New Organosilicon Composite Based on Borosiloxane and Zinc Oxide Nanoparticles Inhibits Bacterial Growth, but Does Not Have a Toxic Effect on the Development of Animal Eukaryotic Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Metal Oxide Nanoparticles Synthesis and Characteristics Assay
2.2. Borosiloxan Composites Synthesis and Rheological Characteristics Assay
2.3. Measurement of Hydrogen Peroxide Concentration
2.4. Measurement of OH-Radicals Concentration
2.5. Measurement of Long-Lived Reactive Protein Species Concentration
2.6. Enzyme-Linked Immunosorbent Assay (ELISA)
2.7. Bacteriostatic Activity Assay
2.8. Cell Culture
2.9. Determination of Changes in Gene Expression
2.10. Statistic
3. Results
3.1. Physicochemical Characteristics of Materials and Composite
3.2. Influence of Composite on ROS Generation and Damage to Biomolecules
3.3. Influence of the Composite on the Growth and Development of Eukaryotic and Prokaryotic Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hanley, C.; Layne, J.; Punnoose, A.; Reddy, K.M.; Coombs, I.; Coombs, A.; Feris, K.; Wingett, D. Preferential killing of cancer cells and activated human T cells using ZnO nanoparticles. Nanotechnology 2008, 19, 295103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Houskova, V.; Stengl, V.; Bakardjieva, S.; Murafa, N.; Kalendova, A.; Oplustil, F. Zinc oxide prepared by homogeneous hy-drolysis with thioacetamide, its destruction of warfare agents, and photocatalytic activity. J. Phys. Chem. A 2007, 111, 4215–4221. [Google Scholar] [CrossRef] [PubMed]
- Manzoor, U.; Siddique, S.; Ahmed, R.; Noreen, Z.; Bokhari, H.; Ahmad, I. Antibacterial, Structural and Optical Characterization of Mechano-Chemically Prepared ZnO Nanoparticles. PLoS ONE 2016, 11, e0154704. [Google Scholar] [CrossRef] [Green Version]
- Dadi, R.; Azouani, R.; Traore, M.; Mielcarek, C.; Kanaev, A. Antibacterial activity of ZnO and CuO nanoparticles against gram positive and gram negative strains. Mater. Sci. Eng. C 2019, 104, 109968. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, H.; Shanmugam, V. A review on anti-inflammatory activity of green synthesized zinc oxide nanoparticle: Mecha-nism-based approach. Bioorg. Chem. 2020, 94, 103423. [Google Scholar] [CrossRef]
- Mishra, P.K.; Mishra, H.; Ekielski, A.; Talegaonkar, S.; Vaidya, B. Zinc oxide nanoparticles: A promising nanomaterial for biomedical applications. Drug Discov. Today 2017, 22, 1825–1834. [Google Scholar] [CrossRef] [PubMed]
- Umrani, R.D.; Paknikar, K.M. Zinc oxide nanoparticles show antidiabetic activity in streptozotocin-induced Type 1 and 2 diabetic rats. Nanomedicine 2014, 9, 89–104. [Google Scholar] [CrossRef] [PubMed]
- Azam, A.; Ahmed, A.S.; Oves, M.; Khan, M.S.; Habib, S.S.; Memic, A. Antimicrobial activity of metal oxide nanoparticles against Gram-positive and Gram-negative bacteria: A comparative study. Int. J. Nanomed. 2012, 7, 6003–6009. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hernández-Sierra, J.F.; Ruiz, F.; Pena, D.C.; Martínez-Gutiérrez, F.; Martínez, A.E.; Guillén, A.; Tapia-Pérez, H.; Castañón, G.M. The antimicrobial sensitivity of Streptococcus mutans to nanoparticles of silver, zinc oxide, and gold. Nanomedicine 2008, 4, 237–240. [Google Scholar] [CrossRef]
- McGuffie, M.J.; Hong, J.; Bahng, J.H.; Glynos, E.; Green, P.F.; Kotov, N.A.; Younger, J.G.; VanEpps, J.S. Zinc oxide nanoparticle suspensions and layer-by-layer coatings inhibit staphylococcal growth. Nanomedicine 2015, 12, 33–42. [Google Scholar] [CrossRef] [Green Version]
- Sarwar, S.; Chakraborti, S.; Bera, S.; Sheikh, I.A.; Hoque, K.M.; Chakrabarti, P. The antimicrobial activity of ZnO nanoparticles against Vibrio cholerae: Variation in response depends on biotype. Nanomedicine 2016, 12, 1499–1509. [Google Scholar] [CrossRef]
- Li, D.; Shen, M.; Xia, J.; Shi, X. Recent developments of cancer nanomedicines based on ultrasmall iron oxide nanoparticles and nanoclusters. Nanomedicine 2021, 16, 609–612. [Google Scholar] [CrossRef] [PubMed]
- Boval’Dinova, K.A.; Sherstneva, N.E.; Fel’Dshtein, M.M.; Moskalets, A.P.; Khokhlov, A.R. Pressure-Sensitive Adhesives with Tunable Tackiness. Polym. Sci. Ser. B 2019, 61, 458–470. [Google Scholar] [CrossRef]
- Aleshina, A.L.; Shibaeva, A.V.; Philippova, O.E.; Khokhlova, A.R. Self-healing double polymer networks with dynamic cross-links. Doklad. Akad. Nauk 2020, 491, 64–68. (In Russian) [Google Scholar]
- Lyutakov, O.; Kalachyova, Y.; Solovyev, A.; Vytykacova, S.; Svanda, J.; Siegel, J.; Ulbrich, P.; Svorcik, V. One-step preparation of antimicrobial silver nanoparticles in polymer matrix. J. Nanoparticle Res. 2015, 17, 1–11. [Google Scholar] [CrossRef]
- Pozdnyakov, A.S.; Ivanova, A.A.; Emel’yanov, A.I.; Prozorova, G.F. Metal-polymer Ag nanocomposites based on hydrophilic nitrogen-and sulfur-containing copolymers: Control of nanoparticle size. Russ. Chem. Bull. 2020, 69, 715–720. [Google Scholar] [CrossRef]
- Sánchez-Valdes, S.; Ramírez-Vargas, E.; Ortega-Ortiz, H.; Ramos-deValle, L.F.; Méndez-Nonell, J.; Mondragón-Chaparro, M.; Neira-Velázquez, G.; Yañez-Flores, I.; Meza-Rojas, D.E.; Lozuno-Ramirez, T. Silver nanoparticle deposition on hydrophilic multilayer film surface and its effect on antimicrobial activity. J. Appl. Polym. Sci. 2012, 123, 2643–2650. [Google Scholar] [CrossRef]
- Xu, C.; Wang, Y.; Wu, J.; Song, S.; Cao, S.; Xuan, S.; Jiang, W.; Gong, X. Anti-impact response of Kevlar sandwich structure with silly putty core. Compos. Sci. Technol. 2017, 153, 168–177. [Google Scholar] [CrossRef]
- Palmer, R.M.; Green, P.C. Energy Absorbing Material. U.S. Patent US7381460B2, 3 June 2008. [Google Scholar]
- Speck, O.; Speck, T. An Overview of Bioinspired and Biomimetic Self-Repairing Materials. Biomimetics 2019, 4, 26. [Google Scholar] [CrossRef] [Green Version]
- Wood, C.D.; Green, P.A. Method and Device for Detecting Fascia Damage and Repairing the Same. U.S. Patent US20170228094A1, 10 August 2017. [Google Scholar]
- Tee, B.C.K.; Wang, C.; Allen, R.; Bao, Z. An electrically and mechanically self-healing composite with pressure- and flex-ion-sensitive properties for electronic skin applications. Nat. Nanotech. 2012, 7, 825–832. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Zhu, B.; Jiang, W.; Yang, Y.; Leow, W.R.; Wang, H.; Chen, X. A mechanically and electrically self-healing super-capacitor. Adv. Mater. 2014, 26, 3638–3643. [Google Scholar] [CrossRef]
- Blokhina, S.V.; Olkhovich, M.V.; Sharapova, A.V.; Zhirova, E.D. Synthesis and pharmaceutical significant physical and chemical properties of a new bioactive fluorine derivative of triazol-3-thione. Liq. Cryst. Appl. 2021, 21, 35–44. [Google Scholar] [CrossRef]
- Belyaev, V.V.; Mashchenko, V.I.; Chausov, D.N.; Solomatin, A.S. A Method of Obtaining of a Mixture of Liquid Crystal with a Polymer for Display Technology and Optoelectronics. RU Patent 2607454, 27 December 2016. [Google Scholar]
- Mashchenko, V.I.; Sitnikov, N.N.; Khabibullina, I.A.; Chausov, D.N.; Shelyakov, A.V.; Spiridonov, V.V. Effect of Boric Acid on the Structure and Properties of Borosiloxanes. Polym. Sci. Ser. A 2021, 63, 91–99. [Google Scholar] [CrossRef]
- Baimler, I.V.; Simakin, A.V.; Uvarov, O.V.; Volkov, M.Y.; Gudkov, S.V. Generation of Hydroxyl Radicals during Laser Breakdown of Aqueous Solutions in the Presence of Fe and Cu Nanoparticles of Different Sizes. Phys. Wave Phenom. 2020, 28, 107–110. [Google Scholar] [CrossRef]
- Kirsanov, E.A.; Timoshin, Y.N. Non-Newtonian flow of structured systems: II Analysis of flow curve. Liq. Cryst. Appl. 2012, 4, 71–80. (In Russian) [Google Scholar]
- Shcherbakov, I.A.; Baimler, I.V.; Gudkov, S.V.; Lyakhov, G.A.; Mikhailova, G.N.; Pustovoy, V.I.; Sarimov, R.M.; Simakin, A.V.; Troitsky, A.V. Influence of a Constant Magnetic Field on Some Properties of Water Solutions. Doklad. Phys. 2020, 65, 273–275. [Google Scholar] [CrossRef]
- Gudkov, S.V.; Guryev, E.L.; Gapeyev, A.B.; Sharapov, M.G.; Bunkin, N.F.; Shkirin, A.V.; Zabelina, T.S.; Glinushkin, A.P.; Sevost’yanov, M.A.; Belosludtsev, K.N.; et al. Unmodified hydrated C60 fullerene molecules exhibit antioxidant properties, prevent damage to DNA and proteins induced by reactive oxygen species and protect mice against injuries caused by radiation-induced oxidative stress. Nanomedicine 2019, 15, 37–46. [Google Scholar] [CrossRef] [PubMed]
- Gudkov, S.; Garmash, S.A.; Shtarkman, I.N.; Chernikov, A.V.; Karp, O.E.; Bruskov, V.I. Long-lived protein radicals induced by X-ray irradiation are the source of reactive oxygen species in aqueous medium. Dokl. Biochem. Biophys. 2010, 430, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Gudkov, S.; Shtarkman, I.N.; Chernikov, A.V.; Usacheva, A.M.; Bruskov, V.I. Guanosine and inosine (riboxin) eliminate the long-lived protein radicals induced X-ray radiation. Dokl. Biochem. Biophys. 2007, 413, 50–53. [Google Scholar] [CrossRef]
- Shtarkman, I.N.; Gudkov, S.V.; Chernikov, A.V.; Bruskov, V.I. Effect of amino acids on X-ray-induced hydrogen peroxide and hydroxyl radical formation in water and 8-oxoguanine in DNA. Biochemistry 2008, 73, 470–478. [Google Scholar] [CrossRef]
- Barkhudarov, E.; Kossyi, I.; Anpilov, A.; Ivashkin, P.; Artem’Ev, K.; Moryakov, I.; Misakyan, M.; Christofi, N.; Burmistrov, D.; Smirnova, V.; et al. New Nanostructured Carbon Coating Inhibits Bacterial Growth, but Does Not Influence on Animal Cells. Nanomaterials 2020, 10, 2130. [Google Scholar] [CrossRef] [PubMed]
- Kaplan, M.A.; Sergienko, K.V.; Kolmakova, A.A.; Konushkin, S.V.; Baikin, A.S.; Kolmakov, A.G.; Sevostyanov, M.A.; Kulikov, A.V.; Ivanov, V.E.; Belosludtsev, K.N.; et al. Development of a biocompatible PLGA polymers with a thrombolytic effect for stents coatings. J. Biomater. Sci. 2020, 31, 1405–1420. [Google Scholar] [CrossRef]
- Gudkov, S.V.; Simakin, A.V.; Konushkin, S.V.; Ivannikov, A.Y.; Nasakina, E.O.; Shatova, L.A.; Kolmakov, A.G.; Sevostyanov, M.A. Preparation, structural and microstructural characterization of Ti–30Nb–10Ta–5Zr alloy for biomedical applications. J. Mater. Res. Technol. 2020, 9, 16018–16028. [Google Scholar] [CrossRef]
- Konushkin, S.V.; Sergiyenko, K.V.; Nasakina, E.O.; Leontyev, V.G.; Kuznetsova, O.G.; Titov, D.D.; Tsareva, A.M.; Dormi-dontov, N.A.; Kirsankin, A.A.; Kannykin, S.V.; et al. Study of the physicochemical and biological properties of the new promising Ti–20Nb–13Ta–5Zr alloy for biomedical applications. Mater. Chem. Phys. 2020, 255, 123557. [Google Scholar] [CrossRef]
- Gupta, M.K.; Martin, J.R.; Werfel, T.A.; Shen, T.; Page, J.M.; Duvall, C.L. Cell protective, ABC triblock polymer-based ther-moresponsive hydrogels with ROS-triggered degradation and drug release. J. Am. Chem. Soc. 2014, 136, 14896–14902. [Google Scholar] [CrossRef] [PubMed]
- Balenko, N.V.; Bobrovsky, A.Y.; Vtyurina, E.S.; Shibaev, V.P. Mechanosensitive liquid crystalline composites based on cholesterics dispersed in polyvinyl alcohol films. Liq. Cryst. Appl. 2021, 21, 26. [Google Scholar] [CrossRef]
- Bezborodov, V.S.; Finko, A.V.; Mikhalyonok, S.G.; Derikov, Y.I.; Shandryuk, G.A.; Kuz’menok, N.M.; Arol, A.S.; Karpov, O.N.; Talroze, R.V. Anisotropic derivatives of 6-aryloxyhexanoic acid and nanocomposites on their base. Liq. Cryst. Appl. 2021, 21, 24. [Google Scholar] [CrossRef]
- Fu, P.P.; Xia, Q.; Hwang, H.-M.; Ray, P.C.; Yu, H. Mechanisms of nanotoxicity: Generation of reactive oxygen species. J. Food Drug Anal. 2014, 22, 64–75. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Premanathan, M.; Karthikeyan, K.; Jeyasubramanian, K.; Manivannan, G. Selective toxicity of ZnO nanoparticles toward Gram-positive bacteria and cancer cells by apoptosis through lipid peroxidation. Nanomedicine 2011, 7, 184–192. [Google Scholar] [CrossRef]
- Nagao, S.; Murao, K.; Imachi, H.; Cao, W.M.; Yu, X.; Li, J.; Matsumoto, K.; Nishiuchi, T.; Ahmed, R.A.; Wong, N.C.; et al. Platelet derived growth factor regulates ABCA1 expression invascular smooth muscle cells. Int. J. Biochem. Cell Biol. 2006, 39, 44–84. [Google Scholar]
- Valko, M.; Rhodes, C.; Moncol, J.; Izakovic, M.; Mazur, M. Free radicals, metals and antioxidants in oxidative stress-induced cancer. Chem. Biol. Interact. 2006, 160, 1–40. [Google Scholar] [CrossRef]
- Shim, M.S.; Xia, Y. A Reactive oxygen species (ROS)-responsive polymer for safe, efficient, and targeted gene delivery in cancer cells. Angew. Chem. 2013, 25, 7064–7067. [Google Scholar] [CrossRef] [Green Version]
- Na, Y.; Lee, J.S.; Woo, J.; Ahn, S.; Lee, E.; Choi, W.I.; Sung, D. Reactive oxygen species (ROS)-responsive ferro-cene-polymer-based nanoparticles for controlled release of drugs. J. Mater. Chem. B 2020, 8, 1906–1913. [Google Scholar] [CrossRef]
- Stadtman, E.R.; Berlett, B.S. Reactive Oxygen-Mediated Protein Oxidation in Aging and Disease. Chem. Res. Toxicol. 1997, 10, 485–494. [Google Scholar] [CrossRef] [PubMed]
- Popovich, I.G.; Voitenkov, B.O.; Anisimov, V.N.; Ivanov, V.T.; Mikhaleva, I.I.; Zabezhinski, M.A.; Alimova, I.N.; Baturin, D.A.; Zavarzina, N.Y.; Rosenfeld, S.V.; et al. Effect of delta-sleep inducing peptide-containing prepara-tion Deltaran on biomarkers of aging, life span and spontaneous tumor incidence in female SHR mice. Mech. Ageing Dev. 2003, 124, 721–731. [Google Scholar] [CrossRef]
- Poon, H.F.; Calabrese, V.; Scapagnini, G.; Butterfield, D.A. Free radicals and brain aging. Clin. Geriatr. Med. 2004, 20, 329–359. [Google Scholar] [CrossRef]
- Yin, J.-J.; Fu, P.P.; Lutterodt, H.; Zhou, Y.-T.; Antholine, W.E.; Wamer, W. Dual Role of Selected Antioxidants Found in Dietary Supplements: Crossover between Anti-and Pro-Oxidant Activities in the Presence of Copper. J. Agric. Food Chem. 2012, 60, 2554–2561. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dwyer, B.E.; Raina, A.K.; Perry, G.; Smith, M.A. Homocysteine and Alzheimer’s disease: A modifiable risk? Free Radic. Biol. Med. 2004, 36, 1471–1475. [Google Scholar] [CrossRef] [PubMed]
- Barrow, M.; Taylor, A.; Murray, P.; Rosseinsky, M.J.; Adams, D.J. Design considerations for the synthesis of polymer coated iron oxide nanoparticles for stem cell labelling and tracking using MRI. Chem. Soc. Rev. 2015, 44, 6733–6748. [Google Scholar] [CrossRef] [Green Version]
- Figueroa, D.; Robinson, M. Hydrogen transport and embrittlement in 300M and AerMet100 ultra high strength steels. Corros. Sci. 2010, 52, 1593–1602. [Google Scholar] [CrossRef] [Green Version]
- Guerrero-Cázares, H.; Tzeng, S.Y.; Young, N.P.; Abutaleb, A.O.; Quiñones-Hinojosa, A.; Green, J.J. Green biodegradable polymeric nanoparticles show high efficacy and specificity at DNA delivery to human glioblastoma in vitro and in vivo. ACS Nano 2014, 8, 5141–5153. [Google Scholar] [CrossRef] [PubMed]
- Bruskov, V.I.; Malakhova, L.V.; Masalimov, Z.K.; Chernikov, A.V. Heat-induced formation of reactive oxygen species and 8-oxoguanine, a biomarker of damage to DNA. Nucleic Acids Res. 2002, 30, 6, 1354–1363. [Google Scholar] [CrossRef] [Green Version]
- Kneuer, C.; Sameti, M.; Bakowsky, U.; Schiestel, T.; Schirra, H.; Schmidt, H.; Lehr, C.-M. A Nonviral DNA Delivery System Based on Surface Modified Silica-Nanoparticles Can Efficiently Transfect Cells in Vitro. Bioconjugate Chem. 2000, 11, 926–932. [Google Scholar] [CrossRef] [Green Version]
- Zhang, T.; Lin, K.; Jiang, H.; Gao, Y.; Ming, C.; Ruan, B.; Ma, J.; Li, C.; Lou, F.; Yang, Y. Core-shell lipid polymer nanoparticles for combined chemo and gene therapy of childhood head and neck cancers. Oncol. Rep. 2017, 37, 1653–1661. [Google Scholar] [CrossRef]
- Cohen, H.; Levy, R.J.; Gao, J.; Fishbein, I.; Kousaev, V.; Sosnowski, S.; Slomkowski, S.; Golomb, G. Sustained delivery and expression of DNA encapsulated in polymeric nanoparticles. Gene Ther. 2000, 7, 1896–1905. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nehra, P.; Chauhan, R.P.; Garg, N.; Verma, K. Antibacterial and antifungal activity of chitosan coated iron oxide nanoparticles. Br. J. Biomed. Sci. 2017, 75, 13–18. [Google Scholar] [CrossRef]
- Thukkaram, M.; Sitaram, S.; Kannaiyan, S.K.; Subbiahdoss, G. Antibacterial efficacy of iron-oxide nanoparticles against bio-films on different biomaterial surfaces. Int. J. Biomater. 2014, 2014, 716080. [Google Scholar] [CrossRef] [Green Version]
- Hughes, S.P.F.; Anderson, F.M. Infection in the operating room. J. Bone Jt. Surg. 1991, 81-B, 754–755. [Google Scholar] [CrossRef]
- Davis, N.; Curry, A.; Gambhir, A.K.; Panigrahi, H.; Walker, C.R.C.; Wilkins, E.G.L.; Worsley, M.A.; Kay, P.R. Intraoperative bacterial contamination in operations for joint replacement. J. Bone Jt. Surg. 1999, 81-B, 886–889. [Google Scholar] [CrossRef]
- Leckband, D.; Sheth, S.; Halperin, A. Grafted poly(ethylene oxide) brushes as nonfouling surface coatings. J. Biomater. Sci. 1999, 10, 1125–1147. [Google Scholar] [CrossRef]
- Tyner, K.M.; Wokovich, A.M.; Doub, W.H.; Buhse, L.F.; Sung, L.-P.; Watson, S.S.; Sadrieh, N. Comparing methods for detecting and characterizing metal oxide nanoparticles in unmodified commercial sunscreens. Nanomedicine 2009, 4, 145–159. [Google Scholar] [CrossRef] [PubMed]
- Sathyanarayanan, M.B.; Balachandranath, R.; Srinivasulu, Y.G.; Kannaiyan, S.K.; Subbiahdoss, G. The Effect of Gold and Iron-Oxide Nanoparticles on Biofilm-Forming Pathogens. ISRN Microbiol. 2013, 2013, 1–5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, J.H.; Yang, S.H.; Lee, J.; Ko, E.H.; Hong, D.; Choi, I.S. Nanocoating of Single Cells: From Maintenance of Cell Viability to Manipulation of Cellular Activities. Adv. Mater. 2014, 26, 2001–2010. [Google Scholar] [CrossRef]
- Hoskins, C.; Wang, L.; Cheng, W.P.; Cuschieri, A. Dilemmas in the reliable estimation of the in-vitro cell viability in magnetic nanoparticle engineering: Which tests and what protocols? Nanoscale Res. Lett. 2012, 7, 77. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, S.; Oh, W.-K.; Jeong, Y.S.; Hong, J.-Y.; Cho, B.-R.; Hahn, J.-S.; Jang, J. Cytotoxicity of, and innate immune response to, size-controlled polypyrrole nanoparticles in mammalian cells. Biomaterials 2011, 32, 2342–2350. [Google Scholar] [CrossRef]
- Jian, P.; Fen, Z.; Lu, L.; Liang, T.; Li, Y.; Wei, C.; Hui, L.; Jing-bo, T.; Li-xiang, W. Preparation and characterization of PEG-PEI/Fe3O4 nano-magnetic fluid by co-precipitation method. Trans. Nonferr. Met. Soc. China 2008, 18, 393–398. [Google Scholar]
- Vila, A.; Gill, H.; McCallion, O.; Alonso, M.J. Transport of PLA-PEG particles across the nasal mucosa: Effect of particle size and PEG coating density. J. Control. Release 2004, 98, 231–244. [Google Scholar] [CrossRef]
H2O2 Concentration Added to the Sample, nM | Luminescence Intensity, cps |
---|---|
0 | 52 |
2 | 851 |
5 | 2076 |
10 | 4092 |
15 | 6121 |
20 | 81452 |
7-OH-KKK Concentration Added to the Sample, nM | Fluorescence Intensity, a.u. |
---|---|
0 | 0.1 |
5 | 2.2 |
10 | 4.2 |
20 | 8.3 |
30 | 12.1 |
40 | 16.2 |
Dose, Gy | 8-oxoGua per 105 Gua in DNA |
---|---|
0 | 0.01 |
1 | 0.78 |
2 | 1.56 |
5 | 3.90 |
10 | 7.80 |
Genes | GenBank Accsession | Oligonucleotides 5′-3′ (F+R) | Amplicon Size, bp |
---|---|---|---|
Actb | NM_007393.4 | CCTTCCTTCTTGGGTATGGAATCC CACCAGACAGCACTGTGTTGGCA | 115 |
CAT | NM_009804 | AGCGACCAGATGAAGCAGTG TCCGCTCTCTGTCAAAGTGTG | 181 |
SOD1 | NM_011434 | AACCAGTTGTGTTGTCAGGAC CCACCATGTTTCTTAGAGTGAGG | 139 |
NRF2 | NM_010902 | CTCGCTGGAAAAAGAAGTG CCGTCCAGGAGTTCAGAGG | 240 |
Extraction Time, Days | Concentration of Zn+ in Solution, μM |
---|---|
0 | >1 |
5 | >1 |
10 | >1 |
15 | 1 |
20 | 3 |
25 | 7 |
30 | 9 |
45 | 11 |
60 | 12 |
Parameter | Concentration of Nanoparticles, % | |||
---|---|---|---|---|
Control | 0.0001 | 0.001 | 0.01 | |
Viable cells, % | 97.08 ± 1.59 | 96.03 ± 1.97 | 95.86 ± 1.49 | 93.78 ± 1.77 |
Mitotic index, % | 1.22 ± 0.37 | 1.24 ± 0.35 | 1.02 ± 0.23 | 0.74 ± 0.26 |
Average cell area, μm2 | 135.33 ± 24.24 | 146.71 ± 24.74 | 124.78 ± 22.05 | 132.38 ± 26.95 |
Genes | Level of mRNA Relative to bAct = 1 | Change The Level of Gene Expression (Fold) Relative to 0 Gy (-) | |||||
---|---|---|---|---|---|---|---|
Control | Borosiloxane + Zn (%) | NiTi | |||||
0% | 0.001% | 0.01% | 0.1% | ||||
CAT | 3.7 × 10−3 | 1 | 0.98 | 1.08 | 1.89 | 3.39 | 2.31 |
SOD1 | 3.6 × 10−2 | 1 | 1.24 | 1.41 | 1.13 | 2.06 | 1.79 |
NRF2 | 2.2 × 10−3 | 1 | 0.75 | 1.26 | 2.04 | 2.15 | 1.96 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chausov, D.N.; Burmistrov, D.E.; Kurilov, A.D.; Bunkin, N.F.; Astashev, M.E.; Simakin, A.V.; Vedunova, M.V.; Gudkov, S.V. New Organosilicon Composite Based on Borosiloxane and Zinc Oxide Nanoparticles Inhibits Bacterial Growth, but Does Not Have a Toxic Effect on the Development of Animal Eukaryotic Cells. Materials 2021, 14, 6281. https://doi.org/10.3390/ma14216281
Chausov DN, Burmistrov DE, Kurilov AD, Bunkin NF, Astashev ME, Simakin AV, Vedunova MV, Gudkov SV. New Organosilicon Composite Based on Borosiloxane and Zinc Oxide Nanoparticles Inhibits Bacterial Growth, but Does Not Have a Toxic Effect on the Development of Animal Eukaryotic Cells. Materials. 2021; 14(21):6281. https://doi.org/10.3390/ma14216281
Chicago/Turabian StyleChausov, Denis N., Dmitriy E. Burmistrov, Alexander D. Kurilov, Nikolai F. Bunkin, Maxim E. Astashev, Alexander V. Simakin, Maria V. Vedunova, and Sergey V. Gudkov. 2021. "New Organosilicon Composite Based on Borosiloxane and Zinc Oxide Nanoparticles Inhibits Bacterial Growth, but Does Not Have a Toxic Effect on the Development of Animal Eukaryotic Cells" Materials 14, no. 21: 6281. https://doi.org/10.3390/ma14216281
APA StyleChausov, D. N., Burmistrov, D. E., Kurilov, A. D., Bunkin, N. F., Astashev, M. E., Simakin, A. V., Vedunova, M. V., & Gudkov, S. V. (2021). New Organosilicon Composite Based on Borosiloxane and Zinc Oxide Nanoparticles Inhibits Bacterial Growth, but Does Not Have a Toxic Effect on the Development of Animal Eukaryotic Cells. Materials, 14(21), 6281. https://doi.org/10.3390/ma14216281