1. Introduction
Genome editing using the clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein 9 (Cas9) is a widely used tool for genetic modification in many organisms [
1,
2,
3]. Gene knockouts and knock-ins using the CRISPR/Cas9 system in cultured cells enable functional studies of genes and proteins, providing valuable insights into gene function [
4]. To edit a gene of interest, Cas9 is introduced into cells through an expression plasmid, mRNA, or protein [
4]. Various transfection methods have been employed to introduce Cas9 or other genetic material into cells, including electroporation, which is one of the most efficient methods for delivering nucleic acids and proteins [
5,
6]. Electrical stimulation generated by electroporation leads to an increase in cell membrane permeability and the introduction of transfectants into cells [
7]. However, electrical stimulation can induce cell injury or toxicity via cell membrane damage, potentially affecting gene expression. Therefore, optimization of electroporation conditions is critical for balancing transfection efficiency and cell viability [
7,
8,
9]. For genome editing, the conditions for electroporation must be evaluated before determining the editing efficiency of the target gene.
Platelet-derived growth factor receptor alpha (
PDGFRA) is a crucial driver gene in glioblastoma (GBM) [
10]. Researchers in precision medicine continually detect new variants of uncertain significance (VUS) in
PDGFRA and other potentially pathogenic genes using next-generation sequencing (NGS) [
10,
11]. One approach for analyzing VUS involves functional analysis of a cancer cell line harboring variants generated by genome editing, which has proven useful in the study of
PDGFRA [
12,
13]. In our previous genome editing studies using electroporation, we observed that the electroporation process unexpectedly decreased the expression of
PDGFRA mRNA in GBM cell lines [
12]. We speculated that the decrease was due to physical cell membrane damage by electroporation; however, the reason was not clear. Accordingly, we attempted to evaluate the relationship between the decrease in
PDGFRA mRNA expression and electroporation in this study. This adverse effect can lead to overestimation or underestimation of knockout gene functions or even erroneously indicate the success of gene knockout. Therefore, it is essential to understand how electroporation influences gene expression, particularly that of key genes such as
PDGFRA, and to explore alternative transfection methods that might minimize such adverse outcomes.
In this study, we investigated the background effects of electroporation, lipofection, and recombinant adeno-associated virus (rAAV) transfection methods on the expression of PDGFRA and receptor tyrosine kinase (RTK) genes in human GBM cell lines U-251 MG and U-87 MG and human chronic myelogenous leukemia HAP1 cells to determine the optimal experimental conditions for genome editing. Additionally, we assessed the effects of electroporation and rAAV transfection on gene expression using comprehensive mRNA expression through RNA sequencing (RNA-seq) analysis. The expression of inflammatory cytokines was also evaluated to monitor inflammatory or immune responses after rAAV transfection. To the best of our knowledge, few reports have demonstrated the occurrence of unfavorable alterations in gene expression after electroporation. Here, we report adverse effects of electroporation on gene expression and the necessity of a sufficient culture period after electroporation for cell damage recovery or an alternative rAAV transfection method to lessen the adverse effects.
3. Discussion
The present study showed that electroporation itself carries the risk of unintended alterations in gene expression; therefore, it is critical to determine the optimal conditions for Cas9 transfer to ensure successful gene editing. Cas9-based genome editing technologies are increasingly being used in various fields, including basic research, with electroporation being commonly employed for Cas9 expression plasmids and protein transfection. Electroporation has also been widely utilized in other areas of molecular biology research [
6,
7], highlighting the necessity of elucidating its effects on gene expression and determining the optimal electroporation conditions.
In this study, we investigated the effects of electroporation on
PDGFRA mRNA and protein expression in cultured human GBM and HAP1 cells. We found that
PDGFRA mRNA and protein expression levels decreased unexpectedly after electroporation without the transfection of the Cas9 RNP complex. This effect likely stems from cell membrane damage induced by electroporation [
7,
8,
9], as alterations in the membrane structure may influence the expression of genes such as
PDGFRA. Gene expression is known to change when cell membranes are altered by the delivery of nanoparticles [
22], and similar structural or functional changes may occur after electroporation. RNA-seq analysis further revealed that the mRNA expression levels of other
RTKs also varied after electroporation, suggesting that electroporation-induced changes in mRNA expression are not uniform and can unpredictably affect gene expression. This underscores the importance of verifying the effects of electroporation on target genes before proceeding with genome editing, as such as alterations may undermine the intended gene knockout effects or lead to misinterpretation of successful gene editing. On the other hand,
PDGFRA mRNA expression levels in HAP1 cells did not change after electroporation. Although this might be characteristic of HAP1 cells (e.g., ploidy of the cell and resistance for the electroporation), the reason for no change in
PDGFRA mRNA expression in HAP1 cells is not clear in this study.
We also observed that while PDGFRα expression was restored 13 days after electroporation in U-87 MG cells, a longer recovery period (approximately one additional week) was required for PDGFRα expression to return to baseline in U-251 MG cells. This difference in recovery time could be related to recovery from cell damage. To explore this further, we conducted a cell proliferation assay in U-251 MG cells and found that the growth rate of these cells was similar to that of control cells, except at 2 days post-electroporation. These results suggest that electroporation-induced cell injury likely involves complex biochemical mechanisms [
8] that reduce PDGFRα expression, independent of cell proliferation. Therefore, cell recovery should not be solely assessed via proliferation assays after electroporation but should instead be evaluated in conjunction with protein expression analyses to obtain a more accurate assessment of recovery. In general, the necessity for a sufficient recovery period after electroporation might not be critical, because most gene editing studies require several weeks for cell culture, damage recovery, and cloning. In contrast, this is particularly important in saturation genome editing studies, which often analyze gene-edited pools of cells without cloning. To minimize the risk of erroneous conclusions, we performed control experiments using cells treated solely with electroporation. This allowed us to compare mRNA and protein expression levels at each experimental time point between the treated and control cells. However, it is important to note that there is limited documentation of this fundamental principle in electroporation-based experiments, and this gap in the literature should be addressed in future studies.
In U-251 MG cells, the effects on
PDGFRA and
RTK mRNA expression after lipofection were similar to those observed after electroporation. However, rAAV transfection did not affect
PDGFRA and
RTK mRNA expression and had less of an impact on the RNA-seq profile. Additionally, rAAV transfection only slightly affected the expression of inflammation- or immune-related genes, in contrast with the known inflammatory and immune responses induced by biological transfection using other recombinant viral vectors [
21]. These findings are in line with a previous report suggesting that immune system activation is absent in
in vitro but moderate in
in vivo studies using rAAV vectors compared to the more pronounced immune responses observed in both
in vitro and
in vivo studies with recombinant adenovirus vectors [
23]. Overall, rAAV-mediated transfection was less disruptive to baseline gene expression and caused fewer inflammatory and immune responses. This may be due to the less harmful biological gene delivery mechanism of viral vector transfer [
24], which differs from the more disruptive physical and chemical methods of electroporation and lipofection [
20]. Based on these findings, we concluded that rAAV transfection is the most suitable method for genome editing among the conditions tested.
A potential limitation of the present study is that it primarily focused on
PDGFRA expression in GBM and HAP1 cells. Although the results indicated that similar unexpected effects of electroporation may occur in other genes and cells of interest, the scope of this study was limited to these specific contexts. Moreover, in other cell types, the optimal conditions for successful genome editing remain uncertain and controversial [
13], suggesting that the appropriate selection of transfection methods and cells is essential for successful genome editing. Furthermore, although we identified some discrepancies between mRNA and protein expression in U-251 MG cells, these were not observed in U-87 MG or HAP1 cells after electroporation. Such discrepancies between mRNA and protein expression can occur due to the post-translational regulation of protein expression [
25,
26], but the mechanisms underlying these differences were not fully elucidated in this study. Future studies should explore these mechanisms further. In general, HAP1 or U-87 MG cells appear to be better suited for studies utilizing electroporation-mediated gene transfer, whereas rAAV transfection may be more appropriate for experiments that require minimal disruption of cellular function.
In conclusion, the effects of electroporation on gene expression are not uniform and vary depending on cell type and target gene. Therefore, we recommend that the choice of transfection method and the potential alterations in target gene expression be thoroughly confirmed before initiating genome editing studies using Cas9-based technologies. This approach will help avoid erroneous evaluations of gene knockout success or unintended effects on gene expression, ensuring the reliability of the experimental outcomes. Nevertheless, further research is needed to refine transfection protocols and understand the broader implications of electroporation and other gene delivery methods for genome editing.
4. Materials and Methods
4.1. Cell Culture
U-251 MG cells were obtained from the JCRB Cell Bank (Osaka, Japan) and U-87 MG cells were purchased from the American Type Culture Collection (Manassas, VA, USA). HAP1 cells were purchased from Horizon Discovery Ltd. (Cambridge, UK). HEK293T cells were purchased from Takara Bio Inc. (Shiga, Japan). U-251 and U-87 MG cells were maintained in Eagle’s minimum essential medium (FUJIFILM Wako Pure Chemical, Osaka, Japan), HAP1 cells were maintained in Iscove’s Modified Dulbecco’s medium (FUJIFILM Wako), and HEK293T cells were maintained in Dulbecco’s Modified Eagle Medium (FUJIFILM Wako) at 37 °C with 95% air and 5% CO2. The culture medium was supplemented with 2 mM glutamine, 100 U/mL penicillin, 100 μg/mL streptomycin, and 10% fetal bovine serum (Sigma-Aldrich, St Louis, MO, USA).
4.2. Fluorescence In Situ Hybridization
Sections (4 μm thick) were cut from formalin-fixed, paraffin-embedded cell blocks for fluorescence in situ hybridization analysis. The sections were immersed in 0.2 N HCl for 20 min, then in distilled water for 3 min, and finally in 2× saline–sodium citrate buffer (SSC). Slides were microwaved in a pressure jar and digested with protease I (Abbott Laboratories, Des Plaines, IL, USA) for 45 min. The slides were washed twice with 2× SSC, air-dried, fixed with phosphate-buffered neutral 10% formalin for 10 min, and dehydrated in ethanol. Artificial bacterial chromosome clones RP11-231C18 (red) and CEP4 (green) probes (Empire Genomics, Buffalo, NY, USA) were used to analyze the PDGFRA ploidy. The sections were then transferred to ThermoBrite (Abbott), which was programmed to perform denaturation at 85 °C for 1 min, followed by hybridization at 37 °C for 16 h. The slides were then air-dried in the dark and counterstained with 4,6-diamidino-phenyl-indole. Images were captured using a fluorescence microscope (BX51; Olympus, Tokyo, Japan), and the red and green fluorescence signals in each section were counted in 30 cells.
4.3. Electroporation
Cells were trypsinized and suspended in Opti-MEM I reduced-serum medium (Thermo Fisher Scientific, Waltham, MA, USA) at a concentration of 1–2 × 10
7 cells/mL. The Cas9 RNP complexes were added to 80 μL of the cell suspension, and the mixture was transferred to 2-mm cuvettes (Nepa Gene, Chiba, Japan). For RNP complex electroporation, an electroporation enhancer (1.2 μM, Integrated DNA Technologies (IDT), Coralville, IA, USA) was added to the cell suspension. Electroporation was conducted using a NEPA21 electroporator (Nepa Gene) with 2× poring pulses (GBM cells: voltage 150 V; length 7.5 ms; interval 50 ms; polarity +, HAP1 cells: voltage 275 V; length 0.5 ms; interval 50 ms; polarity +) and 5× transfer pulses (voltage: 20 V; length: 50 ms; interval: 50 ms; polarity ±). Electroporated cells were seeded in 6-well plates (Thermo Fisher Scientific). Cas9 RNP complex formation was performed using the following procedure: equimolar amounts of CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA, IDT) were hybridized for 5 min at 95 °C to form a single-guide RNA. Subsequently, the single-guide RNA (1.2 μM) and Cas9 nuclease (1 μM; IDT) were mixed with Opti-MEM to form ribonucleoprotein complexes, which were then incubated for 30 min at room temperature. The crRNA sequence has been described previously [
12,
13].
4.4. Quantitative Reverse Transcription–Polymerase Chain Reaction
Cells were harvested on the indicated days, and their total RNA was extracted using an RNeasy kit (QIAGEN, Hilden, Germany) and converted into complementary DNA using ReverTra Ace qPCR RT Master Mix (TOYOBO, Osaka, Japan). The complementary DNA (5–10 ng/reaction) was mixed with 2× master mix (THUNDERBIRD Probe qPCR Mix, TOYOBO), probe (4 pmol), and a primer pair (6 pmol each) according to the manufacturer’s instructions and amplified using LightCycler 480 (Roche Diagnostics, Basel, Switzerland) under the following cycling conditions: 1 cycle at 95 °C for 60 s, then 40 cycles at 95 °C for 15 s and 60 °C for 60 s. The premixed probe and primer pair (PrimeTime qPCR Probe Assays, IDT) were used as follows: PDGFRA: Hs.PT.58.45699973; ERBB2: Hs.PT.58.1330269; KDR: Hs.PT.58.3285240; MET: Hs.PT.58.339430; IL1B: Hs.PT.58.1518186; IL6: Hs.PT.58.40226675; CXCL8: Hs.PT.58.39926886.g; CCL2: Hs.PT.58.45467977. Each sample was analyzed in triplicate in separate wells for each target. The average of the three threshold cycle values was calculated for the target and reference genes and analyzed using the comparative Ct method. The Ct values were normalized to a reference gene (18S rRNA, probe and primer pair: Hs.PT.58.14390640).
4.5. Western Blotting
Cells were washed with phosphate-buffered saline (PBS) and precipitated with 10% trichloroacetic acid on ice for 30 min. The precipitate was washed with cold PBS and dissolved in cold lysis buffer (7 M urea, 2 M thiourea, 3% CHAPS, and 1% Triton X-100). The lysates were fractionated using sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes. The membranes were blocked with 5% nonfat dry milk in Tris-buffered saline containing 0.1% Tween 20 and incubated overnight at 4 °C with the relevant primary antibodies diluted in Can Get Signal Solution 1 (TOYOBO). Subsequently, the membranes were incubated for 1 h at room temperature with HRP-conjugated anti-rabbit IgG antibody (#7074; Cell Signaling Technology, Danvers, MA, USA) or HRP-conjugated anti-mouse IgG antibody (#7076; Cell Signaling Technology), and proteins were detected using Clarity Max Western ECL Substrate (Bio-Rad Laboratories, Hercules, CA, USA) or SuperSignal West Pico chemiluminescent substrate (Thermo Fisher Scientific). The proteins were detected using a chemiluminescence imaging system (Ez-Capture MG, ATTO, Tokyo, Japan). The following primary antibodies were used: rabbit anti-PDGFRα monoclonal (#3174; Cell Signaling Technology), rabbit anti-erbB-2 monoclonal (#2165; Cell Signaling Technology), rabbit anti-VEGF receptor 2 monoclonal (#9698; Cell Signaling Technology), rabbit anti-MET monoclonal (#8198; Cell Signaling Technology), and mouse anti-β-actin (sc-47778; Santa Cruz Biotechnology, Dallas, TX, USA).
4.6. Cell Proliferation Assay
Cells were seeded at 2.5 × 103 cells/well in 96-well plates (Thermo Fisher Scientific, Waltham, MA, USA) with medium supplemented with 10% FBS and allowed to attach overnight. The Cell Counting Kit-8 (WST-8; Dojindo, Kumamoto, Japan) was used to count viable cells according to the manufacturer’s instructions on the indicated days. Cell viability was determined by measuring the amount of formazan dye generated at 450 nm against a reference wavelength at 620 nm using a microplate reader (Thermo Fisher Scientific).
4.7. RNA Sequencing
Cells were harvested 2 days after electroporation or rAAV infection, and their total RNA was extracted as described above. Pair-end RNA-seq was performed using NovaSeq 6000 (Illumina, San Diego, CA, USA) on Rhelixa (Tokyo, Japan). RNA-seq analysis was performed as follows: raw sequence reads were trimmed and filtered using PrinSeq-lite (version 0.20.4) [
27]. The trimmed reads were aligned using HISAT2 (version 2.2.1) [
28]. FeatureCounts (version 2.0.6) [
29] was used to quantify the expression of each gene. The iDEP application [
17] was used to analyze and visualize changes in gene expression.
4.8. Lipofection
A mixture of Cas9 RNP complex (1 μM) and 1.2 μL of Lipofectamine RNAiMAX reagent (Thermo Fisher Scientific) was transferred to the wells of 96-well plates (Thermo Fisher Scientific), then 100 μL of cell suspensions at 1 × 105 cells/mL were added to the wells containing the transfection complex. After the 2-day culture, the cells were harvested, and their genomic DNA was extracted using a Wizard SV Genomic DNA Purification System (Promega, Madison, WI, USA). The total RNA was extracted as described above.
4.9. Viral Production, Purification, Titering, and Infection
CRISPR/SaCas9 virus was prepared using a triple-transfection, helper-free method with serotype 2 packaging. The AAV vector (pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA; U6::BsaI-sgRNA, #61591, Addgene, Watertown, MA, USA) and pRC and pHelper vectors (CRISPR/SaCas9 Helper Free System (AAV2), Takara Bio) were transfected into HEK293T cells using the XFect Transfection Reagent (Takara Bio) according to the manufacturer’s instructions for rAAV production. The cells were cultured with medium containing 2% FBS and harvested 3 days post-transfection. The rAAV was purified using an AAV purification kit (Takara Bio). The purified rAAV was titered using the quantitative PCR-based method reported by Ahammer [
30]. The sequence of the single-guided RNA was “acggagatccactcccgagac”, and oligonucleotides for the single-guided RNA were annealed and cloned into the AAV vector, as reported by Ran [
19]. The mNeonGreen fluorescent protein-expressing rAAV was produced from pAAV-CAG-mNeonGreen (#99134, Addgene). The cells were seeded at a density of 2 × 10
4 cells/well in 48-well plates (Greiner, Kremsmünster, Austria) and infected with rAAV at the indicated multiplicity of infection on the following day. After two days of culturing, the cells were harvested, and their genomic DNA and total RNA were extracted as described above.
4.10. High-Throughput Sequencing
The genomic DNA was sequenced using a MiSeq sequencer (Illumina). The genomic region of interest was amplified using primers containing Illumina forward and reverse adapters (forward primer: 5′- TCTTTCCCTACACGACGCTCTTCCGATCTGCAAACCTTAGAGGTTCTGGCAAGGAG, reverse primer: 5′-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTACCTTATATTCCCAGGGCCGGTTAATG) via PCR. PCR was performed with genomic DNA (50–150 ng) using the KOD One PCR Master Mix (TOYOBO) and conducted as follows: 30 cycles at 98 °C for 10 s, 67 °C for 5 s, and 68 °C for 10 s. Unique Illumina barcoding primer pairs were added to each sample during the second PCR step. The second PCR step was conducted with 1 μL of the unpurified first PCR reaction mixture using the KOD One PCR Master Mix as follows: 10 cycles of 98 °C for 10 s and 68 °C for 10 s. The PCR products were monitored using a Microchip Electrophoresis System (MultiNA, Shimadzu Corporation, Kyoto, Japan). DNA libraries were prepared using mixtures of equal molar amounts of PCR products and purified using solid-phase paramagnetic beads (AMPure XP; Beckman Coulter, Brea, CA, USA). DNA concentration was measured using fluorometric quantification (Qubit; Thermo Fisher Scientific). The alignment of amplicon sequences to a reference sequence and quantification of editing efficiency were performed using CRISPResso2 software (version 2.3.2) [
31].
4.11. Statistical Analysis
Data were plotted and analyzed using R (version 4.1.0) and ggplot2 (version 3.3.3). Three or more replicates were performed for all experiments, and all data are presented as means ± standard error. Statistical significance was determined using a one-way analysis of variance (ANOVA) with Tukey’s post hoc test, and the results were considered statistically significant at p < 0.05.