewer rosette leaves at the flowering stage than the wild type (Figure 1d). The flowering time of the empty vector-expressing controls was similar to that of the wild type, indicating that AGL11 overexpression promoted early flowering.
Figure 1.
VvAGL11 overexpression promotes Arabidopsis flowering. (a) Relative transcript abundance of VvAGL11. Error bars indicate the standard error (SE, n = 3). (b) The growth of the wild type (Col-0) and transgenic lines (VvAGL11 OE-1 and VvAGL11 OE-2) under long-day conditions. Bar: 2 cm. (c) The number of days to flowering of the Col-0 plants compared with those of VvAGL11-OE plants. Values are presented as mean ± standard error (n = 3). (d) Number of rosette leaves at the flowering stage. The data are presented as mean values ± standard error (n = 3). **, ***: indicates a significant difference from Col-0 (p < 0.01, 0.001).
3.2. Transcriptome Analysis of the VvAGL11-OE Plants
To investigate the global gene expression changes in the VvAGL11-OE plants, we performed transcriptome analyses on two VvAGL11-overexpressing lines (OE-1 and OE-2). We obtained 59.79 gigabases (Gb) of clean data, with the data from each sample ranging from 5.48 Gb to 6.99 Gb (Table S1). Our analysis revealed significant differences in gene expression between the overexpression lines and the wild type. Specifically, 631 DEGs were identified in the OE-1 line, of which 366 DEGs were upregulated and 265 DEGs were downregulated (Figure 2a and Table S2). The OE-2 line had 388 DEGs, of which 224 DEGs were upregulated and 164 DEGs were downregulated (Figure 2b and Table S2). Compared to Col-0, OE-1 and OE-2 lines shared 295 DEGs (Figure 2c and Table S3), with 179 DEGs commonly upregulated and 114 DEGs commonly downregulated (Figure 2d and Table S3). These upregulated genes mainly included flowering regulatory genes such as FT, AP3, and SPL5, as well as the sugar transporter SUGARS WILL EVENTUALLY BE EXPORTED TRANSPORTER 10 (SWEET10), the leucine zipper protein BASIC REGION-LEUCINE ZIPPER 44 (bZIP44), and transcription factor families like NAC and WRKY. The down-regulated genes primarily consisted of jasmonic acid synthesis-related genes (like ALLENE OXIDE CYCLASE (AOC)), jasmonate ZIM-domain proteins (JASMONATE ZIM-DOMAIN PROTEIN 1 (JAZ1) and JASMONATE ZIM-DOMAIN PROTEIN 5 (JAZ5)), the AP2/B3-like transcription factor family protein ABSCISIC ACID-INSENSITIVE 3 (ABI3), and transcription factor families such as MYC and ERF (Table S3).
Figure 2.
Transcriptome analysis of the transgenic (VvAGL11-OE) and wildtype (Col-0) Arabidopsis plants. (a) Volcano plot showing differentially expressed genes (DEGs) between the Col-0 and VvAGL11-OE-1 plants. (b) Volcano plot showing DEGs between Col-0 and VvAGL11-OE-2 plants. (c) Venn diagram illustrating DEGs between Col-0_vs_VvAGL11-OE-1 and Col-0_vs_VvAGL11-OE-2. (d) Number of common DEGs between VvAGL11-OE-1 and VvAGL11-OE-2.
3.3. Gene Ontology and KEGG Enrichment Analysis of DEGs
To understand the potential roles of these DEGs, we conducted the GO enrichment analysis of the genes across three aspects: biological processes, cellular components, and molecular functions. The results indicated that the DEGs were predominantly located in the extracellular region and functioned as DNA-binding transcription factors. The genes were involved in responses to various stresses, such as hypoxia, injury, pathogens, and drought, as well as responses to plant hormones, including salicylic acid, jasmonic acid, and abscisic acid (Figure 3a,b). Additionally, our KEGG pathway enrichment analysis showed that these DEGs were mainly enriched in plant hormone signal transduction, plant MAPK signaling pathway, and phenylpropanoid biosynthesis pathways, as well as the biosynthesis pathways of various plant secondary metabolites (Figure 3c,d).
Figure 3.
Gene ontology (GO) functional enrichment and KEGG pathway enrichment analyses of the wildtype (Col-0) and transgenic (VvAGL11-OE) Arabidopsis plants. (a) Enriched GO terms of the differentially expressed genes (DEGs) in Col-0 and VvAGL11-OE-1. (b) Enriched GO terms of the DEGs in Col-0 and VvAGL11-OE-2. (c) KEGG enrichment analysis of the DEGs in Col-0 and VvAGL11-OE-1. (d) KEGG enrichment analysis of the DEGs in Col-0 and VvAGL11-OE-2.
3.4. VvAGL11 Activates the Expression of Flowering Regulation Genes
To investigate how VvAGL11 accelerates flowering in plants, we analyzed the expression patterns of the key flowering regulatory genes in transcriptome data. We found that although there were no significant changes in the expression of FLC, SOC1, CO, LFY, and SVP, the expression of FT, AP3, and SPL5 was increased in VvAGL11-overexpressing lines compared to Col-0 (Figure 4a). This finding was also confirmed via quantitative PCR (qPCR), which confirmed no significant changes in FLC, LFY, and SVP expression and a slight decrease in SOC1 and CO expression. However, FT, AP3, and SPL5 were significantly upregulated in the VvAGL11-overexpressing lines, with FT showing the strongest increase (Figure 4b–i). It is worth noting that FT, AP3, and SPL5 are positive regulators of flowering, with FT serving as a key element in the flowering regulatory network and playing a central role in the floral transition [14,19,38]. These results imply that VvAGL11 might promote flowering by modulating the expression FT, AP3, and SPL5.
Figure 4.
Gene expression analysis of the flowering-associated genes in the wildtype (Col-0) and transgenic (VvAGL11-OE) Arabidopsis seedlings. (a) A heatmap of the hierarchical cluster analysis results. (b–d) Relative gene transcript abundances of (b) FT, (c) AP3, (d) SPL5, (e) LFY, (f) FLC, (g) SOC1, (h) CO, (i) SVP. Error bars indicate the standard error (SE, n = 3). *, **, ***: denotes a significant difference from the Col-0 (p < 0.05, 0.01, 0.001).
4. Discussion
Flowering is a central physiological process in the life cycle of plants, which is closely linked to crop growth and yield [56]. Hence, unraveling the molecular mechanisms underlying flowering regulation has been a major focus area of plant research. The MADS-box protein family has attracted considerable attention due to its central role in determining flowering time and floral organ identity in plants [21,26,28].
Previous research showed that the grapevine VvAGL11, a member of the MADS-box protein family, is a regulator of seed morphogenesis and determines the seedless phenotype [47,48]. In this study, we provide new insights into the role of VvAGL11 in flowering regulation. Overexpression of VvAGL11 significantly promoted flowering and reduced the number of rosette leaves at the flowering stage (Figure 1b–d), indicating that the gene can accelerate the transition from vegetative to reproductive growth by promoting early floral initiation.
Transcriptome analysis revealed multiple DEGs in VvAGL11-overexpressing plants compared to the wild type (Figure 2). These genes exhibited altered expression patterns in various biological processes, including responses to environmental stress and regulation of plant hormone signaling (Figure 3a,b). In particular, the enrichment analysis revealed the involvement of these DEGs in signaling pathways such as plant hormone signaling, MAPK signaling, and plant secondary metabolite biosynthesis pathways (Figure 3c,d), suggesting that VvAGL11 may affect flowering via these biological pathways. However, how VvAGL11 regulates these signaling pathways remains unclear. Further functional validation by genetic and biochemical approaches is required to clarify the exact role of VvAGL11 in these processes.
It is well known that numerous flowering-related genes play a central role in regulating flowering processes in plants [2,8,11]. Therefore, we focused on some key regulators that are directly associated with flowering [12,13,14,15,16,17,18,19,38,39,40]. Consistently, transcriptome analysis and qPCR validation showed that the expression levels of several known flowering regulators, including FLC, LFY, and SVP, were largely unchanged, while FT, AP3, and SPL5 were significantly upregulated in VvAGL11-overexpressing lines (Figure 4). The most significant increase was observed in FT, which is known to function as an important integrator of various flowering signals and whose increased expression is likely a major factor in accelerating flowering in VvAGL11-overexpressing plants. Previous studies showed that members of the MADS-box protein family can regulate the expression of flowering regulatory genes by directly binding to them. For example, FLC inhibited the expression of SOC1 and FT genes by binding to their CArG boxes [29]. This suggests that VvAGL11 could also exert its effect by directly binding FT, AP3, and SPL5 genes. However, this speculation remains to be further explored. Furthermore, SOC1 reportedly forms a positive feedback loop with AGL24 to simultaneously regulate the flowering process [36,37]. However, whether VvAGL11 also plays a role in feedback regulation is yet to be determined and warrants further investigation.
Heterologous expression of VvAGL11 in Arabidopsis may have different functions compared to its role in grapevine. Although heterologous expression in Arabidopsis has demonstrated the ability of VvAGL11 to promote flowering, future research should focus on validating the endogenous role of VvAGL11 in grapevine and exploring its function and interactions with other regulatory genes to gain a comprehensive understanding of its role in regulating flowering in grapevine.
5. Conclusions
This study demonstrated that VvAGL11 is a novel flowering activating factor that induces early flowering by activating the expression of key regulatory genes such as FT, AP3, and SPL5. These findings highlight the potential of VvAGL11 as a valuable target for genetic engineering for optimized flowering and ripening in grapevine breeding programs. Moreover, the study uncovers broader functions of VvAGL11 beyond its role in seed development, offering fresh insights into its wider biological significance. By manipulating the expression of VvAGL11, it may be possible to develop early-ripening grape varieties, which could help optimize harvest timing and enhance adaptability to changing climatic conditions. Future research should focus on further exploring the potential of VvAGL11 for these applications and translating these fundamental findings into practical breeding strategies.
Supplementary Materials
The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agronomy14112497/s1. Table S1. Sequencing data quality preprocessing result. Table S2. Differentially expressed genes between Col-0_vs_VvAGL11-OE-1 and Col-0_vs_VvAGL11-OE-2. Table S3. Commonly differentially expressed genes between Col-0_vs_VvAGL11-OE-1 and Col-0_vs_VvAGL11-OE-2.
Author Contributions
Conceptualization, H.L.; Data curation, A.L.; Formal analysis, F.W.; Investigation, H.L., T.D., Q.Z., G.Y., and Y.Z.; Methodology, T.D.; A.L., and F.W.; Project administration, Q.M., and P.W.; Resources, T.D., Q.Z., Q.M., and L.L.; Supervision, P.W.; Validation, H.L., L.L., and G.Y.; Writing-original draft, H.L., Q.Z., F.W., L.L., and G.Y.; Writing-review & editing, K.L., A.L., Q.M., and Y.Z. All authors have read and agreed to the published version of the manuscript.
Funding
This research was supported by Shandong Natural Science Foundation (ZR2022QC076, ZR2023QC249, ZR2023QC239, ZR2023QC217); the Improved Variety Program of Shandong Province (2022LZGCQY019); Shandong Academy of Agricultural Sciences, Introduction and Training of High-level Talents (CXGC2024F16); Innovation Project of Shandong Academy of Agricultural Sciences (CXGC2024B02); the Key Research and Development Project of Shandong Province (2021LZGC025 and 2022CXGC010605); Yantai Science and Technology Plan Project (2022XCZX086) and Agriculture key core technology research project of Ningxia-Breeding of high-quality drought and cold resistant wine grape varieties (NXNYKJ202304-1).
Data Availability Statement
The datasets presented in this article are not readily available because the data are part of an ongoing study. Requests to access the datasets should be directed to the corresponding author.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- He, Y. Control of the transition to flowering by chromatin modifications. Mol. Plant 2009, 2, 554–564. [Google Scholar] [CrossRef] [PubMed]
- Srikanth, A.; Schmid, M. Regulation of flowering time: All roads lead to Rome. Cell Mol. Life Sci. 2011, 68, 2013–2037. [Google Scholar] [CrossRef] [PubMed]
- Amasino, R. Seasonal and developmental timing of flowering. Plant J. 2010, 61, 1001–1013. [Google Scholar] [CrossRef]
- Andres, F.; Coupland, G. The genetic basis of flowering responses to seasonal cues. Nat. Rev. Genet. 2012, 13, 627–639. [Google Scholar] [CrossRef]
- Fornara, F.; Montaigu, A.; Coupland, G. Snapshot: Control of flowering in Arabidopsis. Cell 2010, 141, 550–550e2. [Google Scholar] [CrossRef]
- Komeda, Y. Genetic regulation of time to flower in Arabidopsis thaliana. Annu. Rev. Plant Biol. 2004, 55, 521–535. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.V.; Lucyshyn, D.; Jaeger, K.E.; Alós, E.; Alvey, E.; Harberd, N.P.; Wigge, P.A. Transcription factor PIF4 controls the thermosensory activation of flowering. Nature 2012, 484, 242–245. [Google Scholar] [CrossRef]
- Moon, J.; Lee, H.; Kim, M.; Lee, I. Analysis of flowering pathway integrators in Arabidopsis. Plant Cell Physiol. 2005, 46, 292–299. [Google Scholar] [CrossRef]
- Searle, I.; Coupland, G. Induction of flowering by seasonal changes in photoperiod. EMBO J. 2004, 23, 1217–1222. [Google Scholar] [CrossRef]
- Zhou, C.M.; Zhang, T.Q.; Wang, X.; Yu, S.; Lian, H.; Tang, H.B.; Feng, Z.Y.; Lihová, J.Z.; Wang, J.W. Molecular basis of age-dependent vernalization in Cardamine flexuosa. Science 2013, 340, 1097–1100. [Google Scholar] [CrossRef]
- Simpson, G.G.; Dean, C. Arabidopsis, the Rosette stone of flowering time? Science 2002, 296, 285–289. [Google Scholar] [CrossRef]
- Abe, M.; Kobayashi, Y.; Yamamoto, S.; Daimon, Y.; Yamaguchi, A.; Ikeda, Y.; Ichinoki, H.; Notaguchi, M.; Goto, K.; Araki, T. FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science 2005, 309, 1052–1056. [Google Scholar] [CrossRef]
- Kardailsky, I.; Shukla, V.K.; Ahn, J.H.; Dagenais, N.; Christensen, S.K.; Nguyen, J.T.; Chory, J.; Harrison, M.J.; Weigel, D. Activation tagging of the floral inducer FT. Science 1999, 286, 1962–1965. [Google Scholar] [CrossRef]
- Tiwari, S.B.; Shen, Y.; Chang, H.C.; Hou, Y.; Harris, A.; Ma, S.F.; McPartland, M.; Hymus, G.J.; Adam, L.; Marion, C.; et al. The flowering time regulator CONSTANS is recruited to the FLOWERING LOCUS T promoter via a unique cis-element. New Phytol. 2010, 187, 57–66. [Google Scholar] [CrossRef]
- Mathieu, J.; Yant, L.J.; Mürdter, F.; Küttner, F.; Schmid, M. Repression of flowering by the miR172 target SMZ. PLoS Biol. 2009, 7, e1000148. [Google Scholar] [CrossRef]
- Kim, J.J.; Lee, J.H.; Kim, W.; Jung, H.S.; Huijser, P.; Ahn, J.H. The microRNA156-SQUAMOSA PROMOTER BIN-DING PROTEIN-LIKE3 module regulates ambient temperature-responsive flowering via FLOWERING LOCUS T in Arabidopsis. Plant Physiol. 2012, 159, 461–478. [Google Scholar] [CrossRef]
- Searle, I.; He, Y.; Turck, F.; Vincent, C.; Fornara, F.; Kröber, S.; Amasino, R.A.; Coupland, G. The transcription factor FLC confers a flowering response to vernalization by repressing meristem competence and systemic signaling in Arabidopsis. Genes Dev. 2006, 20, 898–912. [Google Scholar] [CrossRef]
- Sawa, M.; Nusinow, D.A.; Kay, S.A.; Imaizumi, T. FKF1 and GIGANTEA complex formation is required for day-length measurement in Arabidopsis. Science 2007, 318, 261–265. [Google Scholar] [CrossRef]
- Jung, J.H.; Lee, H.J.; Ryu, J.Y.; Park, C.M. SPL3/4/5 Integrate Developmental Aging and Photoperiodic Signals into the FT-FD Module in Arabidopsis Flowering. Mol. Plant. 2016, 9, 1647–1659. [Google Scholar] [CrossRef]
- Yamaguchi, N.; Winter, C.M.; Wu, M.F.; Kanno, Y.; Yamaguchi, A.; Seo, M.; Wagner, D. Gibberellin acts positively then negatively to control onset of flower formation in Arabidopsis. Science 2014, 344, 638–641. [Google Scholar] [CrossRef] [PubMed]
- Becker, A.; Theißen, G. The major clades of MADS-box genes and their role in the development and evolution of flowering plants. Mol. Phylogenet Evol. 2003, 29, 464–489. [Google Scholar] [CrossRef] [PubMed]
- Angenent, G.C.; Franken, J.; Busscher, M.; van Dijken, A.; van Went, J.L.; Dons, H.J.; van Tunen, A.J. A novel class of MADS box genes is involved in ovule development in petunia. Plant Cell 1995, 7, 1569–1582. [Google Scholar] [CrossRef] [PubMed]
- Messenguy, F.; Dubois, E. Role of MADS box proteins and their cofactors in combinatorial control of gene expression and cell development. Gene 2003, 316, 1–21. [Google Scholar] [CrossRef]
- Rounsley, S.D.; Ditta, G.S.; Yanofsky, M.F. Diverse roles for MADS box genes in Arabidopsis development. Plant Cell 1995, 7, 1259–1269. [Google Scholar] [CrossRef]
- Alvarez-Buylla, E.R.; Liljegren, S.J.; Pelaz, S.; Gold, S.E.; Burgeff, C.; Ditta, G.S.; Vergara-Silva, F.; Yanofsky, M.F. MADS-box gene evolution beyond flowers: Expression in pollen, endosperm, guard cells, roots and trichomes. Plant J. 2000, 24, 457–466. [Google Scholar] [CrossRef] [PubMed]
- Hartmann, U.; Höhmann, S.; Nettesheim, K.; Wisman, E.; Saedler, H.; Huijser, P. Molecular cloning of SVP: A negative regulator of the floral transition in Arabidopsis. Plant J. 2000, 21, 351–360. [Google Scholar] [CrossRef]
- Moore, S.; Vrebalov, J.; Payton, P.; Giovannoni, J. Use of genomics tools to isolate key ripening genes and analyse fruit maturation in tomato. J. Exp. Bot. 2002, 53, 2023–2203. [Google Scholar] [CrossRef]
- Parenicova, L.; de Folter, S.; Kieffer, M.; Horner, D.; Favalli, C.; Busscher, J.; Cook, H.; Ingram, R.; Kater, M.; Davies, B.; et al. Molecular and phylogenetic analyses of the complete MADS-box transcription factor family in Arabidopsis: New openings to the MADS world. Plant Cell 2003, 15, 1538–1551. [Google Scholar] [CrossRef]
- Helliwell, C.A.; Wood, C.C.; Robertson, M.; James Peacock, W.; Dennis, E.S. The Arbidopsis FLC protein interacts directly in vivo with SOC1 and FT chromatin and is a part of a high-molecular-weight protein complex. Plant J. 2006, 46, 183–192. [Google Scholar] [CrossRef]
- Corbesier, L.; Vincent, C.; Jang, S.; Fornara, F.; Fan, Q.; Searle, I.; Giakountis, A.; Farrona, S.; Gissot, L.; Turnbull, C.; et al. FT protein movement contributes to long-distance signaling in floral induction of Arabidopsis. Science 2007, 316, 1030–1033. [Google Scholar] [CrossRef]
- Samach, A.; Onouchi, H.; Gold, S.E.; Ditta, G.S.; Schwarz-Sommer, Z.; Yanofsky, M.F.; Coupland, G. Distinct roles of CONSTANS target genes in reproductive development of Arabidopsis. Science 2000, 288, 1613–1616. [Google Scholar] [CrossRef]
- Wigge, P.A.; Kim, M.C.; Jaeger, K.E.; Busch, W.; Schmid, M.; Lohmann, J.U.; Weigel, D. Integration of spatial and temporal information during floral induction in Arabidopsis. Science 2005, 309, 1056–1059. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.W.; Czech, B.; Weigel, D. miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana. Cell 2009, 138, 738–749. [Google Scholar] [CrossRef] [PubMed]
- Borner, R.; Kampmann, G.; Chandler, J.; Gleissner, R.; Wisman, E.; Apel, K.; Melzer, S. A MADS domain gene involved in the transition to flowering in Arabidopsis. Plant J. 2000, 24, 591–599. [Google Scholar] [CrossRef] [PubMed]
- Michaels, S.D.; Ditta, G.; Gustafson-Brown, C.; Pelaz, S.; Yanofsky, M.; Amasino, R.M. AGL24 acts as a promoter of flowering in Arabidopsis and is positively regulated by vernalization. Plant J. 2003, 33, 867–874. [Google Scholar] [CrossRef]
- Liu, C.; Chen, H.; Er, H.L.; Soo, H.M.; Kumar, P.P.; Han, J.H.; Liou, Y.C.; Yu, H. Direct interaction of AGL24 and SOC1 integrates flowering signals in Arabidopsis. Development 2008, 135, 1481–1491. [Google Scholar] [CrossRef]
- Yu, H.; Xu, Y.; Tan, E.L.; Kumar, P.P. AGAMOUS-LIKE 24, a dosage-dependent mediator of the flowering signals. Proc. Natl. Acad. Sci. USA 2002, 99, 16336–16341. [Google Scholar] [CrossRef] [PubMed]
- Kramer, E.M.; Dorit, R.L.; Irish, V.F. Molecular evolution of genes controlling petal and stamen development: Duplication and divergence within the APETALA3 and PISTILLATA MADS-box gene lineages. Genetics 1998, 149, 765–783. [Google Scholar] [CrossRef]
- Poupin, M.J.; Federici, F.; Medina, C.; Matus, J.T.; Timmermann, T.; Arce-Johnson, P. Isolation of the three grape sub-lineages of B-class MADS-box TM6, PISTILLATA and APETALA3 genes which are differentially expressed during flower and fruit development. Gene 2007, 404, 10–24. [Google Scholar] [CrossRef]
- Fernandez, L.; Chaïb, J.; Martinez-Zapater, J.M.; Thomas, M.R.; Torregrosa, L. Mis-expression of a PISTILLATA-like MADS box gene prevents fruit development in grapevine. Plant J. 2013, 73, 918–928. [Google Scholar] [CrossRef]
- Ditta, G.S.; Baumann, E.; Wisman, E.; Yanofsky, M.F. B and C floral organ identity functions require SEPALLATA MADS-box genes. Nature 2000, 405, 200–203. [Google Scholar] [CrossRef]
- Ditta, G.; Pinyopich, A.; Robles, P.; Pelaz, S.; Yanofsky, M.F. The SEP4 gene of Arabidopsis thaliana functions in floral organ and meristem identity. Curr. Biol. 2004, 14, 1935–1940. [Google Scholar] [CrossRef]
- Pinyopich, A.; Ditta, G.S.; Savidge, B.; Liljegren, S.J.; Baumann, E.; Wisman, E.; Yanofsky, M.F. Assessing the redundancy of MADS-box genes during carpel and ovule development. Nature 2003, 424, 85–88. [Google Scholar] [CrossRef] [PubMed]
- Colombo, L.; Franken, J.; Koetje, E.; van Went, J.; Dons, H.J.; Angenent, G.C.; van Tunen, A.J. The petunia MADS box gene FBP11 determines ovule identity. Plant Cell 1995, 7, 1859–1868. [Google Scholar] [CrossRef] [PubMed]
- Battaglia, R.; Brambilla, V.; Colombo, L.; Stuitje, A.R.; Kater, M.M. Functional analysis of MADS-box genes controlling ovule development in Arabidopsis using the ethanol-inducible alc gene-expression system. Mech. Dev. 2006, 123, 267–276. [Google Scholar] [CrossRef] [PubMed]
- He, S.; Ma, R.; Liu, Z.; Zhang, D.; Wang, S.; Guo, Y.; Chen, M. Overexpression of BnaAGL11, a MADS-Box transcription factor, regulates leaf morphogenesis and senescence in Brassica napus. J. Agric. Food Chem. 2022, 70, 3420–3434. [Google Scholar] [CrossRef]
- Royo, C.; Torres-Pérez, R.; Mauri, N.; Diestro, N.; Cabezas, J.A.; Marchal, C.; Lacombe, T.; Ibáñez, J.; Tornel, M.; Carreño, J.; et al. The Major Origin of Seedless Grapes Is Associated with a Missense Mutation in the MADS-Box Gene VviAGL11. Plant Physiol. 2018, 177, 1234–1253. [Google Scholar] [CrossRef]
- Ocarez, N.; Mejía, N. Suppression of the D-class MADS-box AGL11 gene triggers seedlessness in fleshy fruits. Plant Cell Rep. 2016, 35, 239–254. [Google Scholar] [CrossRef]
- Goodstein, D.M.; Shu, S.; Howson, R.; Neupane, R.; Hayes, R.D.; Fazo, J.; Mitros, T.; Dirks, W.; Hellsten, U.; Putnam, N.; et al. Phytozome: A comparative platform for green plant genomics. Nucleic Acids Res. 2012, 40, D1178–D1186. [Google Scholar] [CrossRef]
- Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- The Gene Ontology Consortium. The Gene Ontology Resource: 20 years and still GOing strong. Nucleic Acids Res. 2019, 47, D330–D338. [Google Scholar] [CrossRef]
- Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T.; et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008, 36, D480–D484. [Google Scholar] [CrossRef]
- Bao, S.; Hua, C.; Shen, L.; Yu, H. New insights into gibberellin signaling in regulating flowering in Arabidopsis. J. Integr. Plant Biol. 2020, 62, 118–131. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).