Linking Pedigree Information to the Gene Expression Phenotype to Understand Differential Family Survival Mechanisms in Highly Fecund Fish: A Case Study in the Larviculture of Pacific Bluefin Tuna
Abstract
:1. Introduction
2. Materials and Methods
2.1. Parentage Assessment
2.2. Transcriptome Analysis
2.3. RT-qPCR Assay
3. Results
3.1. The Influence of Parental Genetic Effects on Offspring Survival

3.2. Parental Effect on Gene Expression Phenotype
3.3. Correlation with the PG2 Expression Levels at 15 DPH and Larval Survival
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Houde, E.D. Patterns and trends in larval-stage growth and mortality of teleost fish. J. Fish Biol. 1997, 51, 52–83. [Google Scholar] [CrossRef]
- Robledo, D.; Palaiokostas, C.; Bargelloni, L.; Martínez, P.; Houston, R. Applications of genotyping by sequencing in aquaculture breeding and genetics. Rev. Aquac. 2018, 10, 670–682. [Google Scholar] [CrossRef]
- Vandeputte, M.; Haffray, P. Parentage assignment with genomic markers: A major advance for understanding and exploiting genetic variation of quantitative traits in farmed aquatic animals. Front. Genet. 2014, 5, 432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sekino, M.; Saitoh, K.; Yamada, T.; Kumagai, A.; Hara, M.; Yamashita, Y. Microsatellite-based pedigree tracing in a Japanese flounder Paralichthys olivaceus hatchery strain: Implications for hatchery management related to stock enhancement program. Aquaculture 2003, 221, 255–263. [Google Scholar] [CrossRef]
- Cheung, V.G.; Spielman, R.S. The genetics of variation in gene expression. Nat. Genet. 2002, 32, 522–525. [Google Scholar] [CrossRef] [PubMed]
- Oleksiak, M.F. Genomic approaches with natural fish populations. J. Fish Biol. 2010, 76, 1067–1093. [Google Scholar] [CrossRef] [Green Version]
- Oleksiak, M.F.; Churchill, G.A.; Crawford, D.L. Variation in gene expression within and among natural populations. Nat. Genet. 2002, 32, 261–266. [Google Scholar] [CrossRef] [PubMed]
- Cheung, V.G.; Conlin, L.K.; Weber, T.M.; Arcaro, M.; Jen, K.-Y.; Morley, M.; Spielman, R.S. Natural variation in human gene expression assessed in lymphoblastoid cells. Nat. Genet. 2003, 33, 422–425. [Google Scholar] [CrossRef]
- Morley, M.; Molony, C.M.; Weber, T.M.; Devlin, J.L.; Ewens, K.G.; Spielman, R.S.; Cheung, V.G. Genetic analysis of genome-wide variation in human gene expression. Nature 2004, 430, 743–747. [Google Scholar] [CrossRef]
- Schadt, E.E.; Monks, S.A.; Drake, T.A.; Lusis, A.J.; Che, N.; Colinayo, V.; Ruff, T.G.; Milligan, S.B.; Lamb, J.R.; Cavet, G.; et al. Genetics of gene expression surveyed in maize, mouse and man. Nat. Cell Biol. 2003, 422, 297–302. [Google Scholar] [CrossRef]
- Bicskei, B.; Taggart, J.B.; Glover, K.A.; Bron, J.E. Comparing the transcriptomes of embryos from domesticated and wild Atlantic salmon (Salmo salar L.) stocks and examining factors that influence heritability of gene expression. Genet. Sel. Evol. 2016, 48, 1–16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bernatchez, L.; Audet, C.; Bougas, B. The influence of parental effects on transcriptomic landscape during early development in brook charr (Salvelinus fontinalis, Mitchill). Heredity 2013, 110, 484–491. [Google Scholar] [CrossRef]
- Sawada, Y.; Okada, T.; Miyashita, S.; Murata, O.; Kumai, H. Completion of the Pacific bluefin tuna Thunnus orientalis (Temminck et Schlegel) life cycle. Aquac. Res. 2005, 36, 413–421. [Google Scholar] [CrossRef]
- Tanaka, Y.; Kumon, K.; Ishihi, Y.; Eba, T.; Nishi, A.; Nikaido, H.; Shiozawa, S. Mortality processes of hatchery-reared Pacific bluefin tuna Thunnus orientalis (Temminck et Schlegel) larvae in relation to their piscivory. Aquac. Res. 2017, 49, 11–18. [Google Scholar] [CrossRef] [Green Version]
- Yasuike, M.; Fujiwara, A.; Nakamura, Y.; Iwasaki, Y.; Nishiki, I.; Sugaya, T.; Shimizu, A.; Sano, M.; Kobayashi, T.; Ototake, M. A functional genomics tool for the Pacific bluefin tuna: Development of a 44K oligonucleotide microarray from whole-genome sequencing data for global transcriptome analysis. Gene 2016, 576, 603–609. [Google Scholar] [CrossRef] [Green Version]
- Saitoh, K.; Suzuki, N.; Ozaki, M.; Ishii, K.; Sado, T.; Morosawa, T.; Tsunagawa, T.; Tsuchiya, M. Natural habitats uncovered?—Genetic structure of known and newly found localities of the endangered bitterling Pseudorhodeus tanago (Cyprinidae). Nat. Conserv. 2017, 17, 19–33. [Google Scholar] [CrossRef] [Green Version]
- Uchino, T.; Nakamura, Y.; Sekino, M.; Kai, W.; Fujiwara, A.; Yasuike, M.; Sugaya, T.; Fukuda, H.; Sano, M.; Sakamoto, T. Con-structing genetic linkage maps using the whole genome sequence of Pacific bluefin tuna and a comparison of chromosome structure among teleost species. Adv. Biosci. Biotechnol. 2016, 7, 85–122. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Maeda, M.; Oshiman, K.; Tamura, S.; Futai, M. Human gastric (H+ + K+)-ATPase gene. Similarity to (Na+ + K+)-ATPase genes in exon/intron organization but difference in control region. J. Biol. Chem. 1990, 265, 9027–9032. [Google Scholar] [CrossRef]
- Sachs, G.; Chang, H.H.; Rabon, E.; Schackman, R.; Lewin, M.; Saccomani, G. A nonelectrogenic H+ pump in plasma membranes of hog stomach. J. Biol. Chem. 1976, 251, 7690–7698. [Google Scholar] [CrossRef]
- Foltmann, B. Gastric proteinases--structure, function, evolution and mechanism of action. Essays Biochem. 1981, 17, 52–84. [Google Scholar]
- Reis, C.A.; David, L.; Nielsen, P.A.; Clausen, H.; Mirgorodskaya, K.; Roepstorff, P.; Sobrinho-Simoes, M. Immunohistochemical study of MUC5AC expression in human gastric carcinomas using a novel monoclonal antibody. Int. J. Cancer 1997, 74, 112–121. [Google Scholar] [CrossRef]
- Lang, T.; Klasson, S.; Larsson, E.; Johansson, M.E.; Hansson, G.C.; Samuelsson, T. Searching the Evolutionary origin of epi-thelial mucus protein components-mucins and FCGBP. Mol. Biol. Evol. 2016, 33, 1921–1936. [Google Scholar] [CrossRef]
- Yasuike, M.; Iwasaki, Y.; Nishiki, I.; Nakamura, Y.; Matsuura, A.; Yoshida, K.; Noda, T.; Andoh, T.; Fujiwara, A. The yellowtail (Seriola quinqueradiata) genome and transcriptome atlas of the digestive tract. DNA Res. 2018, 25, 547–560. [Google Scholar] [CrossRef] [Green Version]
- Manchado, M.; Infante, C.; Asensio, E.; Crespo, A.; Zuasti, E.; Cañavate, J.P. Molecular characterization and gene expression of six trypsinogens in the flatfish Senegalese sole (Solea senegalensis Kaup) during larval development and in tissues. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2008, 149, 334–344. [Google Scholar] [CrossRef]
- Xie, J.; Zhu, X.Y.; Liu, L.M.; Meng, Z.Q. Solute carrier transporters: Potential targets for digestive system neoplasms. Cancer Manag. Res. 2018, 10, 153–166. [Google Scholar] [CrossRef] [Green Version]
- Xu, J.; Henriksnäs, J.; Barone, S.; Witte, D.; Shull, G.E.; Forte, J.G.; Holm, L.; Soleimani, M. SLC26A9 is expressed in gastric surface epithelial cells, mediates Cl−/HCO3− exchange, and is inhibited by NH4+. Am. J. Physiol. Physiol. 2005, 289, C493–C505. [Google Scholar] [CrossRef]
- Limoges, M.-A.; Cloutier, M.; Nandi, M.; Ilangumaran, S.; Ramanathan, S. The GIMAP family proteins: An incomplete puzzle. Front. Immunol. 2021, 12, 679739. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Yang, N.; Xie, T.; Yang, G.; Chang, L.; Yan, D.; Li, T. Summary and comparison of the perforin in teleosts and mammals: A review. Scand. J. Immunol. 2021, 94, e13047. [Google Scholar] [CrossRef] [PubMed]
- Efimova, I.; Steinberg, I.; Zvibel, I.; Neumann, A.; Mantelmacher, D.F.; Drucker, D.J.; Fishman, S.; Varol, C. GIPR signaling in immune cells maintains metabolically beneficial type 2 immune responses in the white fat from obese mice. Front. Immunol. 2021, 12, 643144. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Bi, X.; Chu, Q.; Xu, T. Discovery of toll-like receptor 13 exists in the teleost fish: Miiuy croaker (Perciformes, Sciaenidae). Dev. Comp. Immunol. 2016, 61, 25–33. [Google Scholar] [CrossRef]
- Clark, E.A.; Giltiay, N.V. CD22: A regulator of innate and adaptive B cell responses and autoimmunity. Front. Immunol. 2018, 9, 2235. [Google Scholar] [CrossRef]
- Liu, C.; Wang, T.; Zhang, W.; Li, X. Computational identification and analysis of immune-associated nucleotide gene family in Arabidopsis thaliana. J. Plant Physiol. 2008, 165, 777–787. [Google Scholar] [CrossRef] [PubMed]
- Liu, P.; Wang, L.; Kwang, J.; Yue, G.H.; Wong, S.-M. Transcriptome analysis of genes responding to NNV infection in Asian seabass epithelial cells. Fish Shellfish Immunol. 2016, 54, 342–352. [Google Scholar] [CrossRef]
- Zhang, X.; Liu, Z.; Li, C.; Zhang, Y.; Wang, L.; Wei, J.; Qin, Q. Characterization of orange-spotted grouper (Epinephelus coioides) ASC and caspase-1 involved in extracellular ATP-mediated immune signaling in fish. Fish Shellfish Immunol. 2020, 97, 58–71. [Google Scholar] [CrossRef]
- Afzali, B.; Kim, S.; West, E.; Nova-Lamperti, E.; Cheru, N.; Nagashima, H.; Yan, B.; Freiwald, T.; Merle, N.; Chauss, D.; et al. RNF144A shapes the hierarchy of cytokine signaling to provide protective immunity against influenza. Biorxiv 2019, 782680. [Google Scholar] [CrossRef]
- Tanji, M.; Yakabe, E.; Kubota, K.; Kageyama, T.; Ichinose, M.; Miki, K.; Ito, H.; Takahashi, K. Structural and phylogenetic comparison of three pepsinogens from Pacific bluefin tuna: Molecular evolution of fish pepsinogens. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2009, 152, 9–19. [Google Scholar] [CrossRef]
- Kaji, T.; Tanaka, M.; Takahashi, Y.; Oka, M.; Ishibashi, N. Preliminary observations on development of Pacific bluefin tuna Thunnus thynnus (Scombridae) larvae reared in the laboratory, with special reference to the digestive system. Mar. Freshw. Res. 1996, 47, 261–269. [Google Scholar] [CrossRef]
- Miyashita, S.; Kato, K.; Sawada, Y.; Murata, O.; Ishitani, Y.; Shimizu, K.; Yamamoto, S.; Kumai, H. Development of digestive system and digestive enzyme activities of larval and juvenile bluefin tuna, Thunnus thynnus, reared in the laboratory. Aquac. Sci. 1998, 46, 111–120. [Google Scholar]
- Murashita, K.; Matsunari, H.; Kumon, K.; Tanaka, Y.; Shiozawa, S.; Furuita, H.; Oku, H.; Yamamoto, T. Characterization and ontogenetic development of digestive enzymes in Pacific bluefin tuna Thunnus orientalis larvae. Fish Physiol. Biochem. 2014, 40, 1741–1755. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, Y.; Minami, H.; Ishihi, Y.; Kumon, K.; Higuchi, K.; Eba, T.; Nishi, A.; Nikaido, H.; Shiozawa, S. Differential growth rates related to initiation of piscivory by hatchery-reared larval Pacific bluefin tuna Thunnus orientalis. Fish. Sci. 2014, 80, 1205–1214. [Google Scholar] [CrossRef]
- Tanaka, Y.; Minami, H.; Ishihi, Y.; Kumon, K.; Eba, T.; Nishi, A.; Nikaido, H.; Shiozawa, S. Prey utilization by hatchery-reared Pacific bluefin tuna larvae in mass culture tank estimated using stable isotope analysis, with special reference to their growth variation. Aquac. Sci. 2010, 58, 501–508. [Google Scholar]
- Tanaka, Y.; Minami, H.; Ishihi, Y.; Kumon, K.; Higuchi, K.; Eba, T.; Nishi, A.; Nikaido, H.; Shiozawa, S. Relationship between prey utilization and growth variation in hatchery-reared Pacific bluefin tuna, Thunnus orientalis (Temminck et Schlegel), larvae estimated using nitrogen stable isotope analysis. Aquac. Res. 2012, 45, 537–545. [Google Scholar] [CrossRef]
- Sabate, F.D.L.S.; Sakakura, Y.; Tanaka, Y.; Kumon, K.; Nikaido, H.; Eba, T.; Nishi, A.; Shiozawa, S.; Hagiwara, A.; Masuma, S. Onset and development of cannibalistic and schooling behavior in the early life stages of Pacific bluefin tuna Thunnus orientalis. Aquaculture 2010, 301, 16–21. [Google Scholar] [CrossRef] [Green Version]
- Bourque, G.; Burns, K.H.; Gehring, M.; Gorbunova, V.; Seluanov, A.; Hammell, M.; Imbeault, M.; Izsvák, Z.; Levin, H.L.; Macfarlan, T.S.; et al. Ten things you should know about transposable elements. Genome Biol. 2018, 19, 1–12. [Google Scholar] [CrossRef]
- Horváth, V.; Merenciano, M.; González, J. Revisiting the relationship between transposable elements and the eukaryotic stress response. Trends Genet. 2017, 33, 832–841. [Google Scholar] [CrossRef]
- Urlacher, S.; Ellison, P.T.; Sugiyama, L.S.; Pontzer, H.; Eick, G.; Liebert, M.A.; Cepon-Robins, T.J.; Gildner, T.E.; Snodgrass, J.J. Tradeoffs between immune function and childhood growth among Amazonian forager-horticulturalists. Proc. Natl. Acad. Sci. USA 2018, 115, E3914–E3921. [Google Scholar] [CrossRef] [Green Version]
- Miura, T.; Iwata, K.; Zongshe, Z. Biological significance of effects of phytophagous fishes on phytoplankton. Chin. J. Oceanol. Limnol. 1989, 7, 335–338. [Google Scholar] [CrossRef]
- Ringø, E.; Olsen, R.E.; Mayhew, T.M.; Myklebust, R. Electron microscopy of the intestinal microflora of fish. Aquaculture 2003, 227, 395–415. [Google Scholar] [CrossRef]
- Wang, Z.; Gerstein, M.; Snyder, M. RNA-Seq: A revolutionary tool for transcriptomics. Nat. Rev. Genet. 2009, 10, 57–63. [Google Scholar] [CrossRef]




| Gene | Forward Primer | Reverse Primer | TaqMan MGB Probe |
|---|---|---|---|
| PG1 | AACGAGCTGTACTGGCAGATCA | AGCCACAACCTGACCATTGAC | CAGTGGACAGTGTTACC |
| PG2 | CCGAGGTCACCTTCACTCTGA | GCCAGTTCTGCAACCATAGTAGCT | CTGCATCTGCCTACGTC |
| PG3 | CCACCTACCTGCCCTCTAGTGA | GTGCGGTCGTAGACGGAGTAGT | CTCTGTGGATCTTTG |
| ATP4A | TCCTCCAAGAGCCACTGTACCT | CACCATGACAACCCTGATACCA | CAGTGATGAAATGTCG |
| ATP4B | CCATGCCTTGTGTCATCATTAAG | ATTCTCCTGTCCTTCCAGTATGGT | TGAACAGGATCATTGGC |
| β-actin | GAAATCGCCGCACTGGTT | GCATCGTCTCCGGCAAAT | ATCCGGAATGTGCAAAG |
| Ranking | Oligo Array Probe ID | Putative Gene Product | ♀262♂202/ ♀412♂202 | ♀262♂432/ ♀412♂202 | ♀412♂387/ ♀412♂202 |
|---|---|---|---|---|---|
| 1 | Ba00000144_g2079 | Pepsinogen 3 (PG3) | 26.40 | 22.88 | 49.55 |
| 2 | Ba00008844_g23666 | Hyaluronidase-1 | 22.02 | 26.52 | 28.03 |
| 3 | Ba00008341_g23272 | Pepsinogen 3 (PG3) | 16.78 | 13.38 | 27.67 |
| 4 | Ba00001220_g9569 | Potassium-transporting ATPase alpha (ATP4A) | 22.39 | 17.69 | 16.29 |
| 5 | isotigB109707_c | Hypothetical protein | 16.05 | 16.33 | 15.60 |
| 6 | Ba00000817_g7404 | Pepsinogen 1 (PG1) | 13.95 | 14.12 | 14.04 |
| 7 | isotigB46117_n | RNA-directed DNA polymerase | 17.45 | 15.52 | 8.50 |
| 8 | Ba00002263_g13715 | Potassium-transporting ATPase subunit beta (ATP4B) | 15.41 | 10.59 | 15.01 |
| 9 | Ba00000128_g1851 | Pepsinogen 2 (PG2) | 13.06 | 12.98 | 13.11 |
| 10 | isotigB18854_c | Hypothetical protein | 7.91 | 14.33 | 6.00 |
| 11 | Ba00000638_g6231 | Hypothetical protein | 12.22 | 6.26 | 5.80 |
| 12 | Ba00005732_g20720 | Hypothetical protein | 6.68 | 8.80 | 6.61 |
| 13 | isotigB46118_n | Prostate stem cell antigen | 8.78 | 7.36 | 4.15 |
| 14 | Ba00000678_g6517 | Solute carrier family 26, member 9 (SLC26A9) | 6.47 | 7.01 | 5.90 |
| 15 | Ba00000139_g2005 | Trypsinogen | 3.81 | 8.13 | 6.84 |
| 16 | Ba00003884_g17895.p2.613-1845 | Solute carrier family 22 member 31 (SLC22A31) | 5.60 | 5.27 | 6.51 |
| 17 | Ba00000257_g3256 | Fc fragment of IgG binding protein (FCGBP) | 5.53 | 6.19 | 3.57 |
| 18 | Ba00010561_g24778 | ATP-dependent DNA helicase PIF1 | 4.77 | 5.98 | 4.41 |
| 19 | Ba00004935_g19660 | Mucin-5AC (MUC5AC) | 4.06 | 4.36 | 5.68 |
| 20 | BaME00000895_g9062 | Hypothetical protein | 4.94 | 4.15 | 4.68 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yasuike, M.; Kumon, K.; Tanaka, Y.; Saitoh, K.; Sugaya, T. Linking Pedigree Information to the Gene Expression Phenotype to Understand Differential Family Survival Mechanisms in Highly Fecund Fish: A Case Study in the Larviculture of Pacific Bluefin Tuna. Curr. Issues Mol. Biol. 2021, 43, 2098-2110. https://doi.org/10.3390/cimb43030145
Yasuike M, Kumon K, Tanaka Y, Saitoh K, Sugaya T. Linking Pedigree Information to the Gene Expression Phenotype to Understand Differential Family Survival Mechanisms in Highly Fecund Fish: A Case Study in the Larviculture of Pacific Bluefin Tuna. Current Issues in Molecular Biology. 2021; 43(3):2098-2110. https://doi.org/10.3390/cimb43030145
Chicago/Turabian StyleYasuike, Motoshige, Kazunori Kumon, Yosuke Tanaka, Kenji Saitoh, and Takuma Sugaya. 2021. "Linking Pedigree Information to the Gene Expression Phenotype to Understand Differential Family Survival Mechanisms in Highly Fecund Fish: A Case Study in the Larviculture of Pacific Bluefin Tuna" Current Issues in Molecular Biology 43, no. 3: 2098-2110. https://doi.org/10.3390/cimb43030145
APA StyleYasuike, M., Kumon, K., Tanaka, Y., Saitoh, K., & Sugaya, T. (2021). Linking Pedigree Information to the Gene Expression Phenotype to Understand Differential Family Survival Mechanisms in Highly Fecund Fish: A Case Study in the Larviculture of Pacific Bluefin Tuna. Current Issues in Molecular Biology, 43(3), 2098-2110. https://doi.org/10.3390/cimb43030145

