Lactobacillus delbrueckii subsp. lactis CKDB001 Ameliorates Metabolic Complications in High-Fat Diet-Induced Obese Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation for Probiotic Powder
2.2. Animal Experiments and Dietary Interventions
2.3. Oral Glucose Tolerance Test (OGTT) and Oral Lipid Tolerance Test (OLTT)
2.4. Analysis of Metabolic Parameters in the Serum
2.5. Histopathological Evaluation of the Liver and EAT
2.6. Quantification of Hepatic Lipid Levels
2.7. Enzyme-Linked Immunosorbent Assay (ELISA)
2.8. Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)
2.9. Western Blot Analysis
2.10. Statistical Analysis
3. Results
3.1. Effects of LL on Body Weight (BW) and Food Efficiency
3.2. Effect of LL on Liver and WAT Weights
3.3. LL Maintains Intact Insulin Sensitivity in HFD-Induced Mice
3.4. LL Attenuates CVD Risk Markers in HFD-Induced Mice
3.5. LL Ameliorates Hepatic Lipid Accumulation and Function in HFD-Induced Mice
3.6. LL Modulates AMPK and Lipid Metabolism-Related Gene Expression in the Liver
3.7. LL Inhibits Lipid Accumulation and Modulates Leptin and Adiponectin Levels in HFD-Induced Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| Acc | Acetyl-Coa Carboxylase |
| Acox1 | Peroxisomal Acyl-Coenzyme A Oxidase 1 |
| ALT | Alanine Aminotransferase |
| AMPK | Adenosine Monophosphate-Activated Protein Kinase |
| AST | Aspartate Aminotransferase |
| AUC | Area Under the Curve |
| Atgl | Adipose Triglyceride Lipase |
| BAs | Bile Acids |
| BMI | Body Mass Index |
| BW | Body Weight |
| CFU | Colony-Forming Units |
| Cmax | Maximum Plasma Concentration |
| Cpt1α | Carnitine Palmitoyl Transferase I Alpha |
| CRF | Cardiac Risk Factor |
| CVD | Cardiovascular Disease |
| Dgat1 | Diacylglycerol O-Acyltransferase 1 |
| EAT | Epididymal Adipose Tissue |
| ELISA | Enzyme-Linked Immunosorbent Assay |
| Fas | Fatty Acid Synthase |
| FC | Free Cholesterol |
| FER | Food Efficiency Ratio |
| Gapdh | Glyceraldehyde-3-Phosphate Dehydrogenase |
| H&E | Hematoxylin and Eosin |
| HDL-C | High-Density Lipoprotein Cholesterol |
| HFD | High Fat Diet |
| Hmg-coa | 3-Hydroxy-3-Methylglutaryl-Coenzyme A |
| HOMA-IR | Homeostasis Model Assessment of Insulin Resistance |
| Hsl | Hormone-Sensitive Lipase |
| Il-1β | Interleukin 1 Beta |
| Il-6 | Interleukin 6 |
| Ldlr | Low-Density Lipoprotein Receptor |
| LDL-C | Low-Density Lipoprotein Cholesterol |
| LL | Lactobacillus delbrueckii subsp. lactis CKDB001 |
| MASLD | Metabolic-Associated Steatotic Liver Disease |
| MASH | Metabolic Dysfunction-Associated Steatohepatitis |
| MAT | Mesenteric Adipose Tissue |
| Mgl | Monoacylglycerol Lipase |
| NAFLD | Non-Alcoholic Fatty Liver Disease |
| NAS | Non-Alcoholic Fatty Liver Disease Activity Score |
| NASH | Non-Alcoholic Steatohepatitis |
| NCD | Normal Chow Diet |
| OGTT | Oral Glucose Tolerance Test |
| OLTT | Oral Lipid Tolerance Test |
| PBS | Phosphate-Buffered Saline |
| PC | Positive Control |
| Pgc1α | Peroxisome Proliferator-Activated Receptor Gamma Coactivator 1 Alpha |
| PPAR-GAMMA | Peroxisome Proliferator-Activated Receptor Gamma |
| Pparα | Peroxisome Proliferator-Activated Receptor Alpha |
| QRT-PCR | Quantitative Reverse Transcription-Polymerase Chain Reaction |
| RIPA | Radioimmunoprecipitation Assay |
| SAT | Subcutaneous Adipose Tissue |
| Scd1 | Stearoyl-CoA 9-Desaturase |
| SDS | Standard Deviations |
| Srebp1c | Sterol Regulatory Element-Binding Protein 1c |
| T2D | Type 2 Diabetes |
| TC | Total Cholesterol |
| TG | Triglycerides |
| TMAX | Time to Reach Maximum Plasma Concentration |
| Tnf-α | Tumor Necrosis Factor Alpha |
| T-AMPK | Total-AMP-Activated Protein Kinase |
| WAT | White Adipose Tissue |
| WHO | World Health Organization |
References
- Lin, X.; Li, H. Obesity: Epidemiology, Pathophysiology, and Therapeutics. Front. Endocrinol. 2021, 12, 706978. [Google Scholar] [CrossRef] [PubMed]
- Church, T.S.; Thomas, D.M.; Tudor-Locke, C.; Katzmarzyk, P.T.; Earnest, C.P.; Rodarte, R.Q.; Martin, C.K.; Blair, S.N.; Bouchard, C. Trends over 5 Decades in U.S. Occupation-Related Physical Activity and Their Associations with Obesity. PLoS ONE 2011, 6, e19657. [Google Scholar] [CrossRef] [PubMed]
- Clemente-Suárez, V.J.; Beltrán-Velasco, A.I.; Redondo-Flórez, L.; Martín-Rodríguez, A.; Tornero-Aguilera, J.F. Global Impacts of Western Diet and Its Effects on Metabolism and Health: A Narrative Review. Nutrients 2023, 15, 2749. [Google Scholar] [CrossRef] [PubMed]
- Galicia-Garcia, U.; Benito-Vicente, A.; Jebari, S.; Larrea-Sebal, A.; Siddiqi, H.; Uribe, K.B.; Ostolaza, H.; Martín, C. Pathophysiology of Type 2 Diabetes Mellitus. Int. J. Mol. Sci. 2020, 21, 6275. [Google Scholar] [CrossRef]
- Zheng, J.; Lee, J.; Byun, J.; Yu, D.; Ha, J.H. Partial Replacement of High-Fat Diet with n-3 PUFAs Enhanced Beef Tallow Attenuates Dyslipidemia and Endoplasmic Reticulum Stress in Tunicamycin-Injected Rats. Front. Nutr. 2023, 10, 1155436. [Google Scholar] [CrossRef]
- Lee, J.; Lee, J.K.; Lee, J.J.; Park, S.; Jung, S.; Lee, H.J.; Ha, J.H. Partial Replacement of High-Fat Diet with Beef Tallow Attenuates Dyslipidemia and Endoplasmic Reticulum Stress in db/db Mice. J. Med. Food 2022, 25, 660–674. [Google Scholar] [CrossRef]
- Carter, J.L.; Abdullah, N.; Bragg, F.; Murad, N.A.A.; Taylor, H.; Fong, C.S.; Lacey, B.; Sherliker, P.; Karpe, F.; Jamal, R.; et al. Body Composition and Risk Factors for Cardiovascular Disease in Global Multi-Ethnic Populations. Int. J. Obes. 2023, 47, 855–864. [Google Scholar] [CrossRef]
- Tan, P.Y.; Teng, K.T. Role of Dietary Fat on Obesity-Related Postmenopausal Breast Cancer: Insights from Mouse Models and Methodological Considerations. Breast Cancer 2021, 28, 556–571. [Google Scholar] [CrossRef] [PubMed]
- Kim, W.G.; Cheng, S.Y. Mechanisms Linking Obesity and Thyroid Cancer Development and Progression in Mouse Models. Horm. Cancer 2018, 9, 108–116. [Google Scholar] [CrossRef]
- Machado, M.V.; Cortez-Pinto, H. Non-Alcoholic Fatty Liver Disease: What the Clinician Needs to Know. World. J. Gastroenterol. 2014, 20, 12956–12980. [Google Scholar] [CrossRef]
- Fabbrini, E.; Sullivan, S.; Klein, S. Obesity and Nonalcoholic Fatty Liver Disease: Biochemical, Metabolic, and Clinical Implications. Hepatology 2010, 51, 679–689. [Google Scholar] [CrossRef] [PubMed]
- Staufer, K.; Stauber, R.E. Steatotic Liver Disease: Metabolic Dysfunction, Alcohol, or Both? Biomedicines 2023, 11, 2108. [Google Scholar] [CrossRef] [PubMed]
- Huh, Y.; Cho, Y.J.; Nam, G.E. Recent Epidemiology and Risk Factors of Nonalcoholic Fatty Liver Disease. J. Obes. Metab. Syndr. 2022, 31, 17–27. [Google Scholar] [CrossRef]
- Le, M.H.; Yeo, Y.-H.; Li, X.; Li, J.; Zou, B.; Wu, Y.; Ye, Q.; Huang, D.Q.; Zhao, C.; Nguyen, M.H.; et al. 2019 Global NAFLD Prevalence: A Systematic Review and Meta-analysis. Clin. Gastroenterol. Hepatol. 2022, 20, 2809–2817. [Google Scholar] [CrossRef] [PubMed]
- Sandireddy, R.; Sakthivel, S.; Gupta, P.; Behari, J.; Tripathi, M.; Singh, B.K. Systemic Impacts of Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD) and Metabolic Dysfunction-Associated Steatohepatitis (MASH) on Heart, Muscle, and Kidney Related Diseases. Front. Cell Dev. Biol. 2024, 12, 1433857. [Google Scholar] [CrossRef]
- Petito-da-Silva, T.I.; Souza-Mello, V.; Barbosa-da-Silva, S. Empaglifozin Mitigates NAFLD in High-Fat-Fed Mice by Alleviating Insulin Resistance, Lipogenesis and ER stress. Mol. Cell. Endocrinol. 2019, 498, 110539. [Google Scholar] [CrossRef]
- Gaggini, M.; Morelli, M.; Buzzigoli, E.; DeFronzo, R.A.; Bugianesi, E.; Gastaldelli, A. Non-Alcoholic Fatty Liver Disease (NAFLD) and Its Connection with Insulin Resistance, Dyslipidemia, Atherosclerosis and Coronary Heart Disease. Nutrients 2013, 5, 1544–1560. [Google Scholar] [CrossRef]
- Shah, P.; Mudaliar, S. Pioglitazone: Side Effect and Safety Profile. Expert. Opin. Drug. Saf. 2010, 9, 347–354. [Google Scholar] [CrossRef]
- Pioglitazone. Available online: https://www.drugs.com/mtm/pioglitazone.html (accessed on 9 October 2024).
- Armstrong, M.J.; Gaunt, P.; Aithal, G.P.; Barton, D.; Hull, D.; Parker, R.; Hazlehurst, J.M.; Guo, K.; Aldersley, M.K.; Newsome, P.N.; et al. Liraglutide Safety and Efficacy in Patients with Non-alcoholic Steatohepatitis (LEAN): A Multicentre, Double-Blind, Randomised, Placebo-Controlled Phase 2 Study. Lancet 2016, 387, 679–690. [Google Scholar] [CrossRef]
- Liraglutide. Available online: https://www.drugs.com/mtm/liraglutide.html (accessed on 9 October 2024).
- Radlinger, B.; Ress, C.; Folie, S.; Salzmann, K.; Lechuga, A.; Weiss, B.; Salvenmoser, W.; Graber, M.; Hirsch, J.; Kaser, S.; et al. Empagliflozin Protects Mice against Diet-Induced Obesity, Insulin Resistance and Hepatic Steatosis. Diabetologia 2023, 66, 754–767. [Google Scholar] [CrossRef]
- Empagliflozin (Monograph). Available online: https://www.drugs.com/monograph/empagliflozin.html (accessed on 9 October 2024).
- Hotel, A.C.P.; Cordoba, A. Health and Nutritional Properties of Probiotics in Food Including Powder Milk with Live Lactic Acid Bacteria. Prevention 2001, 5, 1–10. [Google Scholar]
- Belizário, J.E.; Faintuch, J.; Garay-Malpartida, M. Gut Microbiome Dysbiosis and Immunometabolism: New Frontiers for Treatment of Metabolic Diseases. Mediat. Inflamm. 2018, 2018, 2037838. [Google Scholar] [CrossRef] [PubMed]
- Vajro, P.; Paolella, G.; Fasano, A. Microbiota and Gut-liver Axis: Their Influences on Obesity and Obesity-Related Liver Disease. J. Pediatr. Gastroenterol. Nutr. 2013, 56, 461–468. [Google Scholar] [CrossRef] [PubMed]
- Gérard, P. Gut Microbiota and Obesity. Cell. Mol. Life. Sci. 2016, 73, 147–162. [Google Scholar] [CrossRef]
- Cai, H.; Zhang, J.; Liu, C.; Le, T.N.; Lu, Y.; Feng, F.; Zhao, M. High-Fat Diet-Induced Decreased Circulating Bile Acids Contribute to Obesity Associated with Gut Microbiota in Mice. Foods 2024, 13, 699. [Google Scholar] [CrossRef]
- Madjd, A.; Taylor, M.A.; Mousavi, N.; Delavari, A.; Malekzadeh, R.; Macdonald, I.A.; Farshchi, H.R. Comparison of the Effect of Daily Consumption of Probiotic Compared with Low-Fat Conventional Yogurt on Weight Loss in Healthy Obese Women Following an Energy-restricted Diet: A Randomized Controlled Trial. Am. J. Clin. Nutr. 2016, 103, 323–329. [Google Scholar] [CrossRef]
- Savijoki, K.; Nyman, T.A.; Kainulainen, V.; Miettinen, I.; Siljamäki, P.; Fallarero, A.; Sandholm, J.; Satokari, R.; Varmanen, P. Growth Mode and Carbon Source Impact the Surfaceome Dynamics of Lactobacillus rhamnosus GG. Front. Microbiol. 2019, 10, 1272. [Google Scholar] [CrossRef]
- Rizzello, C.G.; Angelis, M.D. Lactic Acid Bacteria -Lactobacillus spp.: Lactobacillus delbrueckii Group. In Encyclopedia of Dairy Sciences, 2nd ed.; John, W.F., Ed.; Academic Press: Cambridge, MA, USA, 2011; Volume 3, pp. 119–124. ISBN 978-0-1237-4407-4. [Google Scholar]
- Hallajzadeh, J.; Eslami, R.D.; Tanomand, A. Effect of Lactobacillus delbrueckii Subsp. lactis PTCC1057 on Serum Glucose, Fetuin-A, and Sestrin 3 Levels in Streptozotocin-Induced Diabetic Mice. Probiotics Antimicrob. Proteins 2021, 13, 383–389. [Google Scholar]
- De Jesus, L.C.L.; Drumond, M.M.; Aburjaile, F.F.; Sousa, T.D.J.; Coelho-Rocha, N.D.; Profeta, R.; Brenig, B.; Mancha-Agresti, P.; Azevedo, V. Probiogenomics of Lactobacillus delbrueckii subsp. lactis CIDCA 133: In Silico, In Vitro, and In Vivo Approaches. Microorganisms 2021, 9, 829. [Google Scholar]
- Chen, C.L.; Hsu, P.Y.; Pan, T.M. Therapeutic Effects of Lactobacillus paracasei subsp. paracasei NTU 101 Powder on Dextran Sulfate Sodium-Induced Colitis in Mice. J. Food Drug Anal. 2019, 27, 83–92. [Google Scholar]
- Joung, H.; Chu, J.; Kwon, Y.J.; Kim, K.H.; Shin, C.H.; Ha, J.H. Assessment of the safety and hepatic lipid-lowering effects of Lactobacillus delbrueckii subsp. lactis CKDB001. Appl. Biol. Chem. 2024, 67, 101. [Google Scholar] [CrossRef]
- Lee, N.Y.; Yoon, S.J.; Han, D.H.; Gupta, H.; Youn, G.S.; Shin, M.J.; Ham, Y.L.; Kwak, M.J.; Kim, M.J.; Suk, K.T.; et al. Lactobacillus and Pediococcus Ameliorate Progression of Non-Alcoholic Fatty Liver Disease through Modulation of the Gut Microbiome. Gut Microbes 2020, 11, 882–899. [Google Scholar] [CrossRef] [PubMed]
- Kannt, A.; Wohlfart, P.; Madsen, A.N.; Veidal, S.S.; Feigh, M.; Schmoll, D. Activation of Thyroid Hormone Receptor-β Improved Disease Activity and Metabolism Independent of Body Weight in a Mouse Model of Non-Alcoholic Steatohepatitis and Fibrosis. Br. J. Pharmacol. 2021, 178, 2412–2423. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Wang, L.; Geng, L.; Tanaka, N.; Ye, B. Resmetirom Ameliorates NASH-Model Mice by Suppressing STAT3 and NF-κB Signaling Pathways in an RGS5-Dependent Manner. Int. J. Mol. Sci. 2023, 24, 5843. [Google Scholar] [CrossRef]
- Kelly, M.J.; Pietranico-Cole, S.; Larigan, J.D.; Haynes, N.E.; Reynolds, C.H.; Scott, N.; Vermeulen, J.; Dvorozniak, M.; Conde-Knape, K.; Tilley, J.; et al. Discovery of 2-[3,5-Dichloro-4-(5-isopropyl-6-oxo-1,6-dihydropyridazin-3-yloxy)phenyl]-3,5-dioxo-2,3,4,5-tetrahydro [1,2,4]triazine-6-carbonitrile (MGL-3196), a Highly Selective Thyroid Hormone Receptor β Agonist in Clinical Trials for the Treatment of Dyslipidemia. J. Med. Chem. 2014, 57, 3912–3923. [Google Scholar]
- Park, S.; Lee, J.J.; Lee, J.; Lee, J.K.; Byun, J.; Kim, I.; Ha, J.H. Lowering n-6/ n-3 Ratio as an Important Dietary Intervention to Prevent LPS-Inducible Dyslipidemia and Hepatic Abnormalities in ob/ob Mice. Int. J. Mol. Sci. 2022, 23, 6384. [Google Scholar] [CrossRef]
- Son, H.K.; Kim, B.H.; Lee, J.; Park, S.; Oh, C.B.; Jung, S.; Lee, J.K.; Ha, J. Partial Replacement of Dietary Fat with Krill Oil or Coconut Oil Alleviates Dyslipidemia by Partly Modulating Lipid Metabolism in Lipopolysaccharide-Injected Rats on a High-Fat Diet. Int. J. Environ. Res. Public Health 2022, 19, 843. [Google Scholar] [CrossRef]
- Friedewald, W.T.; Levy, R.I.; Fredrickson, D.S. Estimation of the Concentration of Low-Density Lipoprotein Cholesterol in Plasma, without Use of the Preparative Ultracentrifuge. Clin. Chem. 1972, 18, 499–502. [Google Scholar] [CrossRef]
- Liang, W.; Menke, A.L.; Driessen, A.; Koek, G.H.; Lindeman, J.H.; Stoop, R.; Havekes, L.M.; Kleemann, R.; van den Hoek, A.M. Establishment of a General NAFLD Scoring System for Rodent Models and Comparison to Human Liver Pathology. PLoS ONE 2014, 9, e115922. [Google Scholar] [CrossRef]
- Kleiner, D.E.; Brunt, E.M.; Van Natta, M.; Behling, C.; Contos, M.J.; Cummings, O.W.; Ferrell, L.D.; Liu, Y.-C.; Torbenson, M.S.; Unalp-Arida, A.; et al. Design and Validation of a Histological Scoring System for Nonalcoholic Fatty Liver Disease. Hepatology 2005, 41, 1313–1321. [Google Scholar] [CrossRef]
- Bligh, E.G.; Dyer, W.J. A Rapid Method of Total Lipid Extraction and Purification. Can. J. Biochem. Physiol. 1959, 37, 911–917. [Google Scholar] [CrossRef] [PubMed]
- Ha, J.H.; Doguer, C.; Wang, X.; Flores, S.R.; Collins, J.F. High-Iron Consumption Impairs Growth and Causes Copper-Deficiency Anemia in Weanling Sprague-Dawley Rats. PLoS ONE 2016, 11, e0161033. [Google Scholar] [CrossRef]
- Jeong, S.; Bae, S.; Shin, E.C.; Lee, J.H.; Ha, J.H. Ellagic Acid Prevents Particulate Matter-Induced Pulmonary Inflammation and Hyperactivity in Mice: A Pilot Study. Int. J. Environ. Res. Public Health 2023, 20, 4523. [Google Scholar] [CrossRef]
- Jeong, S.; Shin, E.C.; Lee, J.H.; Ha, J.H. Particulate Matter Elevates Ocular Inflammation and Endoplasmic Reticulum Stress in Human Retinal Pigmented Epithelium Cells. Int. J. Environ. Res. Public Health 2023, 20, 4766. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.; Jang, H.; Kang, D.; Kim, I.; Ha, J.-H. Physicochemical Properties of Yanggaeng with Added Tempeh Powder. Prev. Nutr. Food. Sci. 2023, 28, 514–519. [Google Scholar]
- Qureshi, K.; Abrams, G.A. Metabolic Liver Disease of Obesity and Role of Adipose Tissue in the Pathogenesis of Nonalcoholic Fatty Liver Disease. World J. Gastroenterol. 2007, 13, 3540–3553. [Google Scholar] [CrossRef] [PubMed]
- Mashek, D.G. Hepatic Lipid Droplets: A Balancing Act Between Energy Storage and Metabolic Dysfunction in NAFLD. Mol. Metab. 2021, 50, 101115. [Google Scholar] [CrossRef]
- Franczyk, M.P.; He, M.; Yoshino, J. Removal of Epididymal Visceral Adipose Tissue Prevents Obesity-Induced Multi-organ Insulin Resistance in Male Mice. J. Endocr. Soc. 2021, 5, bvab024. [Google Scholar] [CrossRef]
- Azad, M.A.K.; Sarker, M.; Li, T.; Yin, J. Probiotic Species in the Modulation of Gut Microbiota: An Overview. Biomed Res. Int. 2018, 2018, 9478630. [Google Scholar] [CrossRef]
- Zhou, D.; Fan, J.G. Microbial Metabolites in Non-Alcoholic Fatty Liver Disease. World J. Gastroenterol. 2019, 25, 2019–2028. [Google Scholar] [CrossRef]
- Lindheim, L.; Bashir, M.; Münzker, J.; Trummer, C.; Zachhuber, V.; Leber, B.; Horvath, A.; Pieber, T.R.; Gorkiewicz, G.; Stadlbauer, V.; et al. Alterations in Gut Microbiome Composition and Barrier Function Are Associated with Reproductive and Metabolic Defects in Women with Polycystic Ovary Syndrome (PCOS): A Pilot Study. PLoS ONE 2017, 12, e0168390. [Google Scholar] [CrossRef] [PubMed]
- Milosevic, I.; Vujovic, A.; Barac, A.; Djelic, M.; Korac, M.; Radovanovic Spurnic, A.; Gmizic, I.; Stevanovic, O.; Djordjevic, V.; Lekic, N.; et al. Gut-Liver Axis, Gut Microbiota, and Its Modulation in the Management of Liver Diseases: A Review of the Literature. Int. J. Mol. Sci. 2019, 20, 395. [Google Scholar] [CrossRef] [PubMed]
- Tripathi, A.; Debelius, J.; Brenner, D.A.; Karin, M.; Loomba, R.; Schnabl, B.; Knight, R. The gut-liver axis and the intersection with the microbiome. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 397–411. [Google Scholar] [CrossRef] [PubMed]
- Chiang, J.Y.L.; Ferrell, J.M. Bile Acid Metabolism in Liver Pathobiology. Gene Expr. 2018, 18, 71–87. [Google Scholar] [CrossRef] [PubMed]
- Ni, Y.; Ni, L.; Zhuge, F.; Fu, Z. The Gut Microbiota and Its Metabolites, Novel Targets for Treating and Preventing Non-Alcoholic Fatty Liver Disease. Mol. Nutr. Food Res. 2020, 64, e2000375. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Z.; Yuan, Q.; Yu, R.; Zhang, J.; Ma, H.; Chen, S. Ameliorative Effects of Probiotic Lactobacillus paracasei NL41 on Insulin Sensitivity, Oxidative Stress, and Beta-Cell Function in a Type 2 Diabetes Mellitus Rat Model. Mol. Nutr. Food Res. 2019, 63, e1900457. [Google Scholar] [CrossRef]
- Rajkumar, H.; Kumar, M.; Das, N.; Kumar, S.N.; Challa, H.R.; Nagpal, R. Effect of Probiotic Lactobacillus salivarius UBL S22 and Prebiotic Fructo-oligosaccharide on Serum Lipids, Inflammatory Markers, Insulin Sensitivity, and Gut Bacteria in Healthy Young Volunteers: A Randomized Controlled Single-Blind Pilot Study. J. Cardiovasc. Pharmacol. Ther. 2015, 20, 289–298. [Google Scholar] [CrossRef]
- Li, H.; Liu, F.; Lu, J.; Shi, J.; Guan, J.; Yan, F.; Li, B.; Huo, G. Probiotic Mixture of Lactobacillus plantarum Strains Improves Lipid Metabolism and Gut Microbiota Structure in High Fat Diet-Fed Mice. Front. Microbiol. 2020, 11, 512. [Google Scholar] [CrossRef]
- Yoo, S.R.; Kim, Y.J.; Park, D.Y.; Jung, U.J.; Jeon, S.M.; Ahn, Y.T.; Huh, C.S.; McGregor, R.; Choi, M.S. Probiotics L. Plantarum and L. Curvatus in Combination Alter Hepatic Lipid Metabolism and Suppress Diet-Induced Obesity. Obesity 2013, 21, 2571–2578. [Google Scholar] [CrossRef]
- Zhang, F.; Lo, E.K.K.; Chen, J.; Wang, K.; Felicianna; Ismaiah, M.J.; Leung, H.K.M.; Zhao, D.; Lee, J.C.; El-Nezami, H. Probiotic Mixture Ameliorates a Diet-Induced MASLD/MASH Murine Model Through the Regulation of Hepatic Lipid Metabolism and the Gut Microbiome. J. Agric. Food Chem. 2024, 72, 8536–8549. [Google Scholar] [CrossRef]
- Yu, J.S.; Youn, G.S.; Choi, J.; Kim, C.H.; Kim, B.Y.; Yang, S.J.; Lee, J.H.; Park, T.S.; Kim, B.K.; Kim, Y.B.; et al. Lactobacillus lactis and Pediococcus pentosaceus-Driven Reprogramming of Gut Microbiome and Metabolome Ameliorates the Progression of Non-alcoholic Fatty Liver Disease. Clin. Transl. Med. 2021, 11, e634. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.S.; Youn, G.S.; Choi, J.; Kim, C.H.; Kim, B.Y.; Yang, S.J.; Lee, J.H.; Park, T.S.; Kim, B.K.; Kim, Y.B.; et al. Gut-Microbial and-Metabolomic Signatures in the Prevention of Non-Alcoholic Fatty Liver Disease by Lactobacillus lactis and Pediococcus pentosaceus. Res. Sq. 2020, preprint. [Google Scholar] [CrossRef]
- Samedi, L.; Charles, A.L. Viability of 4 Probiotic Bacteria Microencapsulated with Arrowroot Starch in the Simulated Gastrointestinal Tract (GIT) and Yoghurt. Foods 2019, 8, 175. [Google Scholar] [CrossRef]
- Merenstein, D.; Pot, B.; Leyer, G.; Ouwehand, A.C.; Preidis, G.A.; Elkins, C.A.; Hill, C.; Lewis, Z.T.; Shane, A.L.; Zmora, N.; et al. Emerging issues in probiotic safety. Gut Microbes 2023, 15, 2185034. [Google Scholar] [CrossRef]
- Demaria, T.M.; Crepaldi, L.D.; Costa-Bartuli, E.; Branco, J.R.; Zancan, P.; Sola-Penna, M. Once A Week Consumption of Western Diet Over Twelve Weeks Promotes Sustained Insulin Resistance and Non-Alcoholic Fat Liver Disease in C57BL/6J Mice. Sci. Rep. 2023, 13, 3058. [Google Scholar] [CrossRef]
- Chiu, S.; Williams, P.T.; Krauss, R.M. Effects of A Very High Saturated Fat Diet on LDL Particles in Adults with Atherogenic Dyslipidemia: A Randomized Controlled Trial. PLoS ONE 2017, 12, e0170664. [Google Scholar] [CrossRef]
- Snel, M.; Jonker, J.T.; Schoones, J.; Lamb, H.; de Roos, A.; Pijl, H.; Smit, J.W.; Meinders, A.E.; Jazet, I.M. Ectopic Fat and Insulin Resistance: Pathophysiology and Effect of Diet and Lifestyle Interventions. Int. J. Endocrinol. 2012, 2012, 983814. [Google Scholar] [CrossRef] [PubMed]
- Longato, L.; Tong, M.; Wands, J.R.; de la Monte, S.M. High Fat Diet Induced Hepatic Steatosis and Insulin Resistance: Role of Dysregulated Ceramide Metabolism. Hepatol. Res. 2012, 42, 412–427. [Google Scholar] [CrossRef]
- Kim, M.; Pichiah, P.B.T.; Kim, D.E.; Cha, Y.S. Black Adzuki Bean (Vigna angularis) Extract Exerts Phenotypic Effects on White Adipose Tissue and Reverses Liver Steatosis in Diet-Induced Obese Mice. J. Food Biochem. 2016, 41, e12333. [Google Scholar] [CrossRef]
- Ghesmaty Sangachin, M.; Cavuoto, L.A.; Wang, Y. Use of Various Obesity Measurement and Classification Methods in Occupational Safety and Health Research: A Systematic Review of the Literature. BMC Obes. 2018, 5, 28. [Google Scholar] [CrossRef]
- Lackey, D.E.; Lazaro, R.G.; Li, P.; Johnson, A.; Hernandez-Carretero, A.; Weber, N.; Vorobyova, I.; Tsukomoto, H.; Osborn, O. The Role of Dietary Fat in Obesity-Induced Insulin Resistance. Am. J. Physiol. Endocrinol. Metab. 2016, 311, E989–E997. [Google Scholar] [CrossRef] [PubMed]
- Boyko, E.J.; Magliano, D.; Shaw, J.E. Insulin Sensitivity and Insulin Secretion Determined by Homeostasis Model Assessment and Risk of Diabetes in a Multiethnic Cohort of Women: The Women’s Health Initiative Observational Study. Diabetes Care 2007, 30, 1747–1752. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Petrelli, A.; Cugnata, F.; Carnovale, D.; Bosi, E.; Libman, I.M.; Piemonti, L.; Cuthbertson, D.; Sosenko, J.M. HOMA-IR and the Matsuda Index as Predictors of Progression to Type 1 Diabetes in Autoantibody-Positive Relatives. Diabetologia 2024, 67, 290–300. [Google Scholar] [CrossRef]
- Kim, D.Y.; Park, J.Y.; Gee, H.Y. Lactobacillus plantarum Ameliorates NASH-Related Inflammation by Upregulating L-Arginine Production. Exp. Mol. Med. 2023, 55, 2332–2345. [Google Scholar] [CrossRef] [PubMed]
- Steinberger, J.; Daniels, S.R.; American Heart Association Atherosclerosis, Hypertension, and Obesity in the Young Committee (Council on Cardiovascular Disease in the Young); American Heart Association Diabetes Committee (Council on Nutrition, Physical Activity, and Metabolism). Obesity, Insulin Resistance, Diabetes, and Cardiovascular Risk in Children: An American Heart Association scientific statement from the Atherosclerosis, Hypertension, and Obesity in the Young Committee (Council on Cardiovascular Disease in the Young) and the Diabetes Committee (Council on Nutrition, Physical Activity, and Metabolism). Circulation 2003, 107, 1448–1453. [Google Scholar]
- Klop, B.; Elte, J.W.; Cabezas, M.C. Dyslipidemia in Obesity: Mechanisms and Potential Targets. Nutrients 2013, 5, 1218–1240. [Google Scholar] [CrossRef]
- Hong, Y.; Song, G.; Feng, X.; Niu, J.; Wang, L.; Yang, C.; Luo, X.; Zhou, S.; Ma, W. The Probiotic Kluyveromyces lactis JSA 18 Alleviates Obesity and Hyperlipidemia in High-Fat Diet C57BL/6J Mice. Foods 2024, 13, 1124. [Google Scholar] [CrossRef] [PubMed]
- Shinohata, R.; Shibakura, M.; Arao, Y.; Watanabe, S.; Hirohata, S.; Usui, S. A High-Fat/High-Cholesterol Diet, but Not High-Cholesterol Alone, Increases Free Cholesterol and ApoE-Rich HDL Serum Levels in Rats and Upregulates Hepatic ABCA1 Expression. Biochimie 2022, 197, 49–58. [Google Scholar] [CrossRef]
- Rosales, C.; Gillard, B.K.; Xu, B.; Gotto, A.M., Jr.; Pownall, H.J. Revisiting Reverse Cholesterol Transport in the Context of High-Density Lipoprotein Free Cholesterol Bioavailability. Methodist Debakey Cardiovasc. J. 2019, 15, 47–54. [Google Scholar] [CrossRef]
- Chan, W.K.; Chuah, K.H.; Rajaram, R.B.; Lim, L.L.; Ratnasingam, J.; Vethakkan, S.R. Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD): A State-of-the-Art Review. J. Obes. Metab. Syndr. 2023, 32, 197–213. [Google Scholar] [CrossRef]
- Tilg, H.; Moschen, A.R. Evolution of Inflammation in Nonalcoholic Fatty Liver Disease: The Multiple Parallel Hits Hypothesis. Hepatology 2010, 52, 1836–1846. [Google Scholar] [CrossRef] [PubMed]
- Day, C.P.; James, O.F. Steatohepatitis: A Tale of Two “Hits”? Gastroenterology 1998, 114, 842–845. [Google Scholar] [CrossRef]
- Younossi, Z.; Anstee, Q.M.; Marietti, M.; Hardy, T.; Henry, L.; Eslam, M.; George, J.; Bugianesi, E. Global burden of NAFLD and NASH: Trends, Predictions, Risk Factors and Prevention. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 11–20. [Google Scholar] [CrossRef] [PubMed]
- Elshaer, A.; Chascsa, D.M.H.; Lizaola-Mayo, B.C. Exploring Varied Treatment Strategies for Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD). Life 2024, 17, 844. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.Y.; Mun, S.; Yu, J.H.; Jin, Y.J.; Suh, Y.J.; Cho, S.H.; Lee, J.W. Association between small dense LDL levels and hepatic fibrosis in patients with nonalcoholic fatty liver disease. Medicine 2022, 101, e30527. [Google Scholar]
- Garcia, D.; Shaw, R.J. AMPK: Mechanisms of Cellular Energy Sensing and Restoration of Metabolic Balance. Mol. Cell 2017, 66, 789–800. [Google Scholar] [CrossRef]
- Cui, Y.; Chen, J.; Zhang, Z.; Shi, H.; Sun, W.; Yi, Q. The Role of AMPK in Macrophage Metabolism, Function and Polarisation. J. Transl. Med. 2023, 21, 892. [Google Scholar] [CrossRef]
- Gupta, R.; Kasturi, P.; Bracher, A.; Loew, C.; Zheng, M.; Villella, A.; Garza, D.; Hartl, F.U.; Raychaudhuri, S. Firefly Luciferase Mutants as Sensors of Proteome Stress. Nat. Methods 2011, 8, 879–884. [Google Scholar] [CrossRef]
- Xiao, Z.; Chu, Y.; Qin, W. IGFBP5 Modulates Lipid Metabolism and Insulin Sensitivity through Activating AMPK Pathway in Non-Alcoholic Fatty Liver Disease. Life Sci. 2020, 256, 117997. [Google Scholar] [CrossRef]
- Zachariah Tom, R.; Garcia-Roves, P.M.; Sjögren, R.J.; Jiang, L.Q.; Holmström, M.H.; Deshmukh, A.S.; Vieira, E.; Chibalin, A.V.; Björnholm, M.; Zierath, J.R. Effects of AMPK Activation on Insulin Sensitivity and Metabolism in Leptin-Deficient ob/ob Mice. Diabetes 2014, 63, 1560–1571. [Google Scholar] [CrossRef]
- Chularojmontri, L.; Nanna, U.; Tingpej, P.; Hansakul, P.; Jansom, C.; Wattanapitayakul, S.; Naowaboot, J. Raphanus sativus L. var. caudatus Extract Alleviates Impairment of Lipid and Glucose Homeostasis in Liver of High-Fat Diet-Induced Obesity and Insulin Resistance in Mice. Prev. Nutr. Food Sci. 2022, 27, 399–406. [Google Scholar] [PubMed]
- Zhang, J.; Zhang, W.; Yang, L.; Zhao, W.; Liu, Z.; Wang, E.; Wang, J. Phytochemical Gallic Acid Alleviates Nonalcoholic Fatty Liver Disease via AMPK-ACC-PPARa Axis through Dual Regulation of Lipid Metabolism and Mitochondrial Function. Phytomedicine 2023, 109, 154589. [Google Scholar] [CrossRef] [PubMed]
- Tu, Z.; Moss-Pierce, T.; Ford, P.; Jiang, T.A. Rosemary (Rosmarinus officinalis L.) Extract Regulates Glucose and Lipid Metabolism by Activating AMPK and PPAR Pathways in HepG2 Cells. J. Agric. Food Chem. 2013, 61, 2803–2810. [Google Scholar] [CrossRef] [PubMed]
- Yao, H.; Tao, X.; Xu, L.; Qi, Y.; Yin, L.; Han, X.; Xu, Y.; Zheng, L.; Peng, J. Dioscin Alleviates Non-Alcoholic Fatty Liver Disease through Adjusting Lipid Metabolism via SIRT1/AMPK Signaling Pathway. Pharmacol. Res. 2018, 131, 51–60. [Google Scholar] [CrossRef] [PubMed]
- Yu, P.; Xu, X.; Zhang, J.; Xia, X.; Xu, F.; Weng, J.; Lai, X.; Shen, Y. Liraglutide Attenuates Nonalcoholic Fatty Liver Disease through Adjusting Lipid Metabolism via SHP1/AMPK Signaling Pathway. Int. J. Endocrinol. 2019, 2019, 1567095. [Google Scholar] [CrossRef] [PubMed]
- Esquejo, R.M.; Salatto, C.T.; Delmore, J.; Albuquerque, B.; Reyes, A.; Shi, Y.; Moccia, R.; Cokorinos, E.; Peloquin, M.; Monetti, M.; et al. Activation of Liver AMPK with PF-06409577 Corrects NAFLD and Lowers Cholesterol in Rodent and Primate Preclinical Models. EBioMedicine 2018, 31, 122–132. [Google Scholar] [CrossRef]
- Garcia, D.; Hellberg, K.; Chaix, A.; Wallace, M.; Herzig, S.; Badur, M.G.; Lin, T.; Shokhirev, M.N.; Pinto, A.F.M.; Ross, D.S.; et al. Genetic Liver-Specific AMPK Activation Protects against Diet-Induced Obesity and NAFLD. Cell Rep. 2019, 26, 192–208.e6. [Google Scholar] [CrossRef]
- Li, D.; Liu, F.; Wang, X.; Li, X. Apple Polyphenol Extract Alleviates High-Fat-Diet-Induced Hepatic Steatosis in Male C57BL/6 Mice by Targeting LKB1/AMPK Pathway. J. Agric. Food Chem. 2019, 67, 12208–12218. [Google Scholar] [CrossRef]
- Smith, B.K.; Marcinko, K.; Desjardins, E.M.; Lally, J.S.; Ford, R.J.; Steinberg, G.R. Treatment of Nonalcoholic Fatty Liver Disease: Role of AMPK. Am. J. Physiol. Endocrinol. Metab. 2016, 311, E730–E740. [Google Scholar] [CrossRef]
- Mulder, P.; Morrison, M.C.; Wielinga, P.Y.; van Duyvenvoorde, W.; Kooistra, T.; Kleemann, R. Surgical Removal of Inflamed Epididymal White Adipose Tissue Attenuates the Development of Non-alcoholic Steatohepatitis in Obesity. Int. J. Obes. 2016, 40, 675–684. [Google Scholar] [CrossRef]
- Clemente-Suárez, V.J.; Redondo-Flórez, L.; Beltrán-Velasco, A.I.; Martín-Rodríguez, A.; Martínez-Guardado, I.; Navarro-Jiménez, E.; Laborde-Cárdenas, C.C.; Tornero-Aguilera, J.F. The Role of Adipokines in Health and Disease. Biomedicines 2023, 11, 1290. [Google Scholar] [CrossRef] [PubMed]
- Feijóo-Bandín, S.; Aragón-Herrera, A.; Moraña-Fernández, S.; Anido-Varela, L.; Tarazón, E.; Roselló-Lletí, E.; Portolés, M.; Moscoso, I.; Gualillo, O.; González-Juanatey, J.R.; et al. Adipokines and Inflammation: Focus on Cardiovascular Diseases. Int. J. Mol. Sci. 2020, 21, 7711. [Google Scholar] [CrossRef] [PubMed]
- Gan, X.T.; Ettinger, G.; Huang, C.X.; Burton, J.P.; Haist, J.V.; Rajapurohitam, V.; Sidaway, J.E.; Martin, G.; Gloor, G.B.; Swann, J.R.; et al. Probiotic Administration Attenuates Myocardial Hypertrophy and Heart Failure after Myocardial Infarction in the Rat. Circ. Heart Fail. 2014, 7, 491–499. [Google Scholar] [CrossRef] [PubMed]
- Muskiet, F.A.J.; Carrera-Bastos, P.; Pruimboom, L.; Lucia, A.; Furman, D. Obesity and Leptin Resistance in the Regulation of the Type I Interferon Early Response and the Increased Risk for Severe COVID-19. Nutrients 2022, 14, 1388. [Google Scholar] [CrossRef]
- Pereira, S.; Cline, D.L.; Glavas, M.M.; Covey, S.D.; Kieffer, T.J. Tissue-Specific Effects of Leptin on Glucose and Lipid Metabolism. Endocr. Rev. 2021, 42, 1–28. [Google Scholar] [CrossRef]










| Item | Score | Extent |
|---|---|---|
| NAS | 0 | <5% |
| 1 | 5–33% | |
| 2 | 34–66% | |
| 3 | >66% | |
| Fibrosis | 0 | None |
| 1 | Perisinusoidal or periportal | |
| 1a | Mild, zone 3, perisinusoidal | |
| 1b | Moderate, zone 3, perisinusoidal | |
| 1c | Portal/periportal | |
| 2 | Perisinusoidal and portal/periportal | |
| 3 | Bridging fibrosis | |
| 4 | Cirrhosis | |
| Macrophage infiltration | 0 | None |
| 1 | Minimal (<10%) | |
| 2 | Mild (10–25%) | |
| 3 | Moderate (26–50%) | |
| 4 | Marked (>51%) |
| Transcript | Forward | Reverse |
|---|---|---|
| Acox1 | CAGGAAGAGCAAGGAAGTGG | CCTTTCTGGCTGATCCCATA |
| Cpt1α | CTCCGCCTGAGCCATGAAG | CACCAGTGATGATGCCATTCT |
| Pparα | GTACGGTGTGTATGAAGCCATCTT | GCCGTACGCGATCAGCAT |
| Atgl | TGTGGCCTCATTCCTCCTAC | TCGTGGATGTTGGTGGAGCT |
| Hsl | GCTGGGCTGTCAAGCACTGT | GTAACTGGGTAGGCTGCCAT |
| Mgl | CGGACTTCCAAGTTTTTGTCAGA | GCAGCCACTAGGATGGAGATG |
| Acc | TGGACAGACTGATCGCAGAGAAAG | TGGAGAGCCCCACACACA |
| Fas | GGAGGTGGTGATAGCCGGTAT | TGGGTAATCCATAGAGCCCAG |
| Scd1 | TTCTTGCGATACACTCTGGTGC | CGGGATTGAATGTTCTTGTCGT |
| Dgat1 | GAGTCTATCACTCCAGTGGG | GGCGGCACCACAGGTTGACA |
| Pgc1α | CCCAGGCAGTAGATCCTCTTCAA | CCTTTCGTGCTCATAGGCTTCATA |
| Srebp1 | GCAGCCACCATCTAGCCTG | CAGCAGTGAGTCTGCCTTGAT |
| Il-1β | GTCACAAGAAACCATGGCACAT | GCCCATCAGAGGCAAGGA |
| Il-6 | CTGCAAGAGACTTCCATCCAGTT | AGGGAAGGCCGTGGTTGT |
| Tnf- α | GGCTGCCCCGACTACGT | ACTTTCTCCTGGTATGAGATAGCAAAT |
| Hmg-coa | GGCCCAGTGGTGCGTCTTCC | TGGTCCCACCACCCACGGTT |
| Ldlr | ACTCATGCAGCAGGAACC | GTCATTTTCACAGTCTAC |
| Gapdh | CATGGCCTTCCGTGTTCCTA | GCGGCACGTCAGATCCA |
| Type | Antibody | Dilution Factor | Corporation | Catalog Number |
|---|---|---|---|---|
| Primary | p-AMPK | 1:1000 | Cell Signaling | 2531 |
| t-AMPK | 1:1000 | Cell Signaling | 2532 | |
| GAPDH | 1:2000 | Santa Cruz | 365,062 | |
| Secondary | Anti-rabbit IgG | 1:3000 | Cell Signaling | 7074 |
| Anti-mouse IgG | 1:1000 | Cell Signaling | 7076 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jang, H.; Joung, H.; Chu, J.; Cho, M.; Kim, Y.-W.; Kim, K.H.; Shin, C.H.; Lee, J.; Ha, J.-H. Lactobacillus delbrueckii subsp. lactis CKDB001 Ameliorates Metabolic Complications in High-Fat Diet-Induced Obese Mice. Nutrients 2024, 16, 4260. https://doi.org/10.3390/nu16244260
Jang H, Joung H, Chu J, Cho M, Kim Y-W, Kim KH, Shin CH, Lee J, Ha J-H. Lactobacillus delbrueckii subsp. lactis CKDB001 Ameliorates Metabolic Complications in High-Fat Diet-Induced Obese Mice. Nutrients. 2024; 16(24):4260. https://doi.org/10.3390/nu16244260
Chicago/Turabian StyleJang, Hyunsoo, Hyunchae Joung, Jaeryang Chu, Minseo Cho, Yeon-Woo Kim, Kyung Hwan Kim, Chang Hun Shin, Jisu Lee, and Jung-Heun Ha. 2024. "Lactobacillus delbrueckii subsp. lactis CKDB001 Ameliorates Metabolic Complications in High-Fat Diet-Induced Obese Mice" Nutrients 16, no. 24: 4260. https://doi.org/10.3390/nu16244260
APA StyleJang, H., Joung, H., Chu, J., Cho, M., Kim, Y.-W., Kim, K. H., Shin, C. H., Lee, J., & Ha, J.-H. (2024). Lactobacillus delbrueckii subsp. lactis CKDB001 Ameliorates Metabolic Complications in High-Fat Diet-Induced Obese Mice. Nutrients, 16(24), 4260. https://doi.org/10.3390/nu16244260

