Gingival Response to Dental Implant: Comparison Study on the Effects of New Nanopored Laser-Treated vs. Traditional Healing Abutments
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Patient Selection
4.2. Surgical Treatment
4.3. Specimen Retrieval and Analyses
4.4. RNA Extraction and Reverse Transcription
4.5. Quantitative Real Time PCR (qPCR)
4.6. Immunohistochemical Analyses
4.7. Scanning Electron Microscopy Analysis
4.8. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Moraschini, V.; da C. Poubel, L.A.; Ferreira, V.F.; dos S.P. Barboza, E. Evaluation of survival and success rates of dental implants reported in longitudinal studies with a follow-up period of at least 10 years: A systematic review. Int. J. Oral Maxillofac. Surg. 2015, 44, 377–388. [Google Scholar] [CrossRef] [PubMed]
- Sinjari, B.; D’Addazio, G.; Bozzi, M.; Santilli, M.; Traini, T.; Murmura, G.; Caputi, S. SEM Analysis of Enamel Abrasion after Air Polishing Treatment with Erythritol, Glycine and Sodium Bicarbonate. Coatings 2019, 9, 549. [Google Scholar] [CrossRef]
- Traini, T.; Sinjari, B.; Pascetta, R.; Serafini, N.; Perfetti, G.; Trisi, P.; Caputi, S. The zirconia-reinforced lithium silicate ceramic: Lights and shadows of a new material. Dent. Mater. J. 2016, 35, 748–755. [Google Scholar] [CrossRef] [PubMed]
- Schwarz, F.; Derks, J.; Monje, A.; Wang, H.-L. Peri-implantitis. J. Periodontol. 2018, 89, S267–S290. [Google Scholar] [CrossRef]
- Tomasi, C.; Tessarolo, F.; Caola, I.; Piccoli, F.; Wennström, J.L.; Nollo, G.; Berglundh, T. Early healing of peri-implant mucosa in man. J. Clin. Periodontol. 2016, 43, 816–824. [Google Scholar] [CrossRef] [PubMed]
- D’Ercole, S.; D’Addazio, G.; Di Lodovico, S.; Traini, T.; Di Giulio, M.; Sinjari, B. Porphyromonas Gingivalis Load is Balanced by 0.20% Chlorhexidine Gel. A Randomized, Double-Blind, Controlled, Microbiological and Immunohistochemical Human Study. J. Clin. Med. 2020, 9, 284. [Google Scholar] [CrossRef] [PubMed]
- Di Mauro, M.; Izzicupo, P.; Santarelli, F.; Falone, S.; Pennelli, A.; Amicarelli, F.; Calafiore, A.M.; Di Baldassarre, A.; Gallina, S. ACE and AGTR1 Polymorphisms and Left Ventricular Hypertrophy in Endurance Athletes. Med. Sci. Sports Exerc. 2010, 42, 915–921. [Google Scholar] [CrossRef]
- Ghinassi, B.; D’Addazio, G.; Di Baldassarre, A.; Femminella, B.; Di Vincenzo, G.; Piattelli, M.; Gaggi, G.; Sinjari, B. Immunohistochemical Results of Soft Tissues around a New Implant Healing-Abutment Surface: A Human Study. J. Clin. Med. 2020, 9, 1009. [Google Scholar] [CrossRef]
- Sinjari, B.; Guarnieri, S.; Diomede, F.; Merciaro, I.; Mariggio, M.A.; Caputi, S.; Trubiani, O. Influence of titanium laser surface geometry on proliferation and on morphological features of human mandibular primary osteoblasts. J. Biol. Regul. Homeost. Agents 2012, 26, 505–513. [Google Scholar]
- Petkovic-Curcin, A.; Matic, S.; Vojvodic, D.; Stamatovic, N.; Todorovic, T. Cytokines in pathogenesis of peri-implantitis. Vojnosanit. Pregl. 2011, 68, 435–440. [Google Scholar] [CrossRef]
- Takeuchi, Y.; Sakurai, K.; Ike, I.; Yoshie, H.; Kawasaki, K.; Hara, K. ICAM-1-expressing pocket epithelium, LFA-1-expressing T cells in gingival tissue and gingival crevicular fluid as features characterizing inflammatory cell invasion and exudation in adult periodontitis. J. Periodontal Res. 1995, 30, 426–435. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, M. Histological and immunological characteristics of the junctional epithelium. Jpn. Dent. Sci. Rev. 2018, 54, 59–65. [Google Scholar] [CrossRef] [PubMed]
- Filardi, T.; Ghinassi, B.; Di Baldassarre, A.; Tanzilli, G.; Morano, S.; Lenzi, A.; Basili, S.; Crescioli, C. Cardiomyopathy Associated with Diabetes: The Central Role of the Cardiomyocyte. Int. J. Mol. Sci. 2019, 20, 3299. [Google Scholar] [CrossRef] [PubMed]
- Alassy, H.; Parachuru, P.; Wolff, L. Peri-Implantitis Diagnosis and Prognosis Using Biomarkers in Peri-Implant Crevicular Fluid: A Narrative Review. Diagnostics 2019, 9, 214. [Google Scholar] [CrossRef]
- Delclaux, C.; Delacourt, C.; D’Ortho, M.P.; Boyer, V.; Lafuma, C.; Harf, A. Role of gelatinase B and elastase in human polymorphonuclear neutrophil migration across basement membrane. Am. J. Respir. Cell Mol. Biol. 1996, 14, 288–295. [Google Scholar] [CrossRef]
- Fioruci-Fontanelli, B.A.; Chuffa, L.G.A.; Mendes, L.O.; Pinheiro, P.F.F.; Delella, F.K.; Kurokawa, C.S.; Felisbino, S.L.; Martinez, F.E. MMP-2 and MMP-9 Activities and TIMP-1 and TIMP-2 Expression in the Prostatic Tissue of Two Ethanol-Preferring Rat Models. Anal. Cell. Pathol. 2015, 2015, 1–7. [Google Scholar] [CrossRef]
- Nomura, T.; Ishii, A.; Shimizu, H.; Taguchi, N.; Yoshie, H.; Kusakari, H.; Hara, K. Tissue inhibitor of metalloproteinases-1, matrix metalloproteinases-1 and -8, and collagenase activity levels in peri-implant crevicular fluid after implantation. Clin. Oral Implants Res. 2000, 11, 430–440. [Google Scholar] [CrossRef]
- Brennan, F.M.; Green, P.; Amjadi, P.; Robertshaw, H.J.; Alvarez-Iglesias, M.; Takata, M. Interleukin-10 regulates TNF-α−converting enzyme (TACE/ADAM-17) involving a TIMP-3 dependent and independent mechanism. Eur. J. Immunol. 2008, 38, 1106–1117. [Google Scholar] [CrossRef]
- Ghinassi, B.; Ferro, L.; Masiello, F.; Tirelli, V.; Sanchez, M.; Migliaccio, G.; Whitsett, C.; Kachala, S.; Riviere, I.; Sadelain, M.; et al. Recovery and Biodistribution of Ex Vivo Expanded Human Erythroblasts Injected into NOD/SCID/IL2R γ null mice. Stem Cells Int. 2011, 2011, 1–13. [Google Scholar] [CrossRef]
- Patil, S.; Ganavi, B. Oral Cytokeratins in Health and Disease. J. Contemp. Dent. Pract. 2014, 15, 127–136. [Google Scholar] [CrossRef]
- Prabakaran, S.; Muthukrishnan, A. Expression of cytokeratin 18 and 19 in oral potentially malignant disorders: A systematic review. J. Indian Acad. Oral Med. Radiol. 2014, 26, 173. [Google Scholar] [CrossRef]
- Jiang, Q.; Yu, Y.; Ruan, H.; Luo, Y.; Guo, X. Morphological and functional characteristics of human gingival junctional epithelium. BMC Oral Health 2014, 14. [Google Scholar] [CrossRef] [PubMed]
- Delva, E.; Jennings, J.M.; Calkins, C.C.; Kottke, M.D.; Faundez, V.; Kowalczyk, A.P. Pemphigus Vulgaris IgG-induced Desmoglein-3 Endocytosis and Desmosomal Disassembly Are Mediated by a Clathrin- and Dynamin-independent Mechanism. J. Biol. Chem. 2008, 283, 18303–18313. [Google Scholar] [CrossRef] [PubMed]
- Mangano, C.; Mangano, F.; Shibli, J.; Roth, L.; d’ Addazio, G.; Piattelli, A.; Iezzi, G. Immunohistochemical Evaluation of Peri-Implant Soft Tissues around Machined and Direct Metal Laser Sintered (DMLS) Healing Abutments in Humans. Int. J. Environ. Res. Public. Health 2018, 15, 1611. [Google Scholar] [CrossRef] [PubMed]
- Sinjari, B.; Traini, T.; Caputi, S.; Mortellaro, C.; Scarano, A. Evaluation of Fibrin Clot Attachment on Titanium Laser-Conditioned Surface Using Scanning Electron Microscopy. J. Craniofac. Surg. 2018, 29, 2277–2281. [Google Scholar] [CrossRef] [PubMed]
- Iglhaut, G.; Schwarz, F.; Winter, R.R.; Mihatovic, I.; Stimmelmayr, M.; Schliephake, H. Epithelial Attachment and Downgrowth on Dental Implant Abutments-A Comprehensive Review: Epithelial Attachment and Downgrowth on Dental Implant Abutments. J. Esthet. Restor. Dent. 2014, 26, 324–331. [Google Scholar] [CrossRef]
- Gittens, R.A.; Scheideler, L.; Rupp, F.; Hyzy, S.L.; Geis-Gerstorfer, J.; Schwartz, Z.; Boyan, B.D. A review on the wettability of dental implant surfaces II: Biological and clinical aspects. Acta Biomater. 2014, 10, 2907–2918. [Google Scholar] [CrossRef]
- Ma, Q.; Wang, W.; Chu, P.K.; Mei, S.; Ji, K.; Jin, L.; Zhang, Y. Concentration- and time-dependent response of human gingival fibroblasts to fibroblast growth factor 2 immobilized on titanium dental implants. Int. J. Nanomed. 2012, 7, 1965–1976. [Google Scholar] [CrossRef]
- Sugawara, S.; Maeno, M.; Lee, C.; Nagai, S.; Kim, D.M.; Da Silva, J.; Nagai, M.; Kondo, H. Establishment of Epithelial Attachment on Titanium Surface Coated with Platelet Activating Peptide. PLoS ONE 2016, 11, e0164693. [Google Scholar] [CrossRef]
- van Dijk, I.A.; Beker, A.F.; Jellema, W.; Nazmi, K.; Wu, G.; Wismeijer, D.; Krawczyk, P.M.; Bolscher, J.G.M.; Veerman, E.C.I.; Stap, J. Histatin 1 Enhances Cell Adhesion to Titanium in an Implant Integration Model. J. Dent. Res. 2017, 96, 430–436. [Google Scholar] [CrossRef]
- Di Baldassarre, A.; Cimetta, E.; Bollini, S.; Gaggi, G.; Ghinassi, B. Human-Induced Pluripotent Stem Cell Technology and Cardiomyocyte Generation: Progress and Clinical Applications. Cells 2018, 7, 48. [Google Scholar] [CrossRef] [PubMed]
- Berardi, D.; Colagiovanni, M.; Scoccia, A.; Raffaelli, L.; Manicone, P.F.; Perfetti, G. Evaluation of a new laser surface implant: Scanning electron microscopy/energy dispersive X-ray and X-ray photoelectron spectroscopy analyses. J. Biol. Regul. Homeost. Agents 2008, 22, 161–167. [Google Scholar] [PubMed]
- Tan, J.; Saltzman, W.M. Biomaterials with hierarchically defined micro- and nanoscale structure. Biomaterials 2004, 25, 3593–3601. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.-C.; Liu, C.-M.; Jeng, J.-H.; Ku, C.-C. Association of pocket epithelial cell proliferation in periodontitis with TLR9 expression and inflammatory response. J. Formos. Med. Assoc. 2014, 113, 549–556. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Mariani, E.; Lisignoli, G.; Borzì, R.M.; Pulsatelli, L. Biomaterials: Foreign Bodies or Tuners for the Immune Response? Int. J. Mol. Sci. 2019, 20, 636. [Google Scholar] [CrossRef]
- Liu, X.; Li, M.; Zhu, Y.; Yeung, K.W.K.; Chu, P.K.; Wu, S. The modulation of stem cell behaviors by functionalized nanoceramic coatings on Ti-based implants. Bioact. Mater. 2016, 1, 65–76. [Google Scholar] [CrossRef]
- Ozdemir, T.; Bowers, D.T.; Zhan, X.; Ghosh, D.; Brown, J.L. Identification of Key Signaling Pathways Orchestrating Substrate Topography Directed Osteogenic Differentiation Through High-Throughput siRNA Screening. Sci. Rep. 2019, 9, 1001. [Google Scholar] [CrossRef]
- Branton, M.H.; Kopp, J.B. TGF-β and fibrosis. Microbes Infect. 1999, 1, 1349–1365. [Google Scholar] [CrossRef]
- Ogawa, K.; Chen, F.; Kuang, C.; Chen, Y. Suppression of matrix metalloproteinase-9 transcription by transforming growth factor-β is mediated by a nuclear factor-κB site. Biochem. J. 2004, 381, 413–422. [Google Scholar] [CrossRef]
- Garlet, G.P.; Martins, W.; Fonseca, B.A.L.; Ferreira, B.R.; Silva, J.S. Matrix metalloproteinases, their physiological inhibitors and osteoclast factors are differentially regulated by the cytokine profile in human periodontal disease. J. Clin. Periodontol. 2004, 31, 671–679. [Google Scholar] [CrossRef]
- Crawford, J.M. Distribution of ICAM-1, LFA-3 and HLA-DR in healthy and diseased gingival tissues. J. Periodontal Res. 1992, 27, 291–298. [Google Scholar] [CrossRef] [PubMed]
- Grivennikov, S.I.; Tumanov, A.V.; Liepinsh, D.J.; Kruglov, A.A.; Marakusha, B.I.; Shakhov, A.N.; Murakami, T.; Drutskaya, L.N.; Förster, I.; Clausen, B.E.; et al. Distinct and Nonredundant In Vivo Functions of TNF Produced by T Cells and Macrophages/Neutrophils. Immunity 2005, 22, 93–104. [Google Scholar] [CrossRef] [PubMed]
- Antonucci, I.; Di Pietro, R.; Alfonsi, M.; Centurione, M.A.; Centurione, L.; Sancilio, S.; Pelagatti, F.; D’amico, M.A.; Di Baldassarre, A.; Piattelli, A.; et al. Human Second Trimester Amniotic Fluid Cells are Able to Create Embryoid Body-Like Structures in Vitro and to Show Typical Expression Profiles of Embryonic and Primordial Germ Cells. Cell Transplant. 2014, 23, 1501–1515. [Google Scholar] [CrossRef] [PubMed]
- Di Baldassarre, A.; D’Amico, M.A.; Izzicupo, P.; Gaggi, G.; Guarnieri, S.; Mariggiò, M.A.; Antonucci, I.; Corneo, B.; Sirabella, D.; Stuppia, L.; et al. Cardiomyocytes Derived from Human CardiopoieticAmniotic Fluids. Sci. Rep. 2018, 8, 12028. [Google Scholar] [CrossRef]
- Pritlove-Carson, S.; Charlesworth, S.; Morgan, P.; Palmer, R. Cytokeratin phenotypes at the dento-gingival junction in relative health and inflammation, in smokers and non-smokers. Oral Dis. 2008, 3, 19–24. [Google Scholar] [CrossRef]
- Migliaccio, A.R.; Martelli, F.; Verrucci, M.; Sanchez, M.; Valeri, M.; Migliaccio, G.; Vannucchi, A.M.; Zingariello, M.; Di Baldassarre, A.; Ghinassi, B.; et al. Gata1 expression driven by the alternative HS2 enhancer in the spleen rescues the hematopoietic failure induced by the hypomorphic Gata1low mutation. Blood 2009, 114, 2107–2120. [Google Scholar] [CrossRef]
- Nagarakanti, S.; Ramya, S.; Babu, P.; Arun, K.V.; Sudarsan, S. Differential Expression of E-Cadherin and Cytokeratin 19 and Net Proliferative Rate of Gingival Keratinocytes in Oral Epithelium in Periodontal Health and Disease. J. Periodontol. 2007, 78, 2197–2202. [Google Scholar] [CrossRef]
- Larouche, D.; Hayward, C.; Cuffley, K.; Germain, L. Keratin 19 as a Stem Cell Marker In Vivo and In Vitro. In Epidermal Cells; Humana Press: Totowa, NJ, USA, 2004; Volume 289, pp. 103–110. ISBN 978-1-59259-830-4. [Google Scholar]
- Hatakeyama, S.; Yaegashi, T.; Oikawa, Y.; Fujiwara, H.; Mikami, T.; Takeda, Y.; Satoh, M. Expression pattern of adhesion molecules in junctional epithelium differs from that in other gingival epithelia. J. Periodontal Res. 2006, 41, 322–328. [Google Scholar] [CrossRef]
- Izzicupo, P.; D’Amico, M.A.; Bascelli, A.; Di Fonso, A.; D’Angelo, E.; Di Blasio, A.; Bucci, I.; Napolitano, G.; Gallina, S.; Di Baldassarre, A. Walking training affects dehydroepiandrosterone sulfate and inflammation independent of changes in spontaneous physical activity. Menopause J. North Am. Menopause Soc. 2012, 1. [Google Scholar] [CrossRef]
- Abrahamsson, I.; Zitzmann, N.U.; Berglundh, T.; Linder, E.; Wennerberg, A.; Lindhe, J. The mucosal attachment to titanium implants with different surface characteristics: An experimental study in dogs. J. Clin. Periodontol. 2002, 29, 448–455. [Google Scholar] [CrossRef]
- Kloss, F.R.; Steinmüller-Nethl, D.; Stigler, R.G.; Ennemoser, T.; Rasse, M.; Hächl, O. In vivo investigation on connective tissue healing to polished surfaces with different surface wettability: Connective tissue healing at different surface wettabilities. Clin. Oral Implants Res. 2011, 22, 699–705. [Google Scholar] [CrossRef] [PubMed]
- Sanz-Martín, I.; Sanz-Sánchez, I.; Carrillo de Albornoz, A.; Figuero, E.; Sanz, M. Effects of modified abutment characteristics on peri-implant soft tissue health: A systematic review and meta-analysis. Clin. Oral Implants Res. 2018, 29, 118–129. [Google Scholar] [CrossRef] [PubMed]
- Quirynen, M.; Van Der Mei, H.C.; Bollen, C.M.L.; Schotte, A.; Marechal, M.; Doornbusch, G.I.; Naert, I.; Busscher, H.J.; Van Steenberghe, D. An in vivo Study of the Influence of the Surface Roughness of Implants on the Microbiology of Supra- and Subgingival Plaque. J. Dent. Res. 1993, 72, 1304–1309. [Google Scholar] [CrossRef] [PubMed]
- Teughels, W.; Van Assche, N.; Sliepen, I.; Quirynen, M. Effect of material characteristics and/or surface topography on biofilm development. Clin. Oral Implants Res. 2006, 17, 68–81. [Google Scholar] [CrossRef]
- Albrektsson, T.; Canullo, L.; Cochran, D.; De Bruyn, H. “Peri-Implantitis”: A Complication of a Foreign Body or a Man-Made “Disease”. Facts and Fiction: Peri-Implantitis: Facts and Fiction. Clin. Implant Dent. Relat. Res. 2016, 18, 840–849. [Google Scholar] [CrossRef]
- Di Giulio, M.; Traini, T.; Sinjari, B.; Nostro, A.; Caputi, S.; Cellini, L. Porphyromonas gingivalis biofilm formation in different titanium surfaces, an in vitro study. Clin. Oral Implants Res. 2016, 27, 918–925. [Google Scholar] [CrossRef]
- Canullo, L.; Tallarico, M.; Gracis, S.; Vela, X.; Rodriguez, X.; Covani, U. Clinical Considerations on Strategies That Avoid Multiple Connections and Disconnections of Implant Abutments. Int. J. Periodontics Restor. Dent. 2020, 40, 9–17. [Google Scholar] [CrossRef]
- Jiang, Y.; Jakovcevski, M.; Bharadwaj, R.; Connor, C.; Schroeder, F.A.; Lin, C.L.; Straubhaar, J.; Martin, G.; Akbarian, S. Setdb1 Histone Methyltransferase Regulates Mood-Related Behaviors and Expression of the NMDA Receptor Subunit NR2B. J. Neurosci. 2010, 30, 7152–7167. [Google Scholar] [CrossRef]
- D’amico, M.A.; Ghinassi, B.; Izzicupo, P.; Di Ruscio, A.; Di Baldassarre, A. IL-6 Activates PI3K and PKCζ Signaling and Determines Cardiac Differentiation in Rat Embryonic H9c2 Cells: IL-6 and Cardiac Differentiation of H9c2 Cells. J. Cell. Physiol. 2016, 231, 576–586. [Google Scholar] [CrossRef]
- Martelli, F.; Ghinassi, B.; Lorenzini, R.; Vannucchi, A.M.; Rana, R.A.; Nishikawa, M.; Partamian, S.; Migliaccio, G.; Migliaccio, A.R. Thrombopoietin Inhibits Murine Mast Cell Differentiation. Stem Cells 2008, 26, 912–919. [Google Scholar] [CrossRef][Green Version]
- Sinjari, B.; D’Addazio, G.; Traini, T.; Varvara, G.; Scarano, A.; Murmura, G.; Caputi, S. A 10-year retrospective comparative human study on screw-retained versus cemented dental implant abutments. J. Biol. Regul. Homeost. Agents 2019, 33, 787–797. [Google Scholar] [PubMed]
- Di Mauro, M.; Gallina, S.; D’Amico, M.A.; Izzicupo, P.; Lanuti, P.; Bascelli, A.; Di Fonso, A.; Bartoloni, G.; Calafiore, A.M.; Di Baldassarre, A. Functional mitral regurgitation. Int. J. Cardiol. 2013, 163, 242–248. [Google Scholar] [CrossRef] [PubMed]






| Epithelium | Subepithelial Connective Tissue | |||
|---|---|---|---|---|
| Machined-Surface | Laser Treated Surface | Machined-Surface | Laser Treated Surface | |
| Inflammatory Markers | ||||
| MMP-9 | 13.8 ± 2.1 | 1.4 ± 1.1 * | 41.1 ± 9.2 | 2.3 ± 1.1 * |
| ICAM-1 | 76.8 ± 8.1 | 23.1 ± 5.9 * | 75.1 ± 6.3 | 7.0 ± 1.2 * |
| Structural Proteins of keratinocytes | ||||
| CK-18 | 80.3 ± 6.5 | 8.1 ± 1.3 * | - | - |
| CK-19 | 84.1 ± 8.3 | 4.6 ± 3.4 * | - | - |
| DSG-3 | 14.2 ± 4.2 | 86.7 ± 6.1 * | ||
| Gene | Sequence (5’ to 3’) |
|---|---|
| MMP9 FW | CGCAGACATCGTCATCCAGT |
| MMP9 RW | GGACCACAACTCGTCATCGT |
| TIMP1 FW | CTGTTGGCTGTGAGGAATGC |
| TIMP1 RW | CGGGACTGGAAGCCCTTTTC |
| IL-10 FW | GTGAAAACAAGAGCAAGGCCG |
| IL-10 RW | GCCACCCTGATGTCTCAGTTT |
| TNF-α FW | ATGAGCACTGAAAGCATGATCC |
| TNF-α RW | GAGGGCTGATTAGAGAGAGGTC |
| 18S FW [59] | CATGGCCGTTCTTAGTTGGT |
| 18S RW [59] | CGCTGAGCCAGTCAGTGTAG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ghinassi, B.; Di Baldassarre, A.; D’Addazio, G.; Traini, T.; Andrisani, M.; Di Vincenzo, G.; Gaggi, G.; Piattelli, M.; Caputi, S.; Sinjari, B. Gingival Response to Dental Implant: Comparison Study on the Effects of New Nanopored Laser-Treated vs. Traditional Healing Abutments. Int. J. Mol. Sci. 2020, 21, 6056. https://doi.org/10.3390/ijms21176056
Ghinassi B, Di Baldassarre A, D’Addazio G, Traini T, Andrisani M, Di Vincenzo G, Gaggi G, Piattelli M, Caputi S, Sinjari B. Gingival Response to Dental Implant: Comparison Study on the Effects of New Nanopored Laser-Treated vs. Traditional Healing Abutments. International Journal of Molecular Sciences. 2020; 21(17):6056. https://doi.org/10.3390/ijms21176056
Chicago/Turabian StyleGhinassi, Barbara, Angela Di Baldassarre, Gianmaria D’Addazio, Tonino Traini, Mauro Andrisani, Giorgio Di Vincenzo, Giulia Gaggi, Maurizio Piattelli, Sergio Caputi, and Bruna Sinjari. 2020. "Gingival Response to Dental Implant: Comparison Study on the Effects of New Nanopored Laser-Treated vs. Traditional Healing Abutments" International Journal of Molecular Sciences 21, no. 17: 6056. https://doi.org/10.3390/ijms21176056
APA StyleGhinassi, B., Di Baldassarre, A., D’Addazio, G., Traini, T., Andrisani, M., Di Vincenzo, G., Gaggi, G., Piattelli, M., Caputi, S., & Sinjari, B. (2020). Gingival Response to Dental Implant: Comparison Study on the Effects of New Nanopored Laser-Treated vs. Traditional Healing Abutments. International Journal of Molecular Sciences, 21(17), 6056. https://doi.org/10.3390/ijms21176056

