The Application of Resolvin D1-Loaded Gelatin Methacrylate in a Rat Periodontitis Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Synthesis of GelMA Hydrogel and RvD1 Complexed with GelMA
2.2. Drug Release
2.3. Cell Culture and Cell Proliferation Assay
2.4. Experimental Periodontitis and Topical Application of RvD1 Complexed with GelMA
2.5. Histomorphometry
2.6. Micro-Computed Tomography (Micro-CT) Analysis
2.7. Quantitative Polymerase Chain Reaction (q-PCR) Analysis
2.8. Statistical Analysis
3. Results
3.1. Release Kinetics Study of RvD1
3.2. RvD1 Complexed with GelMA Promotes Cell Proliferation
3.3. RvD1 Restores Alveolar Bone Loss in Experimental Periodontitis by Regulating Osteogenesis-Related Factor Expression
3.4. RvD1 and Its Complexes Promote Alveolar Bone Repair in Rats
3.5. RvD1 and Its Complex Have a Restorative Effect on Periodontal Damage Caused by Experimental Periodontitis in Rats
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Heidari, Z.; Mahmoudzadeh-Sagheb, H.; Rigi-Ladiz, M.; Taheri, M.; Moazenni-Roodi, A.; Hashemi, M. Association of TGF-β1-509 C/T, 29 C/T and 788 C/T gene polymorphisms with chronic periodontitis: A case-control study. Gene 2013, 518, 330–334. [Google Scholar] [CrossRef] [PubMed]
- Krutyhołowa, A.; Strzelec, K.; Dziedzic, A.; Bereta, G.P.; Łazarz-Bartyzel, K.; Potempa, J.; Gawron, K. Host and bacterial factors linking periodontitis and rheumatoid arthritis. Front. Immunol. 2022, 13, 980805. [Google Scholar] [CrossRef] [PubMed]
- Radwan-Oczko, M.; Duś-Ilnicka, I.; Richards, P.; Thomsen, A.M.; Rasmussen, C. Evaluation of Oral Health Status and Oral Care of Patients with Rheumatoid Arthritis. Int. J. Dent. 2020, 2020, 8896766. [Google Scholar] [CrossRef] [PubMed]
- Preshaw, P.M.; Alba, A.L.; Herrera, D.; Jepsen, S.; Konstantinidis, A.; Makrilakis, K.; Taylor, R. Periodontitis and diabetes: A two-way relationship. Diabetologia 2012, 55, 21–31. [Google Scholar] [CrossRef]
- Waligóra, J.; Kuśnierz-Cabala, B.; Pawlica-Gosiewska, D.; Gawlik, K.; Chomyszyn-Gajewska, M.; Pytko-Polończyk, J. Salivary matrix metalloproteinase-9 (MMP-9) as a biomarker of periodontitis in pregnant patients with diabetes. Dent. Med. Probl. 2023, 60, 35–45. [Google Scholar] [CrossRef]
- Van Dyke, T.E. Proresolving lipid mediators: Potential for prevention and treatment of periodontitis. J. Clin. Periodontol. 2011, 38, 119–125. [Google Scholar] [CrossRef]
- Osorio Parra, M.; Elangovan, S.; Lee, C. Specialized pro-resolving lipid mediators in experimental periodontitis: A systematic review. Oral Dis. 2019, 25, 1265–1276. [Google Scholar] [CrossRef]
- Sun, Y.P.; Oh, S.F.; Uddin, J.; Yang, R.; Gotlinger, K.; Campbell, E.; Colgan, S.P.; Petasis, N.A.; Serhan, C.N. Resolvin D1 and Its Aspirin-triggered 17 R Epimer. J. Biol. Chem. 2007, 282, 9323–9334. [Google Scholar] [CrossRef]
- Dyke, T. Shifting the paradigm from inhibitors of inflammation to resolvers of inflammation in periodontitis. J. Periodontol. 2020, 91, S19–S25. [Google Scholar]
- Pinto, N.; Klein, Y.; David, E.; Polak, D.; Steinberg, D.; Mizrahi, G.; Khoury, Y.; Barenholz, Y.; Chaushu, S. Resolvin D1 improves allograft osteointegration and directly enhances osteoblasts differentiation. Front. Immunol. 2023, 14, 1086930. [Google Scholar] [CrossRef]
- Miyazawa, K.; Fukunaga, H.; Tatewaki, Y.; Takano, Y.; Taki, Y. Alzheimer’s Disease and Specialized Pro-Resolving Lipid Mediators: Do MaR1, RvD1, and NPD1 Show Promise for Prevention and Treatment? Int. J. Mol. Sci. 2020, 21, 5783. [Google Scholar] [CrossRef] [PubMed]
- Hamilton, J.A.; Hasturk, H.; Kantarci, A.; Serhan, C.N.; Van Dyke, T. Atherosclerosis, Periodontal Disease, and Treatment with Resolvins. Curr. Atheroscler. Rep. 2017, 19, 57. [Google Scholar] [CrossRef] [PubMed]
- Abullais Saquib, S.; Abdullah AlQahtani, N.; Ahmad, I.; Arora, S.; Mohammed Asif, S.; Ahmed Javali, M.; Nisar, N. Synergistic antibacterial activity of herbal extracts with antibiotics on bacteria responsible for periodontitis. J. Infect. Dev. Ctries. 2021, 15, 1685–1693. [Google Scholar] [CrossRef] [PubMed]
- Addy, M.; Martin, M.V. Systemic antimicrobials in the treatment of chronic periodontal diseases: A dilemma. Oral. Dis. 2003, 9 (Suppl. S1), 38–44. [Google Scholar] [CrossRef]
- Joshi, D.; Garg, T.; Goyal, A.; Rath, G. Advanced drug delivery approaches against periodontitis. Drug Deliv. 2016, 23, 363–377. [Google Scholar] [CrossRef]
- Aminu, N.; Chan, S.-Y.; Yam, M.-F.; Toh, S.-M. A dual-action chitosan-based nanogel system of triclosan and flurbiprofen for localised treatment of periodontitis. Int. J. Pharm. 2019, 570, 118659. [Google Scholar] [CrossRef]
- Liang, J.; Peng, X.; Zhou, X.; Zou, J.; Cheng, L. Emerging Applications of Drug Delivery Systems in Oral Infectious Diseases Prevention and Treatment. Molecules 2020, 25, 516. [Google Scholar] [CrossRef]
- İlk, S.; Ramanauskaitė, A.; Koç Bilican, B.; Mulerčikas, P.; Çam, D.; Onses, M.S.; Torun, I.; Kazlauskaitė, S.; Baublys, V.; Aydın, Ö.; et al. Usage of natural chitosan membrane obtained from insect corneal lenses as a drug carrier and its potential for point of care tests. Mater. Sci. Eng. C Mater. Biol. Appl. 2020, 112, 110897. [Google Scholar] [CrossRef]
- Wijaya, C.J.; Saputra, S.N.; Soetaredjo, F.E.; Putro, J.N.; Lin, C.X.; Kurniawan, A.; Ju, Y.H.; Ismadji, S. Cellulose nanocrystals from passion fruit peels waste as antibiotic drug carrier. Carbohydr. Polym. 2017, 175, 370–376. [Google Scholar] [CrossRef]
- Takei, T.; Yoshihara, R.; Danjo, S.; Fukuhara, Y.; Evans, C.; Tomimatsu, R.; Ohzuno, Y.; Yoshida, M. Hydrophobically-modified gelatin hydrogel as a carrier for charged hydrophilic drugs and hydrophobic drugs. Int. J. Biol. Macromol. 2020, 149, 140–147. [Google Scholar] [CrossRef]
- Tyler, B.; Gullotti, D.; Mangraviti, A.; Utsuki, T.; Brem, H. Polylactic acid (PLA) controlled delivery carriers for biomedical applications. Adv. Drug Deliv. Rev. 2016, 107, 163–175. [Google Scholar] [CrossRef] [PubMed]
- Ziba, M.; Chaber, P.; Duale, K.; Maksymiak, M.M.; Adamus, G. Polymeric Carriers for Delivery Systems in the Treatment of Chronic Periodontal Disease. Polymers 2020, 12, 1574. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Hao, Y.; Wang, Y.; Chen, J.; Liao, W. Functional Hydrogels and Their Application in Drug Delivery, Biosensors, and Tissue Engineering. Int. J. Polym. Sci. 2019, 2019, 3160732. [Google Scholar] [CrossRef]
- Xiao, S.; Zhao, T.; Wang, J.; Wang, C.; Du, J.; Ying, L.; Lin, J.; Zhang, C.; Hu, W.; Wang, L.; et al. Gelatin Methacrylate (GelMA)-Based Hydrogels for Cell Transplantation: An Effective Strategy for Tissue Engineering. Stem Cell Rev. Rep. 2019, 15, 664–679. [Google Scholar] [CrossRef]
- Wu, Z.; Xie, S.; Kang, Y.; Shan, X.; Li, Q.; Cai, Z. Biocompatibility evaluation of a 3D-bioprinted alginate-GelMA-bacteria nanocellulose (BNC) scaffold laden with oriented-growth RSC96 cells. Mater. Sci. Eng. C Mater. Biol. Appl. 2021, 129, 112393. [Google Scholar] [CrossRef]
- Cai, J.; Liu, J.; Yan, J.; Lu, X.; Wang, X.; Li, S.; Mustafa, K.; Wang, H.; Xue, Y.; Mustafa, M.; et al. Impact of Resolvin D1 on the inflammatory phenotype of periodontal ligament cell response to hypoxia. J. Periodontal Res. 2022, 57, 1034–1042. [Google Scholar] [CrossRef]
- Jiang, X.; Liu, J.; Li, S.; Qiu, Y.; Wang, X.; He, X.; Pedersen, T.O.; Mustafa, K.; Xue, Y.; Mustafa, M.; et al. The effect of resolvin D1 on bone regeneration in a rat calvarial defect model. J. Tissue Eng. Regen. Med. 2022, 16, 987–997. [Google Scholar] [CrossRef]
- Hasturk, H.; Kantarci, A.; Goguet-Surmenian, E.; Blackwood, A.; Andry, C.; Serhan, C.; Van Dyke, T. Resolvin E1 regulates inflammation at the cellular and tissue level and restores tissue homeostasis in vivo. J. Immunol. 2007, 179, 7021–7029. [Google Scholar] [CrossRef]
- Winkler, J.W.; Orr, S.K.; Dalli, J.; Cheng, C.; Sanger, J.M.; Chiang, N.; Petasis, N.A.; Serhan, C.N. Resolvin D4 stereoassignment and its novel actions in host protection and bacterial clearance. Sci. Rep. 2016, 6, 18972. [Google Scholar] [CrossRef]
- Mustafa, M.; Zarrough, A.; Bolstad, A.; Lygre, H.; Mustafa, K.; Hasturk, H.; Serhan, C.; Kantarci, A.; Van Dyke, T. Resolvin D1 protects periodontal ligament. Am. J. Physiol. Cell Physiol. 2013, 305, C673–C679. [Google Scholar] [CrossRef]
- Abdelkarem, H.; Fadda, L.; El-Sayed, E.; Radwan, O. Potential Role of L-Arginine and Vitamin E Against Bone Loss Induced by Nano-Zinc Oxide in Rats. J. Diet. Suppl. 2018, 15, 300–310. [Google Scholar] [CrossRef] [PubMed]
- Garg, V.S. Hydrogels: From controlled release to pH-responsive drug delivery. Drug Discov. Today 2002, 7, 569–579. [Google Scholar]
- Xing, Z.; Wang, C.; Yan, J.; Zhang, L.; Li, L.; Zha, L. Dual stimuli responsive hollow nanogels with IPN structure for temperature controlling drug loading and pH triggering drug release. Soft Matter 2011, 7, 7992. [Google Scholar] [CrossRef]
- Rodriguez-Fragoso, L.; Martfnez-Arismendi, R.L.; Orozco-Bustos, R.; Reyes-Esparza, R.; Torres, R.; Burchiel, R.W. Potential risks resulting from fruit/vegetable-drug interactions: Effects on drug-metabolizing enzymes and drug transporters. J. Food Sci. 2011, 76, R112–R124. [Google Scholar] [CrossRef]
- Ehnert, S.; Relja, B.; Schmidt-Bleek, K.; Fischer, V.; Ignatius, A.; Linnemann, C.; Rinderknecht, H.; Huber-Lang, M.; Kalbitz, M.; Histing, T.; et al. Effects of immune cells on mesenchymal stem cells during fracture healing. World J. Stem Cells 2021, 13, 1667–1695. [Google Scholar] [CrossRef]
- Shrestha, S.; McFadden, M.; Gramolini, A.; Santerre, J. Proteome analysis of secretions from human monocyte-derived macrophages post-exposure to biomaterials and the effect of secretions on cardiac fibroblast fibrotic character. Acta Biomater. 2020, 111, 80–90. [Google Scholar] [CrossRef]
- Amani, H.; Alipour, M.; Shahriari, E.; Taboas, J.M. Immunomodulatory Biomaterials: Tailoring Surface Properties to Mitigate Foreign Body Reaction and Enhance Tissue Regeneration. Adv. Healthc. Mater. 2024, 13, e2401253. [Google Scholar] [CrossRef]
- Ganesan, R.; Henkels, K.; Shah, K.; De La Rosa, X.; Libreros, S.; Cheemarla, N.; Serhan, C.; Gomez-Cambronero, J. D-series Resolvins activate Phospholipase D in phagocytes during inflammation and resolution. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2020, 34, 15888–15906. [Google Scholar] [CrossRef]
- Mizraji, G.; Heyman, O.; Van Dyke, T.; Wilensky, A. Resolvin D2 Restrains Th1 Immunity and Prevents Alveolar Bone Loss in Murine Periodontitis. Front. Immunol. 2018, 9, 785. [Google Scholar] [CrossRef]
- Xiang, S.; Ye, Y.; Yang, Q.; Xu, H.; Shen, C.; Ma, M.; Jin, S.; Mei, H.; Zheng, S.; Smith, F.; et al. RvD1 accelerates the resolution of inflammation by promoting apoptosis of the recruited macrophages via the ALX/FasL-FasR/caspase-3 signaling pathway. Cell Death Discov. 2021, 7, 339. [Google Scholar] [CrossRef]
- Wynn, T.A.; Barron, L. Macrophages: Master regulators of inflammation and fibrosis. Semin. Liver Dis. 2010, 30, 245–257. [Google Scholar] [CrossRef] [PubMed]
- Cieszkowski, J.; Warzecha, Z.; Ceranowicz, P.; Ceranowicz, D.; Kusnierz-Cabala, B.; Pedziwiatr, M.; Dembinski, M.; Ambrozy, T.; Kaczmarzyk, T.; Pihut, M.; et al. Therapeutic effect of exogenous ghrelin in the healing of gingival ulcers is mediated by the release of endogenous growth hormone and insulin-like growth factor-1. J. Physiol. Pharmacol. 2017, 68, 609–617. [Google Scholar]
- Redlich, K.; Smolen, J. Inflammatory bone loss: Pathogenesis and therapeutic intervention. Nat. Rev. Drug Discov. 2012, 11, 234–250. [Google Scholar] [CrossRef]
- Benabdoun, H.; Kulbay, M.; Rondon, E.; Vallières, F.; Shi, Q.; Fernandes, J.; Fahmi, H.; Benderdour, M. In vitro and in vivo assessment of the proresolutive and antiresorptive actions of resolvin D1: Relevance to arthritis. Arthritis Res. Ther. 2019, 21, 72. [Google Scholar] [CrossRef]
- Liu, H.; Wu, X.; Gang, N.; Wang, S.; Deng, W.; Zan, L.; Yu, S. Macrophage functional phenotype can be consecutively and reversibly shifted to adapt to microenvironmental changes. Int. J. Clin. Exp. Med. 2015, 8, 3044–3053. [Google Scholar]
- Anderson, J.M.; Rodriguez, A.; Chang, D.T. Foreign body reaction to biomaterials. Semin. Immunol. 2008, 20, 86–100. [Google Scholar] [CrossRef]
- Morris, A.H.; Stamer, D.K.; Kyriakides, T.R. The host response to naturally-derived extracellular matrix biomaterials. Semin. Immunol. 2017, 29, 72–91. [Google Scholar] [CrossRef]
- Yin, C.; Zhao, Q.; Li, W.; Zhao, Z.; Wang, J.; Deng, T.; Zhang, P.; Shen, K.; Li, Z.; Zhang, Y. Biomimetic anti-inflammatory nano-capsule serves as a cytokine blocker and M2 polarization inducer for bone tissue repair. Acta Biomater. 2020, 102, 416–426. [Google Scholar] [CrossRef]
Gene | Forward Primer, 5′-3′ | Reverse Primer, 5′–3′ |
---|---|---|
GADPH | GGCACAGTCAAGGCTGAGAATG | ATGGTGGTGAAGAVGVCAGTA |
TNF-α | GGCGTGTTCATCCGTTCTC’ | CTTCAGCGTCTCGTGTGTTTCT |
IL-10 | CAGACCCACATGCTCCGAGA | CAAGGCTTGGCAACCCAAGTA |
RUNX2 | CATGGCCGGGAATGATGAG | TGTGAAGACCGTTATGGTCAAAGTG |
RANKL | GCAGCATCGCTCTGTTCCTGTA | GCATGAGTCAGGTAGTGCTTCTGTG |
OPG | CTCATCAGTTGGTGGGAATGAAGA | ACCTGGCAGCTTTGCACAATTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xing, Z.; Liu, J.; Cai, J.; Jiang, X.; Liang, J.; Fujio, M.; Hadler-Olsen, E.; Wang, J.; Kantarci, A.; Xue, Y. The Application of Resolvin D1-Loaded Gelatin Methacrylate in a Rat Periodontitis Model. Pharmaceutics 2025, 17, 16. https://doi.org/10.3390/pharmaceutics17010016
Xing Z, Liu J, Cai J, Jiang X, Liang J, Fujio M, Hadler-Olsen E, Wang J, Kantarci A, Xue Y. The Application of Resolvin D1-Loaded Gelatin Methacrylate in a Rat Periodontitis Model. Pharmaceutics. 2025; 17(1):16. https://doi.org/10.3390/pharmaceutics17010016
Chicago/Turabian StyleXing, Zhe, Jing Liu, Jiazheng Cai, Xiaofeng Jiang, Jingwen Liang, Masahito Fujio, Elin Hadler-Olsen, Jing Wang, Alpdogan Kantarci, and Ying Xue. 2025. "The Application of Resolvin D1-Loaded Gelatin Methacrylate in a Rat Periodontitis Model" Pharmaceutics 17, no. 1: 16. https://doi.org/10.3390/pharmaceutics17010016
APA StyleXing, Z., Liu, J., Cai, J., Jiang, X., Liang, J., Fujio, M., Hadler-Olsen, E., Wang, J., Kantarci, A., & Xue, Y. (2025). The Application of Resolvin D1-Loaded Gelatin Methacrylate in a Rat Periodontitis Model. Pharmaceutics, 17(1), 16. https://doi.org/10.3390/pharmaceutics17010016