Time-of-Day Circadian Modulation of Grape-Seed Procyanidin Extract (GSPE) in Hepatic Mitochondrial Dynamics in Cafeteria-Diet-Induced Obese Rats
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Procedure in Animals
2.2. RNA Extraction
2.3. Gene-Expression Analysis
2.4. Serum Analysis
2.5. Extraction and Measurement of Concentrations of Lipids in Liver
2.6. Determination of Liver Mitochondrial Enzymatic Activities
2.7. Metabolomic Analysis
2.8. Circadian-Rhythm Analysis
2.9. Statistical Analysis
3. Results
3.1. Animal Body-Weight Gain Corroborates the Obesogenic Effect of the Cafeteria Diet
3.2. Intake of Obesogenic Diet Alters Circulating Levels of Glucose, TAG and TC
3.3. GSPE Restores CAF Diet-Related Disruption of Circadian Rhythm of Liver Core-Clock Genes
3.4. GSPE Modulates Changes in Mitochondrial Dynamics and Biogenesis Induced by Cafeteria Diet
3.5. Mitochondrial Respiratory Activity Is Highly Altered Due to CAF Diet but Partially Ameliorated by GSPE
3.6. GSPE Treatment Strongly Increases Concentrations of Metabolites of Tricarboxylic Acid Cycles in CAF-Fed Rats
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hüttemann, M.; Helling, S.; Sanderson, T.H.; Sinkler, C.; Samavati, L.; Mahapatra, G.; Varughese, A.; Lu, G.; Liu, J.; Ramzan, R.; et al. Regulation of Mitochondrial Respiration and Apoptosis through Cell Signaling: Cytochrome c Oxidase and Cytochrome c in Ischemia/Reperfusion Injury and Inflammation. Biochim. Biophys. Acta Bioenerg. 2012, 1817, 598–609. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brand, M.D.; Orr, A.L.; Perevoshchikova, I.V.; Quinlan, C.L. The Role of Mitochondrial Function and Cellular Bioenergetics in Ageing and Disease. Br. J. Dermatol. 2013, 169, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Schrepfer, E.; Scorrano, L. Mitofusins, from Mitochondria to Metabolism. Mol. Cell 2016, 61, 683–694. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kohsaka, A.; Das, P.; Hashimoto, I.; Nakao, T.; Deguchi, Y.; Gouraud, S.S.; Waki, H.; Muragaki, Y.; Maeda, M. The Circadian Clock Maintains Cardiac Function by Regulating Mitochondrial Metabolism in Mice. PLoS ONE 2014, 9, e112811. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Molina, A.J.A.; Wikstrom, J.D.; Stiles, L.; Las, G.; Mohamed, H.; Elorza, A.; Walzer, G.; Twig, G.; Katz, S.; Corkey, B.E.; et al. Mitochondrial Networking Protects β-Cells from Nutrient-Induced Apoptosis. Diabetes 2009, 58, 2303–2315. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gomes, L.C.; Di Benedetto, G.; Scorrano, L. During Autophagy Mitochondria Elongate, Are Spared from Degradation and Sustain Cell Viability. Nat. Cell Biol. 2011, 13, 589–598. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jheng, H.-F.; Tsai, P.-J.; Guo, S.-M.; Kuo, L.-H.; Chang, C.-S.; Su, I.-J.; Chang, C.-R.; Tsai, Y.-S. Mitochondrial Fission Contributes to Mitochondrial Dysfunction and Insulin Resistance in Skeletal Muscle. Mol. Cell. Biol. 2012, 32, 309–319. [Google Scholar] [CrossRef] [Scilit]
- Eura, Y.; Ishihara, N.; Yokota, S.; Mihara, K. Two Mitofusin Proteins, Mammalian Homologues of FZO, with Distinct Functions Are Both Required for Mitochondrial Fusion. J. Biochem. 2003, 134, 333–344. [Google Scholar] [CrossRef] [Scilit]
- Olichon, A.; Emorine, L.J.; Descoins, E.; Pelloquin, L.; Brichese, L.; Gas, N.; Guillou, E.; Delettre, C.; Valette, A.; Hamel, C.P.; et al. The Human Dynamin-Related Protein OPA1 Is Anchored to the Mitochondrial Inner Membrane Facing the Inter-Membrane Space. FEBS Lett. 2002, 523, 171–176. [Google Scholar] [CrossRef] [Scilit]
- Scorrano, L. Keeping Mitochondria in Shape: A Matter of Life and Death. European J. Clin. Investig. 2013, 43, 886–893. [Google Scholar] [CrossRef] [Scilit]
- Simmons, R.A.; Suponitsky-Kroyter, I.; Selak, M.A. Progressive Accumulation of Mitochondrial DNA Mutations and Decline in Mitochondrial Function Lead to β-Cell Failure. J. Biol. Chem. 2005, 280, 28785–28791. [Google Scholar] [CrossRef] [Scilit]
- Price, N.L.; Gomes, A.P.; Ling, A.J.Y.; Duarte, F.V.; Martin-Montalvo, A.; North, B.J.; Agarwal, B.; Ye, L.; Ramadori, G.; Teodoro, J.S.; et al. SIRT1 Is Required for AMPK Activation and the Beneficial Effects of Resveratrol on Mitochondrial Function. Cell Metab. 2012, 15, 675–690. [Google Scholar] [CrossRef] [Scilit]
- Dey, A.; Swaminathan, K. Hyperglycemia-Induced Mitochondrial Alterations in Liver. Life Sci. 2010, 87, 197–214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Civitarese, A.E.; Ravussin, E. Minireview: Mitochondrial Energetics and Insulin Resistance. Endocrinology 2008, 149, 950–954. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szendroedi, J.; Phielix, E.; Roden, M. The Role of Mitochondria in Insulin Resistance and Type 2 Diabetes Mellitus. Nat. Rev. Endocrinol. 2012, 8, 92–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rovira-Llopis, S.; Bañuls, C.; Diaz-Morales, N.; Hernandez-Mijares, A.; Rocha, M.; Victor, V.M. Mitochondrial Dynamics in Type 2 Diabetes: Pathophysiological Implications. Redox Biol. 2017, 11, 637–645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Degli Esposti, D.; Hamelin, J.; Bosselut, N.; Saffroy, R.; Sebagh, M.; Pommier, A.; Martel, C.; Lemoine, A. Mitochondrial Roles and Cytoprotection in Chronic Liver Injury. Biochem. Res. Int. 2012, 2012, 387626. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tahara, Y.; Shibata, S. Circadian Rhythms of Liver Physiology and Disease: Experimental and Clinical Evidence. Nat. Rev. Gastroenterol. Hepatol. 2016, 13, 217–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shetty, A.; Hsu, J.W.; Manka, P.P.; Syn, W.K. Role of the Circadian Clock in the Metabolic Syndrome and Nonalcoholic Fatty Liver Disease. Dig. Dis. Sci. 2018, 63, 3187–3206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reinke, H.; Asher, G. Circadian Clock Control of Liver Metabolic Functions. Gastroenterology 2016, 150, 574–580. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sardon Puig, L.; Valera-Alberni, M.; Cantó, C.; Pillon, N.J. Circadian Rhythms and Mitochondria: Connecting the Dots. Front. Genet. 2018, 9, 452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jacobi, D.; Liu, S.; Burkewitz, K.; Kory, N.; Knudsen, N.H.; Alexander, R.K.; Unluturk, U.; Li, X.; Kong, X.; Hyde, A.L.; et al. Hepatic Bmal1 Regulates Rhythmic Mitochondrial Dynamics and Promotes Metabolic Fitness. Cell Metab. 2015, 22, 709–720. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uchiyama, Y. Circadian Alterations in Tubular Structures on the Outer Mitochondrial Membrane of Rat Hepatocytes. Cell Tissue Res. 1981, 214, 519–527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schmitt, K.; Grimm, A.; Dallmann, R.; Oettinghaus, B.; Restelli, L.M.; Witzig, M.; Ishihara, N.; Mihara, K.; Ripperger, J.A.; Albrecht, U.; et al. Circadian Control of DRP1 Activity Regulates Mitochondrial Dynamics and Bioenergetics. Cell Metab. 2018, 27, 657–666.e5. [Google Scholar] [CrossRef] [Scilit]
- Zhou, D.; Wang, Y.; Chen, L.; Jia, L.; Yuan, J.; Sun, M.; Zhang, W.; Wang, P.; Zuo, J.; Xu, Z.; et al. Evolving Roles of Circadian Rhythms in Liver Homeostasis and Pathology. Oncotarget 2016, 7, 8625–8639. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mukherji, A.; Bailey, S.M.; Staels, B.; Baumert, T.F. The Circadian Clock and Liver Function in Health and Disease. J. Hepatol. 2019, 71, 200–211. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mazzoccoli, G.; De Cosmo, S.; Mazza, T. The Biological Clock: A Pivotal Hub in Non-Alcoholic Fatty Liver Disease Pathogenesis. Front. Physiol. 2018, 9, 193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheynier, V. Polyphenols in Foods Are More Complex than Often Thought. Am. J. Clin. Nutr. 2005, 81, 223S–229S. [Google Scholar] [CrossRef] [Scilit]
- Fraga, C.G.; Croft, K.D.; Kennedy, D.O.; Tomás-Barberán, F.A. The Effects of Polyphenols and Other Bioactives on Human Health. Food Funct. 2019, 10, 514–528. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mi, Y.; Qi, G.; Fan, R.; Ji, X.; Liu, Z.; Liu, X. EGCG Ameliorates Diet-Induced Metabolic Syndrome Associating with the Circadian Clock. Biochim. Biophys. Acta Mol. Basis Dis. 2017, 1863, 1575–1589. [Google Scholar] [CrossRef] [Scilit]
- Chiva-Blanch, G.; Badimon, L. Effects of Polyphenol Intake on Metabolic Syndrome: Current Evidences from Human Trials. Oxidative Med. Cell. Longev. 2017, 2017, 5812401. [Google Scholar] [CrossRef] [Scilit]
- Sun, L.; Wang, Y.; Song, Y.; Cheng, X.R.; Xia, S.; Rahman, M.R.T.; Shi, Y.; Le, G. Resveratrol Restores the Circadian Rhythmic Disorder of Lipid Metabolism Induced by High-Fat Diet in Mice. Biochem. Biophys. Res. Commun. 2015, 458, 86–91. [Google Scholar] [CrossRef] [Scilit]
- Qi, G.; Mi, Y.; Liu, Z.; Fan, R.; Qiao, Q.; Sun, Y.; Ren, B.; Liu, X. Dietary Tea Polyphenols Ameliorate Metabolic Syndrome and Memory Impairment via Circadian Clock Related Mechanisms. J. Funct. Foods 2017, 34, 168–180. [Google Scholar] [CrossRef] [Scilit]
- Qi, G.; Mi, Y.; Fan, R.; Zhao, B.; Ren, B.; Liu, X. Tea Polyphenols Ameliorates Neural Redox Imbalance and Mitochondrial Dysfunction via Mechanisms Linking the Key Circadian Regular Bmal1. Food Chem. Toxicol. 2017, 110, 189–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pajuelo, D.; Fernández-Iglesias, A.; Díaz, S.; Quesada, H.; Arola-Arnal, A.; Bladé, C.; Salvadó, J.; Arola, L. Improvement of Mitochondrial Function in Muscle of Genetically Obese Rats after Chronic Supplementation with Proanthocyanidins. J. Agric. Food Chem. 2011, 59, 8491–8498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pajuelo, D.; Quesada, H.; Díaz, S.; Fernández-Iglesias, A.; Arola-Arnal, A.; Bladé, C.; Salvadó, J.; Arola, L. Chronic Dietary Supplementation of Proanthocyanidins Corrects the Mitochondrial Dysfunction of Brown Adipose Tissue Caused by Diet-Induced Obesity in Wistar Rats. Br. J. Nutr. 2012, 107, 170–178. [Google Scholar] [CrossRef] [Scilit]
- Serra, A.; MacI, A.; Romero, M.P.; Valls, J.; Bladé, C.; Arola, L.; Motilva, M.J. Bioavailability of Procyanidin Dimers and Trimers and Matrix Food Effects in in Vitro and in Vivo Models. Br. J. Nutr. 2010, 103, 944–952. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Bligh, E.G.; Dyer, W.J. A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 1959, 37, 911–917. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Srere, P.A. Citrate Synthase. EC 4.1.3.7. Citrate Oxaloacetate-Lyase (CoA-Acetylating)]. Methods Enzymol. 1969, 13, 3–11. [Google Scholar] [CrossRef] [Scilit]
- Janssen, A.J.M.; Trijbels, F.J.M.; Sengers, R.C.A.; Smeitink, J.A.M.; Van Den Heuvel, L.P.; Wintjes, L.T.M.; Stoltenborg-Hogenkamp, B.J.M.; Rodenburg, R.J.T. Spectrophotometric Assay for Complex I of the Respiratory Chain in Tissue Samples and Cultured Fibroblasts. Clin. Chem. 2007, 53, 729–734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rustin, P.; Chretien, D.; Bourgeron, T.; Gérard, B.; Rötig, A.; Saudubray, J.M.; Munnich, A. Biochemical and Molecular Investigations in Respiratory Chain Deficiencies. Clin. Chim. Acta 1994, 228, 35–51. [Google Scholar] [CrossRef] [Scilit]
- Wharton, D.C.; Tzagoloff, A. Cytochrome Oxidase from Beef Heart Mitochondria. Methods Enzymol. 1967, 10, 245–250. [Google Scholar] [CrossRef] [Scilit]
- Cajka, T.; Fiehn, O. Toward Merging Untargeted and Targeted Methods in Mass Spectrometry-Based Metabolomics and Lipidomics. Anal. Chem. 2016, 88, 524–545. [Google Scholar] [CrossRef] [Scilit]
- Moškon, M. CosinorPy: A Python Package for Cosinor-Based Rhythmometry. BMC Bioinform. 2020, 21, 485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, J.; Psychogios, N.; Young, N.; Wishart, D.S. MetaboAnalyst: A Web Server for Metabolomic Data Analysis and Interpretation. Nucleic Acids Res. 2009, 37, W652–W660. [Google Scholar] [CrossRef] [Scilit]
- Pons, Z.; Margalef, M.; Bravo, F.I.; Arola-Arnal, A.; Muguerza, B. Acute Administration of Single Oral Dose of Grape Seed Polyphenols Restores Blood Pressure in a Rat Model of Metabolic Syndrome: Role of Nitric Oxide and Prostacyclin. Eur. J. Nutr. 2016, 55, 749–758. [Google Scholar] [CrossRef] [Scilit]
- Montagut, G.; Bladé, C.; Blay, M.; Fernández-Larrea, J.; Pujadas, G.; Salvadó, M.J.; Arola, L.; Pinent, M.; Ardévol, A. Effects of a Grapeseed Procyanidin Extract (GSPE) on Insulin Resistance. J. Nutr. Biochem. 2010, 21, 961–967. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pons, Z.; Margalef, M.; Bravo, F.I.; Arola-Arnal, A.; Muguerza, B. Chronic Administration of Grape-Seed Polyphenols Attenuates the Development of Hypertension and Improves Other Cardiometabolic Risk Factors Associated with the Metabolic Syndrome in Cafeteria Diet-Fed Rats. Br. J. Nutr. 2017, 117, 200–208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Serrano, J.; Casanova-Martí, À.; Blay, M.; Terra, X.; Ardévol, A.; Pinent, M. Defining Conditions for Optimal Inhibition of Food Intake in Rats by a Grape-Seed Derived Proanthocyanidin Extract. Nutrients 2016, 8, 652. [Google Scholar] [CrossRef] [Scilit]
- Wei, Y.; Rector, R.S.; Thyfault, J.P.; Ibdah, J.A. Nonalcoholic Fatty Liver Disease and Mitochondrial Dysfunction. World J. Gastroenterol. 2008, 14, 193–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Crescenzo, R.; Bianco, F.; Mazzoli, A.; Giacco, A.; Liverini, G.; Iossa, S. A Possible Link between Hepatic Mitochondrial Dysfunction and Diet-Induced Insulin Resistance. Eur. J. Nutr. 2016, 55, 1–6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prasun, P.; Ginevic, I.; Oishi, K. Mitochondrial Dysfunction in Nonalcoholic Fatty Liver Disease and Alcohol Related Liver Disease. Transl. Gastroenterol. Hepatol. 2021, 6, 4. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murakami, M.; Tognini, P.; Liu, Y.; Eckel-Mahan, K.L.; Baldi, P.; Sassone-Corsi, P. Gut Microbiota Directs PPARγ-Driven Reprogramming of the Liver Circadian Clock by Nutritional Challenge. EMBO Rep. 2016, 17, 1292–1303. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dyar, K.A.; Lutter, D.; Artati, A.; Ceglia, N.J.; Liu, Y.; Armenta, D.; Jastroch, M.; Schneider, S.; de Mateo, S.; Cervantes, M.; et al. Atlas of Circadian Metabolism Reveals System-Wide Coordination and Communication between Clocks. Cell 2018, 174, 1571. [Google Scholar] [CrossRef] [Scilit]
- Ribas-Latre, A.; Santos, R.B.; Fekry, B.; Tamim, Y.M.; Shivshankar, S.; Mohamed, A.M.T.; Baumgartner, C.; Kwok, C.; Gebhardt, C.; Rivera, A.; et al. Cellular and Physiological Circadian Mechanisms Drive Diurnal Cell Proliferation and Expansion of White Adipose Tissue. Nat. Commun. 2021, 12, 3482. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Greco, C.M.; Koronowski, K.B.; Smith, J.G.; Shi, J.; Kunderfranco, P.; Carriero, R.; Chen, S.; Samad, M.; Welz, P.S.; Zinna, V.M.; et al. Integration of Feeding Behavior by the Liver Circadian Clock Reveals Network Dependency of Metabolic Rhythms. Sci. Adv. 2021, 7, eabi7828. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Branecky, K.L.; Niswender, K.D.; Pendergast, J.S. Disruption of Daily Rhythms by High-Fat Diet Is Reversible. PLoS ONE 2015, 10, e0137970. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ribas-Latre, A.; Del Bas, J.M.; Baselga-Escudero, L.; Casanova, E.; Arola-Arnal, A.; Salvadó, M.J.; Bladé, C.; Arola, L. Dietary Proanthocyanidins Modulate the Rhythm of BMAL1 Expression and Induce RORα Transactivation in HepG2 Cells. J. Funct. Foods 2015, 13, 336–344. [Google Scholar] [CrossRef] [Scilit]
- Ribas-Latre, A.; Baselga-Escudero, L.; Casanova, E.; Arola-Arnal, A.; Salvadó, M.-J.; Bladé, C.; Arola, L. Dietary Proanthocyanidins Modulate BMAL1 Acetylation, Nampt Expression and NAD Levels in Rat Liver. Sci. Rep. 2015, 5, 10954. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jarosz, J.; Ghosh, S.; Delbridge, L.M.D.; Petzer, A.; Hickey, A.J.R.; Crampin, E.J.; Hanssen, E.; Rajagopal, V. Changes in Mitochondrial Morphology and Organization Can Enhance Energy Supply from Mitochondrial Oxidative Phosphorylation in Diabetic Cardiomyopathy. Am. J. Physiol. Cell Physiol. 2017, 312, C190–C197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farrell, G.C.; Larter, C.Z. Nonalcoholic Fatty Liver Disease: From Steatosis to Cirrhosis. Hepatology 2006, 43, S99–S112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- García-Ruiz, C.; Fernández-Checa, J.C. Mitochondrial Oxidative Stress and Antioxidants Balance in Fatty Liver Disease. Hepatol. Commun. 2018, 2, 1425–1439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Detmer, S.A.; Chan, D.C. Functions and Dysfunctions of Mitochondrial Dynamics. Nat. Rev. Mol. Cell Biol. 2007, 8, 870–879. [Google Scholar] [CrossRef] [Scilit]
- Huang, P.; Yu, T.; Yoon, Y. Mitochondrial Clustering Induced by Overexpression of the Mitochondrial Fusion Protein Mfn2 Causes Mitochondrial Dysfunction and Cell Death. Eur. J. Cell Biol. 2007, 86, 289–302. [Google Scholar] [CrossRef] [Scilit]
- Zhu, H.; Shan, Y.; Ge, K.; Lu, J.; Kong, W.; Jia, C. Specific Overexpression of Mitofusin-2 in Hepatic Stellate Cells Ameliorates Liver Fibrosis in Mice Model. Hum. Gene Ther. 2020, 31, 103–109. [Google Scholar] [CrossRef] [Scilit]
- Youle, R.J.; Van Der Bliek, A.M. Mitochondrial Fission, Fusion, and Stress. Science 2012, 337, 1062–1065. [Google Scholar] [CrossRef] [Scilit]
- Galloway, C.A.; Lee, H.; Brookes, P.S.; Yoon, Y. Decreasing Mitochondrial Fission Alleviates Hepatic Steatosis in a Murine Model of Nonalcoholic Fatty Liver Disease. Am. J. Physiol. Gastrointest. Liver Physiol. 2014, 307, G632–G641. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Ishihara, T.; Ibayashi, Y.; Tatsushima, K.; Setoyama, D.; Hanada, Y.; Takeichi, Y.; Sakamoto, S.; Yokota, S.; Mihara, K.; et al. Disruption of Mitochondrial Fission in the Liver Protects Mice from Diet-Induced Obesity and Metabolic Deterioration. Diabetologia 2015, 58, 2371–2380. [Google Scholar] [CrossRef] [Scilit]
- Martínez-reyes, I.; Chandel, N.S. Mitochondrial TCA Cycle Metabolites Control. Nat. Commun. 2020, 11, 102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, H.J.; Han, Y.H.; Na, H.; Kim, J.Y.; Kim, T.; Kim, H.J.; Shin, C.; Lee, J.W.; Lee, M.O. Liver-Specific Deletion of RORα Aggravates Diet-Induced Nonalcoholic Steatohepatitis by Inducing Mitochondrial Dysfunction. Sci. Rep. 2017, 7, 13392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reagan-Shaw, S.; Nihal, M.; Ahmad, N. Dose Translation from Animal to Human Studies Revisited. FASEB J. 2008, 22, 659–661. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zamora-Ros, R.; Forouhi, N.G.; Sharp, S.J.; González, C.A.; Buijsse, B.; Guevara, M.; van der Schouw, Y.T.; Amiano, P.; Boeing, H.; Bredsdorff, L.; et al. Dietary Intakes of Individual Flavanols and Flavonols Are Inversely Associated with Incident Type 2 Diabetes in European Populations. J. Nutr. 2014, 144, 335–343. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Gene | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
|---|---|---|
| Bmal1 | GTAGATCAGAGGGCGACGGCTA | CTTGTCTGTAAAACTTGCCTGTGAC |
| Cry1 | TGGAAGGTATGCGTGTCCTC | TCCAGGAGAACCTCCTCACG |
| Drp1 | CCAGGAATGACCAAGGTCCC | CCTCGTCCATCAGGTCCAAC |
| Fis1 | GCACGCAGTTTGAATACGCC | CTGCTCCTCTTTGCTACCTTTGG |
| Mfn1 | CCTTGTACATCGATTCCTGGGTTC | CCTGGGCTGCATTATCTGGTG |
| Mfn2 | GATGTCACCACGGAGCTGGA | AGAGACGCTCACTCACTTTG |
| Nampt | CTCTTCACAAGAGACTGCCG | TTCATGGTCTTTCCCCCACG |
| Nr1d1 | ACAGCTGACACCACCCAGATC | CATGGGCATAGGTGAAGATTTCT |
| Pcg1α | AGAGTCACCAAATGACCCCAAG | TTGGCTTTATGAGGAGGAGTCG |
| Per2 | CGGACCTGGCTTCAGTTCAT | AGGATCCAAGAACGGCACAG |
| Ppia | CCAAACACAAATGGTTCCCAGT | ATTCCTGGACCCAAAACGCT |
| Rorα | CCCGATGTCTTCAAATCCTTAGG | TCAGTCAGATGCATAGAACACAAACTC |
| Glucose (mg/dL) | Cholesterol (mg/dL) | Triglycerides (mg/dL) | NEFA (mg/dL) | |||
|---|---|---|---|---|---|---|
| ZT0 | ZT1 | STD-VH | 90.11 ± 2.68 | 90.96 ± 13.33 | 64.07 ± 5.81 | 21.93 ± 3.84 |
| CAF-VH | 96.22 ± 5.25 | 95.99 ± 7.07 | 108.5 ± 6.17 ** | 24.71 ± 2.46 | ||
| CAF-GSPE | 101.72 ± 7.7 | 100.55 ± 8.53 | 107.41 ± 19.36 | 21.12 ± 1.23 | ||
| ZT7 | STD-VH | 89.45 ± 3.38 | 101.17 ± 4.2 | 118.11 ± 14.71 | 32.4 ± 2.23 | |
| CAF-VH | 110.84 ± 4.22 ** | 134.24 ± 14.32 * | 319.19 ± 15.87 *** | 31.15 ± 2.2 | ||
| CAF-GSPE | 114.6 ± 6.01 | 142.02 ± 13.78 | 280.27 ± 42.88 | 33.17 ± 1.51 | ||
| ZT13 | STD-VH | 89.6 ± 3.67 | 87.6 ± 6.68 | 53.13 ± 9.52 | 25.38 ± 6.2 | |
| CAF-VH | 111.29 ± 6 * | 112.86 ± 22.76 | 204.94 ± 57.47 * | 32.62 ± 3.96 | ||
| CAF-GSPE | 96.13 ± 3.89 # | 79.6 ± 7.44 | 136.11 ± 32.03 | 35.5 ± 1.05 | ||
| ZT19 | STD-VH | 79.62 ± 4.25 | 85.75 ± 9.53 | 50.22 ± 6.36 | 22.23 ± 3.02 | |
| CAF-VH | 96.2 ± 6.8 | 97.05 ± 4.44 | 133.68 ± 18 ** | 28.66 ± 2.04 | ||
| CAF-GSPE | 97.38 ± 11.51 | 82.53 ± 9.56 | 118.93 ± 11.97 | 31.92 ± 2.97 | ||
| ZT12 | ZT1 | STD-VH | 85.7 ± 4.92 | 119.64 ± 17.95 | 84.23 ± 19.56 | 31.46 ± 10.85 |
| CAF-VH | 103.82 ± 4.64 * | 88.39 ± 10.1 | 122.92 ± 10.74 | 26.58 ± 2.58 | ||
| CAF-GSPE | 108.95 ± 8.27 | 92.68 ± 7.49 | 181.82 ± 27.14 | 30.66 ± 7.37 | ||
| ZT7 | STD-VH | 87.28 ± 8.97 | 134.24 ± 14.51 | 163.51 ± 19.99 | 30.14 ± 2.47 | |
| CAF-VH | 116.33 ± 6.05 * | 122.37 ± 17.35 | 320.27 ± 48.57 * | 32.74 ± 2.73 | ||
| CAF-GSPE | 125.87 ± 7.78 | 151.36 ± 13.35 | 366.76 ± 45.42 | 34.47 ± 3.99 | ||
| ZT13 | STD-VH | 85.49 ± 4.15 | 100.51 ± 14.49 | 49.84 ± 3.83 | 27.29 ± 2.74 | |
| CAF-VH | 124.13 ± 10.98 * | 119.27 ± 13.91 | 189.03 ± 39.51 * | 33.28 ± 4.73 | ||
| CAF-GSPE | 112.93 ± 9.55 | 118.23 ± 17.02 | 183.64 ± 55.82 | 34.24 ± 3.52 | ||
| ZT19 | STD-VH | 81.01 ± 7.4 | 93.55 ± 6.9 | 65.25 ± 6.78 | 31.02 ± 2.14 | |
| CAF-VH | 125.05 ± 10.89 * | 134.03 ± 19.23 * | 213.53 ± 51.16 * | 30.18 ± 2.07 | ||
| CAF-GSPE | 106.35 ± 14.1 | 128.44 ± 30.01 | 179.87 ± 44.01 | 32.26 ± 8.15 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rodríguez, R.M.; Cortés-Espinar, A.J.; Soliz-Rueda, J.R.; Feillet-Coudray, C.; Casas, F.; Colom-Pellicer, M.; Aragonès, G.; Avila-Román, J.; Muguerza, B.; Mulero, M.; et al. Time-of-Day Circadian Modulation of Grape-Seed Procyanidin Extract (GSPE) in Hepatic Mitochondrial Dynamics in Cafeteria-Diet-Induced Obese Rats. Nutrients 2022, 14, 774. https://doi.org/10.3390/nu14040774
Rodríguez RM, Cortés-Espinar AJ, Soliz-Rueda JR, Feillet-Coudray C, Casas F, Colom-Pellicer M, Aragonès G, Avila-Román J, Muguerza B, Mulero M, et al. Time-of-Day Circadian Modulation of Grape-Seed Procyanidin Extract (GSPE) in Hepatic Mitochondrial Dynamics in Cafeteria-Diet-Induced Obese Rats. Nutrients. 2022; 14(4):774. https://doi.org/10.3390/nu14040774
Chicago/Turabian StyleRodríguez, Romina M., Antonio J. Cortés-Espinar, Jorge R. Soliz-Rueda, Christine Feillet-Coudray, François Casas, Marina Colom-Pellicer, Gerard Aragonès, Javier Avila-Román, Begoña Muguerza, Miquel Mulero, and et al. 2022. "Time-of-Day Circadian Modulation of Grape-Seed Procyanidin Extract (GSPE) in Hepatic Mitochondrial Dynamics in Cafeteria-Diet-Induced Obese Rats" Nutrients 14, no. 4: 774. https://doi.org/10.3390/nu14040774
APA StyleRodríguez, R. M., Cortés-Espinar, A. J., Soliz-Rueda, J. R., Feillet-Coudray, C., Casas, F., Colom-Pellicer, M., Aragonès, G., Avila-Román, J., Muguerza, B., Mulero, M., & Salvadó, M. J. (2022). Time-of-Day Circadian Modulation of Grape-Seed Procyanidin Extract (GSPE) in Hepatic Mitochondrial Dynamics in Cafeteria-Diet-Induced Obese Rats. Nutrients, 14(4), 774. https://doi.org/10.3390/nu14040774

