DNA Metabarcoding Using Indexed Primers: Workflow to Characterize Bacteria, Fungi, Plants, and Arthropods from Environmental Samples
Abstract
1. Introduction
2. Materials and Methods
2.1. DNA Isolation and Quantification
2.2. Indexed Primer Constructs for PCR
2.3. Amplification
2.4. Library Purification
2.5. Library Quantification and Pooling
2.6. Sequencing Primer Constructs
2.7. Next-Generation Sequencing
2.8. Demultiplexing of Raw Sequencing Reads
2.9. Primer Trimming and Amplicon Sequence Variant Identification
2.10. Taxonomic Assignments and Data Reporting
3. Results
4. Discussion
4.1. Wet Laboratory Workflow
4.2. Bioinformatic Workflow
4.3. Positive Controls
4.4. Environmental Samples
4.5. Research Limitations
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pan, B.; Wu, Y.; Yang, Q.; Ge, L.; Gao, C.; Xun, Y.; Tian, J.; Ding, G. Minimizing polymerase biases in metabarcoding. Mol. Ecol. Resour. 2018, 18, 927–939. [Google Scholar] [CrossRef]
- Woese, C.R.; Gutell, R.; Gupta, R.; Noller, H.F. Detailed analysis of the higher-order structure of 16S-like ribosomal ribonucleic acids. Microbiol. Rev. 1983, 47, 621–669. [Google Scholar] [CrossRef] [PubMed]
- Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1991, 173, 697–703. [Google Scholar] [CrossRef] [PubMed]
- Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Fungal Barcoding Consortium; Fungal Barcoding Consortium Author List; Bolchacova, E.; et al. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. USA 2012, 109, 6241–6246. [Google Scholar] [CrossRef] [PubMed]
- Nilsson, R.H.; Ryberg, M.; Abarenkov, K.; Sjökvist, E.; Kristiansson, E. The ITS region as a target for characterization of fungal communities using emerging sequencing technologies. FEMS Microbiol. Lett. 2009, 26, 97–101. [Google Scholar] [CrossRef]
- Hebert, P.D.N.; Cywinska, A.; Ball, S.L.; deWaard, J.R. Biological identification through DNA barcodes. Proc. R. Soc. Lond. B 2003, 270, 313–321. [Google Scholar] [CrossRef]
- CBOL Plant Working Group. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 2009, 106, 12794–12797. [Google Scholar] [CrossRef] [PubMed]
- Fahner, N.A.; Shokralla, S.; Baird, D.J.; Hajibabaei, M. Large-scale monitoring of plants through environmental DNA metabarcoding of soil: Recovery, resolution, and annotation of four DNA markers. PLoS ONE 2016, 11, e0157505. [Google Scholar] [CrossRef]
- Cheng, T.; Xu, C.; Lei, L.; Li, C.; Zhang, Y.; Zhou, S. Barcoding the kingdom Plantae: New PCR primers for ITS regions of plants with improved universality and specificity. Mol. Biol. Resour. 2016, 16, 138–149. [Google Scholar] [CrossRef]
- Taberlet, P.; Coissac, E.; Pompanon, F.; Gielly, L.; Miquel, C.; Valentini, A.; Vermat, T.; Corthier, G.; Brochmann, C.; Willerslev, E. Power and limitations of the cholorplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Res. 2007, 35, e14. [Google Scholar] [CrossRef] [PubMed]
- Gilbert, J.A.; Meyer, F.; Jansson, J.; Gordon, J.; Pace, N.; Tiedje, J.; Ley, R.; Fierer, N.; Field, D.; Kyrpides, N.; et al. The Earth Microbiome Project: Meeting report of the “1st EMP meeting on sample selection and acquisition” at Argonne National Laboratory October 6th, 2010. Stand. Genom. Sci. 2010, 3, 249–253. [Google Scholar] [CrossRef]
- Caporaso, J.G.; Lauber, C.L.; Walters, W.A.; Berg-Lyons, D.; Louzpone, C.A.; Turnbaugh, P.J.; Fierer, N.; Knight, R. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proc. Natl. Acad. Sci. USA 2011, 108 (Suppl. S1), 4516–4522. [Google Scholar] [CrossRef] [PubMed]
- Amaral-Zettler, L.A.; McCliment, E.A.; Ducklow, H.W.; Huse, S.M. A method for studying protistan diversity using massively parallel sequencing of V9 hypervariable regions of small-subunit ribosomal RNA genes. PLoS ONE 2009, 4, e6372. [Google Scholar] [CrossRef]
- Stoeck, T.; Bass, D.; Nebel, M.; Christen, R.; Jones, M.D.M.; Breiner, H.-W.; Richards, T.A. Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water. Mol. Ecol. 2010, 19 (Suppl. S1), 21–31. [Google Scholar] [CrossRef] [PubMed]
- Smith, D.P.; Peay, K.G. Sequence depth, not PCR replication, improves ecological inference from next generation DNA sequencing. PLoS ONE 2014, 9, e90234. [Google Scholar] [CrossRef] [PubMed]
- Tiedge, T.M.; Meiklejohn, K.A. Assessing three soil removal methods for environmental DNA analysis of mock forensic geology evidence. J. Forensic Sci. 2024, 69, 52–59. [Google Scholar] [CrossRef] [PubMed]
- Parada, A.E.; Needham, D.M.; Fuhrman, J.A. Every base matters: Assessing small subunit rRNA primers for marine microbiomes with mock communities, time series and global field samples. Environ. Microbiol. 2016, 18, 1403–1414. [Google Scholar] [CrossRef] [PubMed]
- Apprill, A.; McNally, S.; Parsons, R.; Weber, L. Minor revision to V4 region SSU rRNA 806R gene primer greatly increases detection of SAR11 bacterioplankton. Aquat. Microb. Ecol. 2015, 75, 129–137. [Google Scholar] [CrossRef]
- Grantham, N.S.; Reich, B.J.; Pacifici, K.; Laber, E.B.; Menninger, H.L.; Henley, J.B.; Barberán, A.; Leff, J.W.; Fierer, N.; Dunn, R.R. Fungi identify the geographic origin of dust samples. PLoS ONE 2015, 10, e0122605. [Google Scholar] [CrossRef] [PubMed]
- Timpano, E.K.; Scheible, M.K.R.; Meiklejohn, K.A. Optimization of the second internal transcribed spacer (ITS2) for characterizing land plants from soil. PLoS ONE 2020, 15, e0231436. [Google Scholar] [CrossRef]
- Zeale, M.R.K.; Butlin, R.K.; Barker, G.L.A.; Lees, D.C.; Jones, G. Taxon-specific PCR for DNA barcoding arthropod prey in bat faeces. Mol. Ecol. Resour. 2011, 11, 236–244. [Google Scholar] [CrossRef] [PubMed]
- Hajibabaei, M.; Janzen, D.H.; Burns, J.M.; Hallwachs, W.; Hebert, P.D.N. DNA barcodes distinguish species of tropical Lepidoptera. Proc. Natl. Acad. Sci. USA 2006, 103, 968–971. [Google Scholar] [CrossRef]
- Elbrecht, V.; Braukmann, T.W.A.; Ivanova, N.V.; Prosser, S.W.J.; Hajibabaei, M.; Wright, M.; Zakharov, E.V.; Hebert, P.D.N.; Steinke, D. Validation of COI metabarcoding primers for terrestrial arthropods. PeerJ 2019, 7, e7745. [Google Scholar] [CrossRef]
- Deagle, B.E.; Jarman, S.N.; Coissac, E.; Pompanon, F.; Taberlet, P. DNA metabarcoding and the cytochrome c oxidase subunit I marker: Not a perfect match. Biol. Lett. 2014, 10, 20140562. [Google Scholar] [CrossRef] [PubMed]
- Earth Microbiome Project. 16S Illumina Amplicon Protocol. Available online: https://earthmicrobiome.org/protocols-and-standards/16s/ (accessed on 1 April 2021).
- Walters, W.; Hyde, E.R.; Berg-Lyons, D.; Ackermann, G.; Humphrey, G.; Parada, A.; Gilbert, J.A.; Jansson, J.K.; Caporaso, J.G.; Fuhrman, J.A.; et al. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys. mSystems 2016, 1, e00009-15. [Google Scholar] [CrossRef]
- Illumina. Considerations When Migrating Non Illumina Libraries Between Sequencing Platforms. Available online: https://knowledge.illumina.com/library-preparation/general/library-preparation-general-reference_material-list/000001478 (accessed on 1 May 2021).
- Illumina. How to Perform Library Heat Denaturation (Heat Shock) Before Sequencing? Available online: https://knowledge.illumina.com/library-preparation/general/library-preparation-general-faq-list/000005129 (accessed on 1 July 2022).
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [PubMed]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef]
- Chamberlain, S.A.; Szöcs, E. taxize: Taxonomic search and retrieval in R. F1000Research 2013, 2, 191. [Google Scholar] [CrossRef]
- McLaren, M.R.; Callahan, B.J. Silva 138.1 prokaryotic SSU taxonomic training data formatted for DADA2. Zenodo. 2021. [Google Scholar] [CrossRef]
- Abarenkov, K.; Zirk, A.; Piirmann, T.; Pöhönen, R.; Ivanov, F.; Nilsson, R.H.; Kõljalg, U. UNITE general FASTA release for eukaryotes. Version 18.07.2023. UNITE Community. 2023. [Google Scholar] [CrossRef]
- CALeDNA. Reference Databases for Metabarcoding: Metabarcoding Reference Database. 2019. Available online: https://ucedna.com/reference-databases-for-metabarcoding (accessed on 1 August 2023).
- Santos, C.; Carneiro, J.; Pereira, F. A Web-Based Platform of Nucleotide Sequence Alignments of Plants. Submitted to Molecular Ecology Resources. 2017. Available online: https://www.biorxiv.org/content/10.1101/617035v2.full-text (accessed on 1 August 2023).
- Ratnasingham, S.; Hebert, P.D.N. BOLD: The Barcode of Life Data System. Mol. Ecol. Notes 2007, 7, 355–364. [Google Scholar] [CrossRef]
- Wickham, H. ggplot2: Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2016. [Google Scholar]
- Madden, A.A.; Barberán, A.; Bertone, M.A.; Menninger, H.L.; Dunn, R.R.; Fierer, N. The diversity of arthropods in homes across the United States as determined by environmental DNA analyses. Mol. Ecol. 2016, 25, 6214–6224. [Google Scholar] [CrossRef]
- Oliverio, A.M.; Gan, H.; Wickings, K.; Fierer, N. A DNA metabarcoding approach to characterize soil arthropod communities. Soil Biol. Biochem. 2018, 125, 37–43. [Google Scholar] [CrossRef]
- Bellemain, E.; Carlsen, T.; Brochmann, C.; Coissac, E.; Taberlet, P.; Kauserud, H. ITS as an environmental DNA barcode for fungi: An in silico approach reveals potential PCR biases. BMC Microbiol. 2010, 10, 189. [Google Scholar] [CrossRef] [PubMed]
- Dopheide, A.; Xie, D.; Buckley, T.R.; Drummond, A.J.; Newcomb, R.D. Impacts of DNA extraction and PCR on DNA metabarcoding estimates of soil biodiversity. Methods Ecol. Evol. 2019, 10, 120–133. [Google Scholar] [CrossRef]
- Ficetola, G.F.; Pansu, J.; Bonin, A.; Coissac, E.; Giguet-Covex, C.; De Barba, M.; Gielly, L.; Lopes, C.M.; Boyer, F.; Pompanon, F.; et al. Replication levels, false presences, and the estimation of the presence/absence from eDNA metabarcoding data. Mol. Ecol. Resour. 2015, 15, 543–556. [Google Scholar] [CrossRef] [PubMed]
- Shirazi, S.; Meyer, R.S.; Shapiro, B. Revisiting the effect of PCR replication and sequencing depth on biodiversity metrics in environmental DNA metabarcoding. Ecol. Evol. 2021, 11, 15766–15779. [Google Scholar] [CrossRef]
Target Taxon | DNA Target | Primer | Sequence (5′ to 3′) | Library Size (bp) * | Reference |
---|---|---|---|---|---|
Bacteria | 16S | 515F | GTGYCAGCMGCCGCGGTAA | ~400 | [12,17] |
806R | GGACTACNVGGGTWTCTAAT | [12,18] | |||
Fungi | ITS1 | ITS1-F | CTTGGTCATTTAGAGGAAGTAA | ~500 | [19] |
ITS2 | GCTGCGTTCTTCATCGATGC | [19] | |||
Plants | ITS2 a | ITS2F | ATGCGATACTTGGTGTGAAT | ~500 | [20] |
ITSp4 | CCGCTTAKTGATATGCTTAAA | [20] | |||
ITS2 b | ITSp3 | YGACTCTCGGCAACGGATA | ~500 | [20] | |
ITSu4 | RGTTTCTTTTCCTCCGCTTA | [20] | |||
trnL p6 loop | c | CGAAATCGGTAGACGCTACG | ~300 | [10] | |
h | CCATTGAGTCTCTGCACCTATC | [10] | |||
Arthropods | COI c | ZBJArtF1c | AGATATTGGAACWTTATATTTTATTTTTGG | ~300 | [21] |
ZBJArtR2c | WACTAATCAATTWCCAAATCCTCC | [21] | |||
COI d | mLepF1 | GCTTTCCCACGAATAAATAATA | ~500 | [22] | |
LepR1 | TAAACTTCTGGATGTCCAAAAAATCA | [22] |
Environmental Sample Type | DNA Isolation Yield (ng/μL) | Library Yield (nM) | |
---|---|---|---|
Median | Dust | 0.112 * | 133.8 |
Soil | 143.5 | 245.8 | |
Range | Dust | 0.05–1.35 * | 5.6–595.3 |
Soil | 2.62–580 | 36.6–629.6 |
Environmental Sample Type | Bacteria | Fungi | Plants | Arthropods | ||||
---|---|---|---|---|---|---|---|---|
16S | ITS1 | ITS2 a | ITS2 b | trnL p6 Loop | COI c | COI d | ||
Median | Dust | 88,148 | 4159 | 17,785 | 2920 | 51,063 | 1209 | 457 |
Soil | 51,003 | 1958 | 21,952 | 6296 | 48,358 | 1312 | 1664 | |
Range | Dust | 15,587–397,273 | 186–22,957 | 203–62,897 | 70–19,445 | 2504–138,841 | 107–10,699 | 64–8277 |
Soil | 23,572–348,814 | 37–26,770 | 3904–142,947 | 110–19,046 | 13,167–329,421 | 110–19,046 | 62–17,342 |
Taxon | Primer Pair | # of Taxa in Positive Control | % of Known Taxa Recovered | Total # of ASVs Recovered per Primer Pair | Known ASVs Present in Each Positive Control? † | # of Reads per Known ASV | # of Known ASVs Resolved to the Species Level | # of Non-Known Reads |
---|---|---|---|---|---|---|---|---|
Plants | trnL p6 loop | 4 | 50% | Target: 14 Non-known: 31 Total: 45 | 1 (out of 14) | Median: 0 (14 ASVs) Range: 0–44,518 | 7 | Median: 0 Range: 0–3508 |
ITS2 a | 50% | Target: 4 Non-known: 7 Total: 11 | 3 (out of 4) | Median: 1020 (4 ASVs) Range: 0–9234 | 0 | Median: 0 Range: 0–52 | ||
ITS2 b | 50% | Target: 4 Non-known: 1 Total: 5 | 2 (out of 4) | Median: 407 (4 ASVs) Range: 0–14,268 | 1 | 13 (1 ASV) | ||
Bacteria | 16S | 8 | 75% * | Target: 6 Non-known: 48 (6 in high abundance) Total: 54 | 6 (out of 6) | Median: 1663 (6 ASVs) Range: 656–34,786 | 5 | High: 1743 Low: 0 |
Fungi | ITS1 | 4 | 0% | Target: 0 Non-known: 1 Total: 1 | No | 0 | 0 | 2 (1 ASV) |
Arthropods | COI c | 4 | 75% | Target: 5 Non-known: 0 Total: 5 | 0 (out of 5) | Median: 0 (5 ASVs) Range: 0–41 | 5 | 0 |
COI d | 25% | Target: 15 Non-known: 0 Total: 15 | 0 (out of 15) | Median: 0 (15 ASVs) Range: 0–1218 | 15 | 0 |
Geologic Material | Bacteria | Fungi | Plants | Arthropods | ||||
---|---|---|---|---|---|---|---|---|
16S | ITS1 | ITS2 a | ITS2 b | trnL p6 Loop | COI c * | COI d | ||
Median | Dust | 6368 | 639 | 7680 | 217 | 38,654 | 0 | 0 |
Soil | 19,901 | 740 | 11,119 | 539 | 30,792 | 0 | 0 | |
Range | Dust | 43–121,474 | 17,519 | 0–38,746 | 0–5578 | 0–189,957 | 0–95 | 0–9717 |
Soil | 0–61,951 | 0–10,191 | 0–36,952 | 0–8334 | 5316–30,792 | 0–118 | 0–8349 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tiedge, T.M.; Rabasco, J.T.; Meiklejohn, K.A. DNA Metabarcoding Using Indexed Primers: Workflow to Characterize Bacteria, Fungi, Plants, and Arthropods from Environmental Samples. Diversity 2025, 17, 137. https://doi.org/10.3390/d17020137
Tiedge TM, Rabasco JT, Meiklejohn KA. DNA Metabarcoding Using Indexed Primers: Workflow to Characterize Bacteria, Fungi, Plants, and Arthropods from Environmental Samples. Diversity. 2025; 17(2):137. https://doi.org/10.3390/d17020137
Chicago/Turabian StyleTiedge, Teresa M., Jorden T. Rabasco, and Kelly A. Meiklejohn. 2025. "DNA Metabarcoding Using Indexed Primers: Workflow to Characterize Bacteria, Fungi, Plants, and Arthropods from Environmental Samples" Diversity 17, no. 2: 137. https://doi.org/10.3390/d17020137
APA StyleTiedge, T. M., Rabasco, J. T., & Meiklejohn, K. A. (2025). DNA Metabarcoding Using Indexed Primers: Workflow to Characterize Bacteria, Fungi, Plants, and Arthropods from Environmental Samples. Diversity, 17(2), 137. https://doi.org/10.3390/d17020137