GABA and Fermented Curcuma longa L. Extract Enriched with GABA Ameliorate Obesity through Nox4-IRE1α Sulfonation-RIDD-SIRT1 Decay Axis in High-Fat Diet-Induced Obese Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparations of GABA and Fermented Curcuma longa L. Extract Enriched with GABA
2.2. High Performance Liquid Chromatography (HPLC) Analysis
2.3. Animal Studies
2.4. Biochemical Analysis
2.5. Immunoblot Analysis
2.6. Histological Analysis and Immunohistochemistry (IHC)
2.7. Immunofluorescence Analysis
2.8. DHE Staining Analysis
2.9. IRE1α Sulfonation Assay
2.10. NADPH-Dependent Oxidoreductase (Nox) Activity Assay
2.11. In Vitro IRE1α-Mediated SIRT1 Cleavage Assay
2.12. Reverse Transcription Polymerase Chain Reaction (RT-PCR)
2.13. Lipid Peroxidation Measurement
2.14. Membrane Fluidity
2.15. Dual-Energy X-ray Absorptiometry (DXA) Scan
2.16. Statistical Analysis
3. Results
3.1. GABA and FCLL-GABA Regulate Body Weight Gain and Its Effect on Metabolic Profile in HFD Induced Obese Mice
3.2. GABA and FCLL-GABA Regulate Biochemical Characteristics and Ameliorate Hepatic Lipid Accumulation in HFD Induced Obese Mice
3.3. GABA and Fermented Curcuma longa L. Extract Enriched with GABA Control the Levels of Adipogenesis-Related Proteins in Adipose Tissues in HFD Induced Obese Mice
3.4. GABA and Fermented Curcuma longa L. Extract Enriched with GABA Inhibit the Expression of Adipogenesis-Related Genes in the Liver of HFD Induced Obese Mice
3.5. GABA and Fermented Curcuma longa L. Extract Enriched with GABA Control Oxidative Stress and ER Redox Imbalance in HFD Induced Obese Mice
3.6. GABA and Fermented Curcuma longa L. Extract Enriched with GABA Regulate the IRE1α Sulfonation-RIDD-SIRT1 Decay Axis and ER Stress Response in HFD Induced Obese Mice
3.7. GABA and Fermented Curcuma longa L. Extract Enriched with GABA Regulate Lipid Metabolism via AMPK-SIRT1 Signaling and Promote Browning of BAT
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gadde, K.M.; Martin, C.K.; Berthoud, H.R.; Heymsfield, S.B. Obesity: Pathophysiology and Management. J. Am. Coll. Cardiol. 2018, 71, 69–84. [Google Scholar] [CrossRef] [PubMed]
- Kusminski, C.M.; Bickel, P.E.; Scherer, P.E. Targeting adipose tissue in the treatment of obesity-associated diabetes. Nat. Rev. Drug Discov. 2016, 15, 639–660. [Google Scholar] [CrossRef] [PubMed]
- Serra, D.; Mera, P.; Malandrino, M.I.; Mir, J.F.; Herrero, L. Mitochondrial fatty acid oxidation in obesity. Antioxid. Redox Signal. 2013, 19, 269–284. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rask-Madsen, C.; King, G.L. Mechanisms of Disease: Endothelial dysfunction in insulin resistance and diabetes. Nat. Clin. Pract. Endocrinol. Metab. 2007, 3, 46–56. [Google Scholar] [CrossRef]
- Evans, J.L.; Goldfine, I.D.; Maddux, B.A.; Grodsky, G.M. Are oxidative stress-activated signaling pathways mediators of insulin resistance and beta-cell dysfunction? Diabetes 2003, 52, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Zeeshan, H.M.; Lee, G.H.; Kim, H.R.; Chae, H.J. Endoplasmic Reticulum Stress and Associated ROS. Int. J. Mol. Sci. 2016, 17, 327. [Google Scholar] [CrossRef] [Green Version]
- Bhandary, B.; Marahatta, A.; Kim, H.R.; Chae, H.J. An involvement of oxidative stress in endoplasmic reticulum stress and its associated diseases. Int. J. Mol. Sci. 2012, 14, 434–456. [Google Scholar] [CrossRef]
- Holmstrom, K.M.; Finkel, T. Cellular mechanisms and physiological consequences of redox-dependent signalling. Nat. Rev. Mol. Cell Biol. 2014, 15, 411–421. [Google Scholar] [CrossRef]
- Wu, R.F.; Ma, Z.; Liu, Z.; Terada, L.S. Nox4-derived H2O2 mediates endoplasmic reticulum signaling through local Ras activation. Mol. Cell. Biol. 2010, 30, 3553–3568. [Google Scholar] [CrossRef] [Green Version]
- Hourihan, J.M.; Moronetti Mazzeo, L.E.; Fernandez-Cardenas, L.P.; Blackwell, T.K. Cysteine Sulfenylation Directs IRE-1 to Activate the SKN-1/Nrf2 Antioxidant Response. Mol. Cell 2016, 63, 553–566. [Google Scholar] [CrossRef] [Green Version]
- Hwang, I.; Jo, K.; Shin, K.C.; Kim, J.I.; Ji, Y.; Park, Y.J.; Park, J.; Jeon, Y.G.; Ka, S.; Suk, S.; et al. GABA-stimulated adipose-derived stem cells suppress subcutaneous adipose inflammation in obesity. Proc. Natl. Acad. Sci. USA 2019, 116, 11936–11945. [Google Scholar] [CrossRef] [Green Version]
- Tian, J.; Dang, H.N.; Yong, J.; Chui, W.S.; Dizon, M.P.; Yaw, C.K.; Kaufman, D.L. Oral treatment with gamma-aminobutyric acid improves glucose tolerance and insulin sensitivity by inhibiting inflammation in high fat diet-fed mice. PLoS ONE 2011, 6, e25338. [Google Scholar] [CrossRef] [Green Version]
- Untereiner, A.; Abdo, S.; Bhattacharjee, A.; Gohil, H.; Pourasgari, F.; Ibeh, N.; Lai, M.; Batchuluun, B.; Wong, A.; Khuu, N.; et al. GABA promotes beta-cell proliferation, but does not overcome impaired glucose homeostasis associated with diet-induced obesity. FASEB J. 2019, 33, 3968–3984. [Google Scholar] [CrossRef]
- Xie, Z.X.; Xia, S.F.; Qiao, Y.; Shi, Y.H.; Le, G.W. Effect of GABA on oxidative stress in the skeletal muscles and plasma free amino acids in mice fed high-fat diet. J. Anim. Physiol. Anim. Nutr. 2015, 99, 492–500. [Google Scholar] [CrossRef]
- Xie, Z.X.; Xia, S.F.; Le, G.W. Gamma-aminobutyric acid improves oxidative stress and function of the thyroid in high-fat diet fed mice. J. Funct. Foods 2014, 8, 76–86. [Google Scholar] [CrossRef]
- Purwana, I.; Zheng, J.; Li, X.; Deurloo, M.; Son, D.O.; Zhang, Z.; Liang, C.; Shen, E.; Tadkase, A.; Feng, Z.P.; et al. GABA promotes human beta-cell proliferation and modulates glucose homeostasis. Diabetes 2014, 63, 4197–4205. [Google Scholar] [CrossRef] [Green Version]
- Soltani, N.; Qiu, H.; Aleksic, M.; Glinka, Y.; Zhao, F.; Liu, R.; Li, Y.; Zhang, N.; Chakrabarti, R.; Ng, T.; et al. GABA exerts protective and regenerative effects on islet beta cells and reverses diabetes. Proc. Natl. Acad. Sci. USA 2011, 108, 11692–11697. [Google Scholar] [CrossRef] [Green Version]
- Cavagnini, F.; Pinto, M.; Dubini, A.; Invitti, C.; Cappelletti, G.; Polli, E.E. Effects of gamma aminobutyric acid (GABA) and muscimol on endocrine pancreatic function in man. Metabolism 1982, 31, 73–77. [Google Scholar] [CrossRef]
- Passariello, N.; Giugliano, D.; Torella, R.; Sgambato, S.; Coppola, L.; Frascolla, N. A possible role of gamma-aminobutyric acid in the control of the endocrine pancreas. J. Clin. Endocrinol. Metab. 1982, 54, 1145–1149. [Google Scholar] [CrossRef]
- Shan, Y.; Man, C.X.; Han, X.; Li, L.; Guo, Y.; Deng, Y.; Li, T.; Zhang, L.W.; Jiang, Y.J. Evaluation of improved gamma-aminobutyric acid production in yogurt using Lactobacillus plantarum NDC75017. J. Dairy Sci. 2015, 98, 2138–2149. [Google Scholar] [CrossRef] [Green Version]
- Hoang, T.-H.; Yoon, Y.; Park, S.-A.; Lee, H.-Y.; Peng, C.; Kim, J.-H.; Lee, G.-H.; Chae, H.-J. IBF-R, a botanical extract of Rhus verniciflua controls obesity in which AMPK-SIRT1 axis and ROS regulatory mechanism are involved in mice. J. Funct. Foods 2021, 87, 104804. [Google Scholar] [CrossRef]
- Kim, H.K.; Lee, H.Y.; Riaz, T.A.; Bhattarai, K.R.; Chaudhary, M.; Ahn, J.H.; Jeong, J.; Kim, H.R.; Chae, H.J. Chalcone suppresses tumor growth through NOX4-IRE1alpha sulfonation-RIDD-miR-23b axis. Redox Biol. 2021, 40, 101853. [Google Scholar] [CrossRef]
- Jalil, J.E.; Perez, A.; Ocaranza, M.P.; Bargetto, J.; Galaz, A.; Lavandero, S. Increased aortic NADPH oxidase activity in rats with genetically high angiotensin-converting enzyme levels. Hypertension 2005, 46, 1362–1367. [Google Scholar] [CrossRef] [Green Version]
- Lee, H.Y.; Lee, G.H.; Hoang, T.H.; Park, S.A.; Lee, J.; Lim, J.; Sa, S.; Kim, G.E.; Han, J.S.; Kim, J.; et al. D-allulose ameliorates hyperglycemia through IRE1alpha sulfonation-RIDD-SIRT1 decay axis in the skeletal muscle. Antioxid. Redox Signal. 2022. [Google Scholar] [CrossRef]
- Ersoy, B.A.; Maner-Smith, K.M.; Li, Y.; Alpertunga, I.; Cohen, D.E. Thioesterase-mediated control of cellular calcium homeostasis enables hepatic ER stress. J. Clin. Investig. 2018, 128, 141–156. [Google Scholar] [CrossRef]
- Zhang, X.; Zhang, G.; Zhang, H.; Karin, M.; Bai, H.; Cai, D. Hypothalamic IKKbeta/NF-kappaB and ER stress link overnutrition to energy imbalance and obesity. Cell 2008, 135, 61–73. [Google Scholar] [CrossRef] [Green Version]
- Viollet, B.; Foretz, M.; Guigas, B.; Horman, S.; Dentin, R.; Bertrand, L.; Hue, L.; Andreelli, F. Activation of AMP-activated protein kinase in the liver: A new strategy for the management of metabolic hepatic disorders. J. Physiol. 2006, 574, 41–53. [Google Scholar] [CrossRef]
- Inoue, M.; Ohtake, T.; Motomura, W.; Takahashi, N.; Hosoki, Y.; Miyoshi, S.; Suzuki, Y.; Saito, H.; Kohgo, Y.; Okumura, T. Increased expression of PPARgamma in high fat diet-induced liver steatosis in mice. Biochem. Biophys. Res. Commun. 2005, 336, 215–222. [Google Scholar] [CrossRef] [Green Version]
- Matsusue, K.; Gavrilova, O.; Lambert, G.; Brewer, H.B., Jr.; Ward, J.M.; Inoue, Y.; LeRoith, D.; Gonzalez, F.J. Hepatic CCAAT/enhancer binding protein alpha mediates induction of lipogenesis and regulation of glucose homeostasis in leptin-deficient mice. Mol. Endocrinol. 2004, 18, 2751–2764. [Google Scholar] [CrossRef]
- Ferre, P.; Foufelle, F. Hepatic steatosis: A role for de novo lipogenesis and the transcription factor SREBP-1c. Diabetes Obes. Metab. 2010, 12 (Suppl. 2), 83–92. [Google Scholar] [CrossRef]
- Pitocco, D.; Tesauro, M.; Alessandro, R.; Ghirlanda, G.; Cardillo, C. Oxidative stress in diabetes: Implications for vascular and other complications. Int. J. Mol. Sci. 2013, 14, 21525–21550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brownlee, M. The pathobiology of diabetic complications: A unifying mechanism. Diabetes 2005, 54, 1615–1625. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiao, W.; Wang, R.S.; Handy, D.E.; Loscalzo, J. NAD(H) and NADP(H) Redox Couples and Cellular Energy Metabolism. Antioxid. Redox Signal. 2018, 28, 251–272. [Google Scholar] [CrossRef] [PubMed]
- Ghemrawi, R.; Battaglia-Hsu, S.F.; Arnold, C. Endoplasmic Reticulum Stress in Metabolic Disorders. Cells 2018, 7, 63. [Google Scholar] [CrossRef] [Green Version]
- Bhattarai, K.R.; Kim, H.K.; Chaudhary, M.; Ur Rashid, M.M.; Kim, J.; Kim, H.R.; Chae, H.J. TMBIM6 regulates redox-associated posttranslational modifications of IRE1alpha and ER stress response failure in aging mice and humans. Redox Biol. 2021, 47, 102128. [Google Scholar] [CrossRef]
- Mei, Z.; Zhang, X.; Yi, J.; Huang, J.; He, J.; Tao, Y. Sirtuins in metabolism, DNA repair and cancer. J. Exp. Clin. Cancer Res. 2016, 35, 182. [Google Scholar] [CrossRef] [Green Version]
- Lagouge, M.; Argmann, C.; Gerhart-Hines, Z.; Meziane, H.; Lerin, C.; Daussin, F.; Messadeq, N.; Milne, J.; Lambert, P.; Elliott, P.; et al. Resveratrol Improves Mitochondrial Function and Protects against Metabolic Disease by Activating SIRT1 and PGC-1α. Cell 2006, 127, 1109–1122. [Google Scholar] [CrossRef]
- Fedorenko, A.; Lishko, P.V.; Kirichok, Y. Mechanism of fatty-acid-dependent UCP1 uncoupling in brown fat mitochondria. Cell 2012, 151, 400–413. [Google Scholar] [CrossRef] [Green Version]
- Furukawa, S.; Fujita, T.; Shimabukuro, M.; Iwaki, M.; Yamada, Y.; Nakajima, Y.; Nakayama, O.; Makishima, M.; Matsuda, M.; Shimomura, I. Increased oxidative stress in obesity and its impact on metabolic syndrome. J. Clin. Investig. 2004, 114, 1752–1761. [Google Scholar] [CrossRef]
- Wang, M.; Wey, S.; Zhang, Y.; Ye, R.; Lee, A.S. Role of the unfolded protein response regulator GRP78/BiP in development, cancer, and neurological disorders. Antioxid. Redox Signal. 2009, 11, 2307–2316. [Google Scholar] [CrossRef]
- Stolz, A.; Wolf, D.H. Endoplasmic reticulum associated protein degradation: A chaperone assisted journey to hell. Biochim. Biophys. Acta 2010, 1803, 694–705. [Google Scholar] [CrossRef] [Green Version]
- Walter, P.; Ron, D. The unfolded protein response: From stress pathway to homeostatic regulation. Science 2011, 334, 1081–1086. [Google Scholar] [CrossRef] [Green Version]
- Halliwell, B. Antioxidants in human health and disease. Annu. Rev. Nutr. 1996, 16, 33–50. [Google Scholar] [CrossRef]
- Cecarini, V.; Gee, J.; Fioretti, E.; Amici, M.; Angeletti, M.; Eleuteri, A.M.; Keller, J.N. Protein oxidation and cellular homeostasis: Emphasis on metabolism. Biochim. Biophys. Acta 2007, 1773, 93–104. [Google Scholar] [CrossRef]
- Kitada, M.; Koya, D. SIRT1 in Type 2 Diabetes: Mechanisms and Therapeutic Potential. Diabetes Metab. J. 2013, 37, 315–325. [Google Scholar] [CrossRef]
- Caton, P.W.; Kieswich, J.; Yaqoob, M.M.; Holness, M.J.; Sugden, M.C. Metformin opposes impaired AMPK and SIRT1 function and deleterious changes in core clock protein expression in white adipose tissue of genetically-obese db/db mice. Diabetes Obes. Metab. 2011, 13, 1097–1104. [Google Scholar] [CrossRef]
- Jeon, S.-M. Regulation and function of AMPK in physiology and diseases. Exp. Mol. Med. 2016, 48, e245. [Google Scholar] [CrossRef]
- Koh, J.-H.; Kim, J.-Y. Role of PGC-1α in the Mitochondrial NAD+ Pool in Metabolic Diseases. Int. J. Mol. Sci. 2021, 22, 4558. [Google Scholar] [CrossRef]
- Weikel, K.A.; Ruderman, N.B.; Cacicedo, J.M. Unraveling the actions of AMP-activated protein kinase in metabolic diseases: Systemic to molecular insights. Metabolism 2016, 65, 634–645. [Google Scholar] [CrossRef] [Green Version]
- Boonstra, E.; De Kleijn, R.; Colzato, L.S.; Alkemade, A.; Forstmann, B.U.; Nieuwenhuis, S. Neurotransmitters as food supplements: The effects of GABA on brain and behavior. Front. Psychol. 2015, 6, 1520. [Google Scholar] [CrossRef] [Green Version]
- Sahab, N.R.M.; Subroto, E.; Balia, R.L.; Utama, G.L. gamma-Aminobutyric acid found in fermented foods and beverages: Current trends. Heliyon 2020, 6, e05526. [Google Scholar] [CrossRef]
Gene | Primer Sequences (5′–3′) | |
---|---|---|
SREBP-1c (NC_000077.7) | Forward Reverse | CTGTTGGTGCTCGTCTCCT TTGCGATGCCTCCAGAAGTA |
PPARγ (NC_000072.7) | Forward Reverse | GATGACAGCGACTTGGCAAT TGTAGCAGGTTGTCTTGAATGT |
FAS (NC_000085.7) | Forward Reverse | ATCCTGGCTGACGAAGACTC TGCTGCTGAGGTTGGAGAG |
CEBPα (NC_000073.7) | Forward Reverse | GACTTGGTGCGTCTAAGATGAG TAGGCATTGGAGCGGTGAG |
Cidea (NC_000084.7) | Forward Reverse | GCCTGCAGGAACTTATCAGC GCCTGCAGGAACTTATCAGC |
Dio2 (NC_000078.7) | Forward Reverse | CTGCGCTGTGTCTGGAAC GGAATTGGGAGCATCTTCAC |
UCP-1 (NC_000074.7) | Forward Reverse | GGCCTCTACGACTCAGTCCA TAAGCCGGCTGAGATCTTGT |
Adrb3 (NC_000074.7 ) | Forward Reverse | ACTGCTAGCATCGAGACCTTG AGGGTTGGTGACAGCTAGG |
PGC-1α (NC_000071.7) | Forward Reverse | GAAAGGGCCAAACAGAGAGA GTAAATCACACGGCGCTCTT |
β-actin (NC_000071.7) | Forward Reverse | AAGACCTCTATGCCAACACAGT AGCCAGAGCAGTAATCTCCTTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, H.-Y.; Lee, G.-H.; Hoang, T.-H.; Kim, Y.-M.; Jang, G.-H.; Seok, C.-H.; Gwak, Y.-G.-S.; Lim, J.; Kim, J.; Chae, H.-J. GABA and Fermented Curcuma longa L. Extract Enriched with GABA Ameliorate Obesity through Nox4-IRE1α Sulfonation-RIDD-SIRT1 Decay Axis in High-Fat Diet-Induced Obese Mice. Nutrients 2022, 14, 1680. https://doi.org/10.3390/nu14081680
Lee H-Y, Lee G-H, Hoang T-H, Kim Y-M, Jang G-H, Seok C-H, Gwak Y-G-S, Lim J, Kim J, Chae H-J. GABA and Fermented Curcuma longa L. Extract Enriched with GABA Ameliorate Obesity through Nox4-IRE1α Sulfonation-RIDD-SIRT1 Decay Axis in High-Fat Diet-Induced Obese Mice. Nutrients. 2022; 14(8):1680. https://doi.org/10.3390/nu14081680
Chicago/Turabian StyleLee, Hwa-Young, Geum-Hwa Lee, The-Hiep Hoang, Yu-Mi Kim, Gi-Hyun Jang, Chang-Hwan Seok, Yun-Geum-Sang Gwak, Junghyun Lim, Junghyun Kim, and Han-Jung Chae. 2022. "GABA and Fermented Curcuma longa L. Extract Enriched with GABA Ameliorate Obesity through Nox4-IRE1α Sulfonation-RIDD-SIRT1 Decay Axis in High-Fat Diet-Induced Obese Mice" Nutrients 14, no. 8: 1680. https://doi.org/10.3390/nu14081680