Antiwrinkle and Antimelanogenesis Effects of Tyndallized Lactobacillus acidophilus KCCM12625P
Abstract
1. Introduction
2. Results
2.1. In Vitro Antioxidant Effects of AL in Skin Cells
2.2. Antiwrinkle Effects of AL through Activation of the AP-1 Signaling Pathway in HaCaT Cells
2.3. Antiwrinkle Effects of AL in Human Dermal Fibroblast Cells
2.4. Antimelanogenesis Effects of AL in B16F10 Cells
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Cell Culture
4.3. ROS Generation Assay
4.4. MTT Assay
4.5. Radical-Scavenging Activity Assay
4.6. Elastase Inhibition Assay
4.7. RT-PCR
4.8. Western Blotting
4.9. ELISA
4.10. Tyrosinase Activity Assay
4.11. Melanin Generation Assay
4.12. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
Abbreviations
| UVR | Ultraviolet radiation |
| AP-1 | Activator protein 1 |
| ROS | Reactive oxygen species |
| PCR | Polymerase chain reaction |
| MMP | Matrix metalloproteinases |
| AL | Tyndallized Lactobacillus acidophilus |
| IL | Interleukin |
| KGF | Keratin growth factor |
| PKA | Protein kinase A |
| α-MSH | α-Melanocyte-stimulating hormone |
| CREB | cAMP response element binding |
| MITF | Microphthalmia-associated transcription factor |
| cAMP | Cyclic adenosine monophosphate |
References
- Kim, E.; Hwang, K.; Lee, J.; Han, S.Y.; Kim, E.M.; Park, J.; Cho, J.Y. Skin protective effect of epigallocatechin gallate. Int. J. Mol. Sci. 2018, 19, 173. [Google Scholar] [CrossRef] [PubMed]
- Perez Davo, A.; Truchuelo, M.T.; Vitale, M.; Gonzalez-Castro, J. Efficacy of an antiaging treatment against environmental factors: Deschampsia antarctica extract and high-tolerance retinoids combination. J. Clin. Aesthet Dermatol 2019, 12, E65–e70. [Google Scholar] [PubMed]
- Gao, W.; Lin, P.; Hwang, E.; Wang, Y.; Yan, Z.; Ngo, H.T.T.; Yi, T.H. Pterocarpus santalinus L. regulated ultraviolet B irradiation-induced procollagen reduction and matrix metalloproteinases expression through activation of TGF-beta/Smad and inhibition of the MAPK/AP-1 pathway in normal human dermal fibroblasts. Photochem. Photobiol. 2018, 94, 139–149. [Google Scholar] [CrossRef] [PubMed]
- Krutmann, J.; Bouloc, A.; Sore, G.; Bernard, B.A.; Passeron, T. The skin aging exposome. J. Dermatol. Sci. 2017, 85, 152–161. [Google Scholar] [CrossRef]
- Shin, M.H.; Moon, Y.J.; Seo, J.-E.; Lee, Y.; Kim, K.H.; Chung, J.H. Reactive oxygen species produced by NADPH oxidase, xanthine oxidase, and mitochondrial electron transport system mediate heat shock-induced MMP-1 and MMP-9 expression. Free Radic Biol. Med. 2008, 44, 635–645. [Google Scholar] [CrossRef]
- Pillai, S.; Oresajo, C.; Hayward, J. Ultraviolet radiation and skin aging: roles of reactive oxygen species, inflammation and protease activation, and strategies for prevention of inflammation-induced matrix degradation–a review. Int. J. Cosmetic Sci. 2005, 27, 17–34. [Google Scholar] [CrossRef]
- Lee, S.E.; Kwon, T.R.; Kim, J.H.; Lee, B.C.; Oh, C.T.; Im, M.; Hwang, Y.K.; Paik, S.H.; Han, S.; Kim, J.Y.; et al. Antiphotoaging and antioxidative activities of natural killer cell conditioned medium following UVB irradiation of human dermal fibroblasts and a reconstructed skin model. Int. J. Mol. Med. 2019, 44, 1641–1652. [Google Scholar]
- Helfrich, Y.R.; Sachs, D.L.; Voorhees, J.J. Overview of skin aging and photoaging. Dermatol. Nurs. 2008, 20, 177. [Google Scholar]
- Masaki, H. Role of antioxidants in the skin: anti-aging effects. J. Dermatol. Sci. 2010, 58, 85–90. [Google Scholar] [CrossRef]
- Poljšak, B.; Dahmane, R. Free radicals and extrinsic skin aging. Dermatol. Res. Prac. 2012, 2012. [Google Scholar] [CrossRef]
- Huang, H.-C.; Hsieh, W.-Y.; Niu, Y.-L.; Chang, T.-M. Inhibition of melanogenesis and antioxidant properties of Magnolia grandiflora L. flower extract. BMC Complement. Altern Med. 2012, 12, 72. [Google Scholar] [CrossRef]
- Lee, J.O.; Kim, E.; Kim, J.H.; Hong, Y.H.; Kim, H.G.; Jeong, D.; Kim, J.; Kim, S.H.; Park, C.; Seo, D.B.; et al. Antimelanogenesis and skin-protective activities of Panax ginseng calyx ethanol extract. J. Ginseng. Res. 2018, 42, 389–399. [Google Scholar] [CrossRef] [PubMed]
- Ayoub, N.A.; McGowen, M.R.; Clark, C.; Springer, M.S.; Gatesy, J. Evolution and phylogenetic utility of the melanocortin-1 receptor gene (MC1R) in Cetartiodactyla. Mol. Phylogenet. Evol. 2009, 52, 550–557. [Google Scholar] [CrossRef] [PubMed]
- D’Mello, S.A.; Finlay, G.J.; Baguley, B.C.; Askarian-Amiri, M.E. Signaling pathways in melanogenesis. Int J. Mol. Sci 2016, 17, 1144. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.; Kim, D.; Yoo, S.; Hong, Y.H.; Han, S.Y.; Jeong, S.; Jeong, D.; Kim, J.H.; Cho, J.Y.; Park, J. The skin protective effects of compound K, a metabolite of ginsenoside Rb1 from Panax ginseng. J. Ginseng. Res. 2018, 42, 218–224. [Google Scholar] [CrossRef]
- Pillaiyar, T.; Manickam, M.; Jung, S.H. Downregulation of melanogenesis: drug discovery and therapeutic options. Drug Discov. Today 2017, 22, 282–298. [Google Scholar] [CrossRef]
- Bravo, K.; Duque, L.; Ferreres, F.; Moreno, D.A.; Osorio, E. Passiflora tarminiana fruits reduce UVB-induced photoaging in human skin fibroblasts. J. Photochem. Photobiol. B. 2017, 168, 78–88. [Google Scholar] [CrossRef]
- Lin, T.Y.; Wu, P.Y.; Hou, C.W.; Chien, T.Y.; Chang, Q.X.; Wen, K.C.; Lin, C.Y.; Chiang, H.M. Protective effects of sesamin against UVB-induced skin inflammation and photodamage in vitro and in vivo. Biomolecules 2019, 9, 479. [Google Scholar] [CrossRef]
- Trevithick, J.R.; Xiong, H.; Lee, S.; Shum, D.T.; Sanford, S.E.; Karlik, S.J.; Norley, C.; Dilworth, G.R. Topical tocopherol acetate reduces post-UVB, sunburn-associated erythema, edema, and skin sensitivity in hairless mice. Arch. Biochem. Biophys. 1992, 296, 575–582. [Google Scholar] [CrossRef]
- Gange, R.W.; Blackett, A.D.; Matzinger, E.A.; Sutherland, B.M.; Kochevar, I.E. Comparative protection efficiency of UVA-and UVB-induced tans against erythema and formation of endonuclease-sensitive sites in DNA by UVB in human skin. J. Investig. Dermatol. 1985, 85, 362–364. [Google Scholar] [CrossRef][Green Version]
- Nikkola, V.; Grönroos, M.; Huotari-Orava, R.; Kautiainen, H.; Ylianttila, L.; Karppinen, T.; Partonen, T.; Snellman, E. Circadian time effects on NB-UVB-induced erythema in human skin in vivo. J. Investig. Dermatol. 2018, 138, 464. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez-Luna, A.; Ávila-Román, J.; González-Rodríguez, M.; Cózar, M.; Rabasco, A.; Motilva, V.; Talero, E. Fucoxanthin-containing cream prevents epidermal hyperplasia and UVB-induced skin erythema in mice. Mar. Drugs 2018, 16, 378. [Google Scholar] [CrossRef] [PubMed]
- Her, Y.; Shin, B.-N.; Lee, Y.L.; Park, J.H.; Kim, D.W.; Kim, K.S.; Kim, H.; Song, M.; Kim, J.-D.; Won, M.-H. Oenanthe javanica extract protects mouse skin from UVB radiation via attenuating collagen disruption and inflammation. Int. J. Mol. Sci. 2019, 20, 1435. [Google Scholar] [CrossRef] [PubMed]
- Kwon, K.-R.; Alam, M.B.; Park, J.-H.; Kim, T.-H.; Lee, S.-H. Attenuation of UVB-induced photo-aging by polyphenolic-rich Spatholobus suberectus stem extract via modulation of MAPK/AP-1/MMPs signaling in human keratinocytes. Nutrients 2019, 11, 1341. [Google Scholar] [CrossRef] [PubMed]
- Roudsari, M.R.; Karimi, R.; Sohrabvandi, S.; Mortazavian, A. Health effects of probiotics on the skin. Crit. Rev. Food Sci. Nutr. 2015, 55, 1219–1240. [Google Scholar] [CrossRef] [PubMed]
- Lolou, V.; Panayiotidis, M.I. Functional role of probiotics and prebiotics on skin health and disease. Fermentation 2019, 5, 41. [Google Scholar] [CrossRef]
- Ljungh, A.; Wadstrom, T. Lactic acid bacteria as probiotics. Cur. Issues Int. Microbiol. 2006, 7, 73–90. [Google Scholar]
- Le, L.T.H.L.; Yoo, W.; Jeon, S.; Kim, K.K.; Kim, T.D. Characterization and immobilization of a novel SGNH family esterase (LaSGNH1) from Lactobacillus acidophilus NCFM. Int. J. Mol. Sci. 2020, 21, 91. [Google Scholar] [CrossRef]
- Im, A.; Lee, B.; Kang, D.J.; Chae, S. Protective effects of tyndallized Lactobacillus acidophilus IDCC 3302 against UVB-induced photodamage to epidermal keratinocytes cells. Int. J. Mol. Med. 2019, 43, 2499–2506. [Google Scholar] [CrossRef]
- Im, A.-R.; Lee, B.; Kang, D.-J.; Chae, S. Skin moisturizing and antiphotodamage effects of tyndallized Lactobacillus acidophilus IDCC 3302. J. Med. Food 2018, 21, 1016–1023. [Google Scholar] [CrossRef]
- Im, A.; Kim, H.S.; Hyun, J.W.; Chae, S. Potential for tyndalized Lactobacillus acidophilus as an effective component in moisturizing skin and anti-wrinkle products. Exp. Ther Med. 2016, 12, 759–764. [Google Scholar] [CrossRef] [PubMed]
- Imokawa, G. Mechanism of UVB-induced wrinkling of the skin: paracrine cytokine linkage between keratinocytes and fibroblasts leading to the stimulation of elastase. In Journal of Investigative Dermatology Symposium Proceedings; Elsevier: Kidlington, UK, 2009; pp. 36–43. [Google Scholar]
- Park, E.; Lee, H.-J.; Lee, H.; Kim, J.-H.; Hwang, J.; Koo, J.; Kim, S.-H. The anti-wrinkle mechanism of melatonin in UVB treated HaCaT keratinocytes and hairless mice via inhibition of ROS and sonic hedgehog mediated inflammatory proteins. Int. J. Mol. Sci. 2018, 19, 1995. [Google Scholar] [CrossRef] [PubMed]
- Philips, N.; Gonzalez, S. Beneficial regulation of elastase activity and expression of tissue inhibitors of matrixmetalloproteinases, fibrillin, transforming growth factor-, and heat shock proteins by P. leucotomos in nonirradiated or ultraviolet-radiated epidermal keratinocytes. ISRN Oxid. Med. 2013, 2013. [Google Scholar] [CrossRef]
- Han, H.-S.; Shin, J.-S.; Myung, D.-B.; Ahn, H.S.; Lee, S.H.; Kim, H.J.; Lee, K.-T. Hydrangea serrata (Thunb.) Ser. extract attenuate UVB-induced photoaging through MAPK/AP-1 inactivation in human skin fibroblasts and hairless Mice. Nutrients 2019, 11, 533. [Google Scholar] [CrossRef] [PubMed]
- Pittayapruek, P.; Meephansan, J.; Prapapan, O.; Komine, M.; Ohtsuki, M. Role of matrix metalloproteinases in photoaging and photocarcinogenesis. Int. J. Mol. Sci. 2016, 17, 868. [Google Scholar] [CrossRef] [PubMed]
- Park, S.H.; Kim, D.S.; Kim, S.; Lorz, L.R.; Choi, E.; Lim, H.Y.; Hossain, M.A.; Jang, S.; Choi, Y.I.; Park, K.J. Loliolide presents antiapoptosis and antiscratching effects in human keratinocytes. Int. J. Mol. Sci. 2019, 20, 651. [Google Scholar] [CrossRef]
- Lorz, L.R.; Yoo, B.C.; Kim, M.-Y.; Cho, J.Y. Anti-wrinkling and anti-melanogenic effect of Pradosia mutisii methanol extract. Int. J. Mol. Sci. 2019, 20, 1043. [Google Scholar] [CrossRef]
- Kuršvietienė, L.; Stanevičienė, I.; Mongirdienė, A.; Bernatonienė, J. Multiplicity of effects and health benefits of resveratrol. Medicina 2016, 52, 148–155. [Google Scholar] [CrossRef]
- D’Orazio, J.; Jarrett, S.; Amaro-Ortiz, A.; Scott, T. UV radiation and the skin. Int. J. Mol. Sci. 2013, 14, 12222–12248. [Google Scholar] [CrossRef]
- Shin, D.; Lee, S.; Huang, Y.-H.; Lim, H.-W.; Lee, Y.; Jang, K.; Cho, Y.; Park, S.J.; Kim, D.-D.; Lim, C.-J. Protective properties of geniposide against UV-B-induced photooxidative stress in human dermal fibroblasts. Pharm. Biol. 2018, 56, 176–182. [Google Scholar] [CrossRef]
- Deng, M.; Li, D.; Zhang, Y.; Zhou, G.; Liu, W.; Cao, Y.; Zhang, W. Protective effect of crocin on ultraviolet B-induced dermal fibroblast photoaging. Mol. Med. Rep. 2018, 18, 1439–1446. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.K.; Bang, C.Y.; Yun, G.J.; Kim, H.-Y.; Jang, Y.P.; Choung, S.Y. Anti-wrinkle effects of Seungma-Galgeun-Tang as evidenced by the inhibition of matrix metalloproteinase-I production and the promotion of type-1 procollagen synthesis. BMC Complement. Altern Med. 2016, 16, 116. [Google Scholar] [CrossRef] [PubMed]
- Tong, T.; Park, J.; Moon, Y.; Kang, W.; Park, T. α-Ionone protects against UVB-induced photoaging in human dermal fibroblasts. Molecules 2019, 24, 1804. [Google Scholar] [CrossRef] [PubMed]
- Cavinato, M.; Waltenberger, B.; Baraldo, G.; Grade, C.V.; Stuppner, H.; Jansen-Dürr, P. Plant extracts and natural compounds used against UVB-induced photoaging. Biogerontology 2017, 18, 499–516. [Google Scholar] [CrossRef]
- Wang, X.; Yan, M.; Wang, Q.; Wang, H.; Wang, Z.; Zhao, J.; Li, J.; Zhang, Z. In vitro DNA-binding, anti-oxidant and anticancer activity of indole-2-carboxylic acid dinuclear copper (II) complexes. Molecules 2017, 22, 171. [Google Scholar] [CrossRef]
- Mareček, V.; Mikyška, A.; Hampel, D.; Čejka, P.; Neuwirthová, J.; Malachová, A.; Cerkal, R. ABTS and DPPH methods as a tool for studying antioxidant capacity of spring barley and malt. J. Cereal. Sci. 2017, 73, 40–45. [Google Scholar] [CrossRef]
- Bernini, R.; Barontini, M.; Cis, V.; Carastro, I.; Tofani, D.; Chiodo, R.; Lupattelli, P.; Incerpi, S. Synthesis and evaluation of the antioxidant activity of lipophilic phenethyl trifluoroacetate esters by in vitro ABTS, DPPH and in cell-culture DCF assays. Molecules 2018, 23, 208. [Google Scholar] [CrossRef]
- Subedi, L.; Lee, T.H.; Wahedi, H.M.; Baek, S.-H.; Kim, S.Y. Resveratrol-enriched rice attenuates UVB-ROS-induced skin aging via downregulation of inflammatory cascades. Oxid Med. Cell Longev. 2017, 2017. [Google Scholar] [CrossRef]
- Ganceviciene, R.; Liakou, A.I.; Theodoridis, A.; Makrantonaki, E.; Zouboulis, C.C. Skin anti-aging strategies. Dermato-endocrinology 2012, 4, 308–319. [Google Scholar] [CrossRef]
- Stout, R.; Birch-Machin, M. Mitochondria’s role in skin ageing. Biology 2019, 8, 29. [Google Scholar] [CrossRef]
- Lintner, K. Benefits of anti-aging actives in sunscreens. Cosmetics 2017, 4, 7. [Google Scholar] [CrossRef]
- Lee, S.Y. Synergistic effect of maclurin on ginsenoside compound K induced inhibition of the transcriptional expression of matrix metalloproteinase-1 in HaCaT human keratinocyte cells. J. Ginseng Res. 2018, 42, 229–232. [Google Scholar] [CrossRef] [PubMed]
- Tu, Y.; Quan, T. Oxidative stress and human skin connective tissue aging. Cosmetics 2016, 3, 28. [Google Scholar] [CrossRef]
- Kim, E.; Kang, Y.G.; Kim, J.H.; Kim, Y.J.; Lee, T.R.; Lee, J.; Kim, D.; Cho, J.Y. The antioxidant and anti-inflammatory activities of 8-hydroxydaidzein (8-HD) in activated macrophage-like RAW264.7 cells. Int. J. Mol. Sci. 2018, 19. [Google Scholar] [CrossRef]
- Choi, E.; Kim, E.; Kim, J.H.; Yoon, K.; Kim, S.; Lee, J.; Cho, J.Y. AKT1-targeted proapoptotic activity of compound K in human breast cancer cells. J. Ginseng. Res. 2019, 43, 692–698. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.O.; Choi, E.; Shin, K.K.; Hong, Y.H.; Kim, H.G.; Jeong, D.; Hossain, M.A.; Kim, H.S.; Yi, Y.S.; Kim, D.; et al. Compound K, a ginsenoside metabolite, plays an antiinflammatory role in macrophages by targeting the AKT1-mediated signaling pathway. J. Ginseng. Res. 2019, 43, 154–160. [Google Scholar] [CrossRef]







| Gene | Direction | Sequence (5’ to 3’) |
| MMP-1 | Forward | TCTGACGTTGATCCCAGAGAGCAG |
| Reverse | CAGGGTGACACCAGTGACTGCAC | |
| MMP-2 | Forward | AAAACGGACAAAGAGTTGGCA |
| Reverse | CTGGGGCAGTCCAAAGAACT | |
| MMP-3 | Forward | TGTTAGGAGAAAGGACAGTGGTC |
| Reverse | CGTCACCTCCAATCCAAGGAA | |
| MMP-9 | Forward | GCCACTTGTCGGCGATAAGG |
| Reverse | TCGCGGGAAGAATAGGATTGG | |
| SIRT-1 | Forward | TCGCAACTATACCCAGAACATAGACA |
| Reverse | CTGTTGCAAAGGAACCATGACA | |
| COL1A1 | Forward | AGGGCCAAGACGAAGACATC |
| Reverse | AGATCACGTCATCGCACAACA | |
| Tyrosinase | Forward | GTCCACTCACAGGGATAGCAG |
| Reverse | AGAGTCTCTGTTATGGCCGA | |
| TYRP-1 | Forward | ATGGAACGGGAGGACAAACC |
| Reverse | TCCTGACCTGGCCATTGAAC | |
| TYRP-2 | Forward | CAGTTTCCCCGAGTCTGCAT |
| Reverse | GTCTAAGGCGCCCAAGAACT | |
| GAPDH | Forward | ACCACAGTCCATGCCATCAC |
| Reverse | CCACCACCCTGTTGCTGTAG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lim, H.Y.; Jeong, D.; Park, S.H.; Shin, K.K.; Hong, Y.H.; Kim, E.; Yu, Y.-G.; Kim, T.-R.; Kim, H.; Lee, J.; et al. Antiwrinkle and Antimelanogenesis Effects of Tyndallized Lactobacillus acidophilus KCCM12625P. Int. J. Mol. Sci. 2020, 21, 1620. https://doi.org/10.3390/ijms21051620
Lim HY, Jeong D, Park SH, Shin KK, Hong YH, Kim E, Yu Y-G, Kim T-R, Kim H, Lee J, et al. Antiwrinkle and Antimelanogenesis Effects of Tyndallized Lactobacillus acidophilus KCCM12625P. International Journal of Molecular Sciences. 2020; 21(5):1620. https://doi.org/10.3390/ijms21051620
Chicago/Turabian StyleLim, Hye Yeon, Deok Jeong, Sang Hee Park, Kon Kuk Shin, Yo Han Hong, Eunji Kim, Yeong-Gyeong Yu, Tae-Rahk Kim, Hun Kim, Jongsung Lee, and et al. 2020. "Antiwrinkle and Antimelanogenesis Effects of Tyndallized Lactobacillus acidophilus KCCM12625P" International Journal of Molecular Sciences 21, no. 5: 1620. https://doi.org/10.3390/ijms21051620
APA StyleLim, H. Y., Jeong, D., Park, S. H., Shin, K. K., Hong, Y. H., Kim, E., Yu, Y.-G., Kim, T.-R., Kim, H., Lee, J., & Cho, J. Y. (2020). Antiwrinkle and Antimelanogenesis Effects of Tyndallized Lactobacillus acidophilus KCCM12625P. International Journal of Molecular Sciences, 21(5), 1620. https://doi.org/10.3390/ijms21051620

