Validation of Selected MicroRNA Transcriptome Data in the Bovine Corpus Luteum during Early Pregnancy by RT-qPCR
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Total RNA Isolation and RNA Integrity Assessment
2.3. Conversion of Total RNA to cDNA and RT-qPCR
2.4. In Silico Analysis
2.5. RNA-Seq Data Re-Analysis and Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tomac, J.; Cekinovic, Đ.; Aparovic, J. Biology of the corpus luteum. Period. Biol. 2011, 113, 43–49. Available online: https://hrcak.srce.hr/67235 (accessed on 23 June 2024).
- Hansen, T.R.; Bott, R.; Romero, J.; Antoniazzi, A.; Davis, J.S. Corpus Luteum and Early Pregnancy in Ruminants. In The Life Cycle of the Corpus Luteum, 1st ed.; Meidan, R., Ed.; Springer: Cham, Switzerland, 2017; pp. 205–225. [Google Scholar]
- Stocco, C.; Telleria, C.; Gibori, G. The Molecular Control of Corpus Luteum Formation, Function, and Regression. Endocr. Rev. 2007, 28, 117–149. [Google Scholar] [CrossRef] [PubMed]
- Bazer, F.W.; Song, G.; Thatcher, W.W. Roles of Conceptus Secretory Proteins in Establishment and Maintenance of Pregnancy in Ruminants. Asian-Australas. J. Anim. Sci. 2012, 25, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Wiltbank, M.C.; Meidan, R.; Ochoa, J.; Baez, G.M.; Giordano, J.O.; Ferreira, J.C.P.; Sartori, R. Maintenance or regression of the corpus luteum during multiple decisive periods of bovine pregnancy. Anim. Reprod. 2016, 13, 217–233. [Google Scholar] [CrossRef]
- Shrestha, K.; Rodler, D.; Sinowatz, F.; Meidan, R. Corpus Luteum Formation. In The Ovary, 3rd ed.; Leung, P.C.K., Adashi, E.Y., Eds.; Academic Press: Cambridge, MA, USA, 2019; pp. 255–267. [Google Scholar]
- McCracken, J.A.; Custer, E.E.; Lamsa, J.C. Luteolysis: A neuroendocrine-mediated event. Physiol. Rev. 1999, 79, 263–323. [Google Scholar] [CrossRef] [PubMed]
- Donadeu, F.X.; Schauer, S.N.; Sontakke, S.D. Involvement of miRNAs in ovarian follicular and luteal development. J. Endocrinol. 2012, 215, 323–334. [Google Scholar] [CrossRef] [PubMed]
- Iwakawa, H.O.; Tomari, Y. The Functions of MicroRNAs: mRNA Decay and Translational Repression. Trends Cell Biol. 2015, 25, 651–665. [Google Scholar] [CrossRef]
- O’Brien, J.; Hayder, H.; Zayed, Y.; Peng, C. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front. Endocrinol. 2018, 9, 402. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Gebert, L.F.R.; MacRae, I.J. Regulation of microRNA function in animals. Nat. Rev. Mol. Cell Biol. 2019, 20, 21–37. [Google Scholar] [CrossRef]
- Chendrimada, T.P.; Gregory, R.I.; Kumaraswamy, E.; Norman, J.; Cooch, N.; Nishikura, K.; Shiekhattar, R. TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing. Nature 2000, 436, 740–744. [Google Scholar] [CrossRef]
- Capra, E.; Lange-Consiglio, A. The Biological Function of Extracellular Vesicles during Fertilization, Early Embryo—Maternal Crosstalk and Their Involvement in Reproduction: Review and Overview. Biomolecules 2020, 10, 1510. [Google Scholar] [CrossRef] [PubMed]
- Tzelos, T.; Howes, N.L.; Esteves, C.L.; Howes, M.P.; Byrne, T.J.; Macrae, A.I.; Donadeu, F.X. Farmer and Veterinary Practices and Opinions Related to Fertility Testing and Pregnancy Diagnosis of UK Dairy Cows. Front. Vet. Sci. 2020, 7, 564209. [Google Scholar] [CrossRef] [PubMed]
- Ioannidis, J.; Donadeu, F. Circulating miRNA signatures of early pregnancy in cattle. BMC Genom. 2016, 17, 184. [Google Scholar] [CrossRef]
- Cook, J.; Bennett, P.R.; Kim, S.H.; Teoh, T.G.; Sykes, L.; Kindinger, L.M.; Garrett, A.; Binkhamis, R.; MacIntyre, D.A.; Terzidou, V. First Trimester Circulating MicroRNA Biomarkers Predictive of Subsequent Preterm Delivery and Cervical Shortening. Sci. Rep. 2019, 9, 5861. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Gu, Z.; Jiang, H. MicroRNAs in farm animals. Animal 2013, 7, 1567–1575. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Zhang, Z.; Zhou, X.; Wang, Z.; Wang, G.; Han, Z. Effects of microRNA-143 in the differentiation and proliferation of bovine intramuscular preadipocytes. Mol. Biol. Rep. 2011, 38, 4273–4280. [Google Scholar] [CrossRef] [PubMed]
- Tripurani, S.K.; Lee, K.B.; Wee, G.; Smith, G.W.; Yao, J. MicroRNA-196a regulates bovine newborn ovary homeobox gene (NOBOX) expression during early embryogenesis. BMC Dev. Biol. 2011, 11, 25. [Google Scholar] [CrossRef] [PubMed]
- Farberov, S.; Meidan, R. Fibroblast growth factor-2 and transforming growth factor-beta1 oppositely regulate miR-221 that targets thrombospondin-1 in bovine luteal endothelial cells. Biol. Reprod. 2018, 98, 366–375. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Hu, Q.C.; Wang, J.P.; Ren, Q.Q.; Wang, X.P.; Luoreng, Z.M.; Wei, D.W.; Ma, Y. RNA-Seq Reveals the Role of miR-29c in Regulating Inflammation and Oxidative Stress of Bovine Mammary Epithelial Cells. Front. Vet. Sci. 2022, 9, 865415. [Google Scholar] [CrossRef]
- Sengar, G.S.; Deb, R.; Singh, U.; Raja, T.V.; Kant, R.; Sajjanar, B.; Alex, R.; Alyethodi, R.R.; Kumar, A.; Kumar, S.; et al. Differential expression of microRNAs associated with thermal stress in Frieswal (Bos taurus x Bos indicus) crossbred dairy cattle. Cell Stress Chaperones 2018, 23, 155–170. [Google Scholar] [CrossRef]
- Hossain, M.M.; Ghanem, N.; Hoelker, M.; Rings, F.; Phatsara, C.; Tholen, E.; Schellander, K.; Tesfaye, D. Identification and characterization of miRNAs expressed in the bovine ovary. BMC Genom. 2009, 10, 443. [Google Scholar] [CrossRef] [PubMed]
- Maalouf, S.W.; Liu, W.S.; Albert, I.; Pate, J.L. Regulating life or death: Potential role of microRNA in rescue of the corpus luteum. Mol. Cell. Endocrinol. 2014, 398, 78–88. [Google Scholar] [CrossRef] [PubMed]
- Gecaj, R.M.; Schanzenbach, C.I.; Kirchner, B.; Pfaffl, M.W.; Riedmaier, I.; Tweedie-Cullen, R.Y.; Berisha, B. The Dynamic of microRNA Transcriptome in Bovine Corpus Luteum during Its Formation, Function, and Regression. Front. Genet. 2017, 15, 213. [Google Scholar] [CrossRef] [PubMed]
- Jerome, A.; Thirumaran, S.M.K.; Kala, S.N. Identification of microRNAs in corpus luteum of pregnancy in buffalo (Bubalus bubalis) by deep sequencing. Iran. J. Vet. Res. 2017, 18, 287–290. [Google Scholar] [PubMed]
- Huggett, J.F.; O’Grady, J.; Bustin, S. qPCR, dPCR, NGS—A journey. Biomol. Detect. Quantif. 2015, 15, A1–A5. [Google Scholar] [CrossRef] [PubMed]
- Schanzenbach, C.I.; Kirchner, B.; Ulbrich, S.E.; Pfaffl, M.W. MicroRNA of whole milk samples are not suitable for pregnancy detection in cattle. Gene 2019, 692, 17–21. [Google Scholar] [CrossRef] [PubMed]
- Ireland, J.J.; Murphee, R.L.; Coulson, P.B. Accuracy of predicting stages of bovine estrous cycle by gross appearance of the corpus luteum. J. Dairy Sci. 1980, 63, 155–160. [Google Scholar] [CrossRef] [PubMed]
- Evans, H.E.; Sack, W.O. Prenatal development of domestic and laboratory mammals: Growth curves, external features and selected references. Anat. Histol. Embryol. 1973, 2, 11–45. [Google Scholar] [CrossRef]
- Houseley, J.; Tollervey, D. The many pathways of RNA degradation. Cell 2009, 20, 763–776. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Tastsoglou, S.; Alexiou, A.; Karagkouni, D.; Skoufos, G.; Zacharopoulou, E.; Hatzigeorgiou, A.G. DIANA-microT 2023: Including predicted targets of virally encoded miRNAs. Nucleic Acids Res. 2023, 51, 148–153. [Google Scholar] [CrossRef]
- Mi, H.; Muruganujan, A.; Huang, X.; Erbert, D.; Mills, C.; Guo, X.; Thomas, P.D. Protocol Update for large-scale genome and gene function analysis with the PANTHER classification system (v.14.0). Nat. Protoc. 2019, 14, 703–721. [Google Scholar] [CrossRef] [PubMed]
- Kehl, T.; Kern, F.; Backes, C.; Fehlmann, T.; Stöckel, D.; Meese, E.; Lenhof, H.P.; Keller, K. miRPathDB 2.0: A novel release of the miRNA Pathway Dictionary Database. Nucleic Acids Res. 2018, 48, 142–147. [Google Scholar] [CrossRef] [PubMed]
- Gecaj, R.; Schanzenbach, C.; Pfaffl, M.W.; Berisha, B. microRNA profiling in the bovine corpus luteum during the early pregnancy. Reprod. Domest. Anim. 2017, 52, 72. [Google Scholar] [CrossRef]
- Gecaj, R.M. Ekspresionimi i microARN-ve gjatë Fazave të Ndryshme të Zhvillimit dhe Funksionalizimit Trupit të Verdhë (Corpus Luteum) te Gjedhi. Ph.D. Thesis, University of Prishtina, Prishtina, Kosovo, 1 November 2018. [Google Scholar]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Perdikopanis, N.; Georgakilas, G.K.; Grigoriadis, D.; Pierros, V.; Kavakiotis, I.; Alexiou, P.; Hatzigeorgiou, A. DIANA-miRGen v4: Indexing promoters and regulators for more than 1500 microRNAs. Nucleic Acids Res. 2021, 49, 151–159. [Google Scholar] [CrossRef] [PubMed]
- Kaczmarek, M.M.; Najmula, J.; Guzewska, M.M.; Przygrodzka, E. MiRNAs in the Peri-Implantation Period: Contribution to Embryo-Maternal Communication in Pigs. Int. J. Mol. Sci. 2020, 21, 2229. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, H.; Ohkuchi, A.; Kuwata, T.; Usui, R.; Baba, Y.; Suzuki, H.; Chaw Kyi, T.T.; Matsubara, S.; Saito, S.; Takizawa, T. Endogenous and exogenous miR-520c-3p modulates CD44-mediated extravillous trophoblast invasion. Placenta 2017, 50, 25–31. [Google Scholar] [CrossRef]
- Mohammed, B.T.; Sontakke, S.D.; Ioannidis, J.; Duncan, W.C.; Donadeu, F.X. The Adequate Corpus Luteum: miR-96 Promotes Luteal Cell Survival and Progesterone Production. J. Clin. Endocrinol. Metab. 2017, 102, 2188–2198. [Google Scholar] [CrossRef]
- Mayor-Lynn, K.; Toloubeydokhti, T.; Cruz, A.C.; Chegini, N. Expression profile of microRNAs and mRNAs in human placentas from pregnancies complicated by preeclampsia and preterm labor. Reprod. Sci. 2011, 18, 46–56. [Google Scholar] [CrossRef]
- Coenye, T. Do results obtained with RNA-sequencing require independent verification? Biofilm 2021, 13, 100043. [Google Scholar] [CrossRef] [PubMed]
- Tsvetkov, D.; Kolpakov, E.; Kassmann, M.; Schubert, R.; Gollasch, M. Distinguishing between Biological and Technical Replicates in Hypertension Research on Isolated Arteries. Front. Med. 2019, 6, 126. [Google Scholar] [CrossRef]
- Blainey, P.; Krzywinski, M.; Altman, N. Points of significance: Replication. Nat. Methods 2014, 11, 879–880. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; He, M. Differential gene expression identified by RNA-Seq and qPCR in two sizes of pearl oyster (Pinctada fucata). Gene 2014, 538, 313–322. [Google Scholar] [CrossRef]
- Hughes, T.R. ’Validation’ in genome-scale research. J. Biol. 2009, 8, 3. [Google Scholar] [CrossRef] [PubMed]
- Ioannidis, J.; Donadeu, F.X. Changes in circulating microRNA levels can be identified as early as day 8 of pregnancy in cattle. PLoS ONE 2017, 12, e0174892. [Google Scholar] [CrossRef]
- Medeiros, S.F.; Barbosa, B.B.; Medeiros, M.A.S.; Yamamoto, M.M.W. Morphology and Biochemistry of Ovulation. Rev. Bras. Ginecol. Obstet. 2021, 43, 480–486. [Google Scholar] [CrossRef]
- González-Blanco, L.; Royo, L.J.; Diñeiro, Y.; García-Torres, S.; Coto-Montes, A.; Sierra, V.; Oliván, M. Exploring the miRNAs Profile in Dark-Cutting Beef. Foods 2024, 13, 960. [Google Scholar] [CrossRef]
- Maston, G.A.; Evans, S.K.; Green, M.R. Transcriptional regulatory elements in the human genome. Annu. Rev. Genom. Hum. Genet. 2006, 7, 29–59. [Google Scholar] [CrossRef]
- Yuan, X.; Mu, N.; Wang, N.; Straat, K.; Sofiadis, A.; Guo, Y.; Stenman, A.; Li, K.; Cheng, G.; Zhang, L.; et al. GABPA inhibits invasion/metastasis in papillary thyroid carcinoma by regulating DICER1 expression. Oncogene 2019, 38, 965–979. [Google Scholar] [CrossRef]
- Thurlings, I.; de Bruin, A. E2F Transcription Factors Control the Roller Coaster Ride of Cell Cycle Gene Expression. Methods Mol. Biol. 2016, 1342, 71–88. [Google Scholar]
- Wang, D.; Sang, Y.; Sun, T.; Kong, P.; Zhang, L.; Dai, Y.; Cao, Y.; Tao, Z.; Liu, W. Emerging roles and mechanisms of microRNA-222-3p in human cancer. Int. J. Ocol. 2021, 58, 20. [Google Scholar] [CrossRef]
- Wang, H.; Deng, Z.; Chen, X.; Cai, J.; Ma, T.; Zhong, Q.; Li, R.; Li, L.; Li, T. Downregulation of miR-222-3p reverses doxorubicin-resistance in LoVo cells through upregulating forkhead box protein P2 (FOXP2) protein. Med. Sci. Monit. 2019, 25, 2169–2178. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Liu, Q.; Li, Z.; Guo, H.; Bai, C.; Wang, F. miR-222-3p promotes osteosarcoma cell migration and invasion through targeting TIMP3. Onco Targets Ther. 2018, 11, 8643–8653. [Google Scholar] [CrossRef]
- Wessels, J.M.; Edwards, A.K.; Khalaj, K.; Kridli, R.T.; Bidarimath, M.; Tayade, C. The MicroRNAome of Pregnancy: Deciphering miRNA Networks at the Maternal-Fetal Interface. PLoS ONE 2013, 8, e72264. [Google Scholar] [CrossRef]
- Pan, H.; Cui, H.; Liu, S.; Qian, Y.; Wu, H.; Li, L.; Guan, Y.; Guan, X.; Zhang, L.; Fan, H.-Y.; et al. Lgr4 Gene Regulates Corpus Luteum Maturation Through Modulation of the WNT-Mediated EGFR-ERK Signaling Pathway. Endocrinology 2014, 155, 3624–3637. [Google Scholar] [CrossRef] [PubMed]
- Woods, D.C.; Johnson, A.L. Protein kinase C activity mediates LH-induced ErbB/Erk signaling in differentiated hen granulosa cells. Reproduction 2007, 133, 733–741. [Google Scholar] [CrossRef][Green Version]
miR Name | Accession Number | Mature Sequence | Chromosome |
---|---|---|---|
bta-miR-222-3p | MIMAT0003530 | AGCUACAUCUGGCUACUGGGU | chX |
bta-miR-29c | MIMAT0003829 | UAGCACCAUUUGAAAUCGGUUA | ch16 |
bta-miR-2411-3p | MIMAT0011973 | GCUGAACUGUCUUACUCCCACAUCC | ch3 |
miR-ID | Normalized Read Counts | Log2 Fold Change of Pregnant CL vs. Regressed CL | Padj (Adjusted p-Value) |
---|---|---|---|
bta-miR-29c | 117 | 1.98 | 2.23 × 10−4 |
bta-miR-21-5p | 195,736 | −1.59 * | 2.29 × 10−4 |
bta-miR-27b | 16,510 | 0.72 | 2.28 × 10−4 |
bta-miR-29a | 7274 | 0.67 | 3.12 × 10−4 |
bta-miR-2332 | 1059 | 1.96 | 6.28 × 10−4 |
bta-miR-32 | 584 | 1.05 | 7.28 × 10−4 |
bta-miR-1248 | 227 | 1.99 | 7.56 × 10−4 |
bta-miR-2411-3p | 662 | 1.91 | 8.56 × 10−4 |
bta-miR-652 | 331 | 1.21 | 7.56 × 10−4 |
bta-miR-150 | 66 | −1.30 | 1.38 × 10−3 |
bta-miR-29b | 340 | 1.52 | 1.67 × 10−3 |
bta-miR-222-3p | 152 | −1.53 | 3.06 × 10−3 |
bta-let-7i | 26,531 | −1.12 | 2.87 × 10−3 |
bta-miR-155 | 382 | −1.27 | 2.87 × 10−3 |
bta-miR-677 | 74 | 1.79 | 2.91 × 10−3 |
bta-miR-199b | 2357 | −1.11 | 2.96 × 10−3 |
bta-miR-30a-5p | 9908 | 0.86 | 2.96 × 10−3 |
bta-miR-33a | 175 | 1.02 | 3.13 × 10−3 |
bta-miR-199a-3p | 6340 | −1.03 | 3.38 × 10−3 |
bta-miR-3604 | 2956 | −1.05 | 4.33 × 10−3 |
bta-miR-3141 | 70 | 2.48 | 4.69 × 10−3 |
bta-miR-148b | 910 | 0.65 | 6.21 × 10−3 |
bta-miR-2484 | 950 | 2.07 | 6.46 × 10−3 |
bta-miR-224 | 228 | −0.98 | 1.12 × 10−2 |
bta-miR-146a | 219 | −1.01 | 1.25 × 10−2 |
bta-miR-23b-3p | 1353 | 0.87 | 1.28 × 10−2 |
bta-miR-30b-5p | 603 | 0.86 | 1.34 × 10−2 |
bta-miR-3600 | 28,676 | 0.92 | 1.34 × 10−2 |
bta-miR-126-5p | 2018 | 0.89 | 1.46 × 10−2 |
bta-miR-22-5p | 502 | 0.71 | 1.80 × 10−2 |
bta-miR-34a | 211 | 0.94 | 1.98 × 10−2 |
bta-miR-379 | 1007 | −1.28 | 1.98 × 10−2 |
bta-miR-149-5p | 71 | −1.03 | 2.08 × 10−2 |
bta-miR-214 | 472 | −0.79 | 2.08 × 10−2 |
bta-miR-29e | 57 | 1.15 | 2.24 × 10−2 |
bta-miR-339a | 1409 | 0.82 | 2.24 × 10−2 |
bta-miR-365-3p | 381 | 0.62 | 2.33 × 10−2 |
bta-miR-382 | 95 | −1.59 | 2.37 × 10−2 |
bta-miR-146b | 483 | −1.21 | 2.48 × 10−2 |
bta-miR-2892 | 88 | 1.42 | 2.73 × 10−2 |
bta-miR-126-3p | 3197 | 0.72 | 2.24 × 10−2 |
bta-miR-1246 | 105 | 1.52 | 4.58 × 10−2 |
bta-miR-411a | 1555 | −0.95 | 4.80 × 10−2 |
bta-miR-432 | 119 | −1.44 | 4.82 × 10−2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gecaj, R.M.; Behluli, B.; Youngs, C.R. Validation of Selected MicroRNA Transcriptome Data in the Bovine Corpus Luteum during Early Pregnancy by RT-qPCR. Curr. Issues Mol. Biol. 2024, 46, 6620-6632. https://doi.org/10.3390/cimb46070394
Gecaj RM, Behluli B, Youngs CR. Validation of Selected MicroRNA Transcriptome Data in the Bovine Corpus Luteum during Early Pregnancy by RT-qPCR. Current Issues in Molecular Biology. 2024; 46(7):6620-6632. https://doi.org/10.3390/cimb46070394
Chicago/Turabian StyleGecaj, Rreze M., Behlul Behluli, and Curtis R. Youngs. 2024. "Validation of Selected MicroRNA Transcriptome Data in the Bovine Corpus Luteum during Early Pregnancy by RT-qPCR" Current Issues in Molecular Biology 46, no. 7: 6620-6632. https://doi.org/10.3390/cimb46070394
APA StyleGecaj, R. M., Behluli, B., & Youngs, C. R. (2024). Validation of Selected MicroRNA Transcriptome Data in the Bovine Corpus Luteum during Early Pregnancy by RT-qPCR. Current Issues in Molecular Biology, 46(7), 6620-6632. https://doi.org/10.3390/cimb46070394