A New Hybrid δ-Lactone Induces Apoptosis and Potentiates Anticancer Activity of Taxol in HL-60 Human Leukemia Cells
Abstract
1. Introduction
2. Results
2.1. Chemistry
2.2. Biology
2.2.1. Metabolic Activity and Cell Proliferation
2.2.2. Induction of Apoptosis
2.2.3. Activation of Caspases
2.2.4. Involvement of the Intrinsic Pathway of Apoptosis
2.2.5. Involvement of the Extrinsic Pathway of Apoptosis
2.2.6. Synergistic Effects of DL-247 and Anticancer Drugs
3. Discussion
4. Materials and Methods
4.1. Synthesis of DL-247
4.2. Cell Culture and Treatment
4.3. Metabolic Activity Assay (MTT)
4.4. Annexin V-FITC/PI Assay
4.5. Tunel Assay
4.6. Caspase 3, Caspase 8, and Caspase 9 Activity
4.7. Mitochondrial Membrane Potential Changes
4.8. Determination of Reactive Oxygen Species (ROS)
4.9. Real-Time PCR
4.10. Human Factor-Related Apoptosis (FAS) Detection by ELISA Assay
4.11. Analysis of Cell Proliferation, Apoptosis, and DNA Damage by Flow Cytometry
4.12. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Saklani, A.; Kutty, S.K. Plant-derived compounds in clinical trials. Drug Discov. Today 2008, 13, 161–171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Riveiro, M.E.; De Kimpe, N.; Moglioni, A.; Vázquez, R.; Monczor, F.; Shayo, C.; Davio, C. Coumarins: Old compounds with novel promising therapeutic perspectives. Curr. Med. Chem. 2010, 17, 1325–1338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Venugopala, K.N.; Rashmi, V.; Odhav, B. Review on natural coumarin lead compounds for their pharmacological activity. Biomed. Res. Int. 2013, 2013, 963248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marshall, M.E.; Kervin, K.; Benefield, C.; Umerani, A.; Albainy-Jenei, S.; Zhao, Q.; Khazaeli, M.B. Growth-inhibitory effects of coumarin (1,2-benzopyrone) and 7-hydroxycoumarin on human malignant cell lines in vitro. J. Cancer Res. Clin. Oncol. 1994, 120, S3–S10. [Google Scholar] [CrossRef] [Scilit]
- Riveiro, M.E.; Vazquez, R.; Moglioni, A.; Gomez, N.; Baldi, A.; Davio, C.; Shayo, C. Biochemical mechanisms underlying the pro-apoptotic activity of 7,8-dihydroxy-4-methylcoumarin in human leukemic cells. Biochem. Pharmacol. 2008, 75, 725–736. [Google Scholar] [CrossRef] [Scilit]
- Nasr, T.; Bondock, S.; Youns, M. Anticancer activity of new coumarin substituted hydrazide-hydrazone derivatives. Eur. J. Med. Chem. 2014, 76, 539–548. [Google Scholar] [CrossRef] [Scilit]
- Zhang, S.; Won, Y.K.; Ong, C.N.; Shen, H.M. Anti-cancer potential of sesquiterpene lactones: Bioactivity and molecular mechanisms. Curr. Med. Chem. Anticancer Agents 2005, 5, 239–249. [Google Scholar] [CrossRef] [Scilit]
- Janecka, A.; Wyrębska, A.; Gach, K.; Fichna, J.; Janecki, T. Natural and synthetic α-methylenelactones and α-methylenelactams with anticancer potential. Drug Discov. Today 2012, 17, 561–572. [Google Scholar] [CrossRef] [Scilit]
- Pati, H.N.; Das, U.; Sharma, R.K.; Dimmock, J.R. Cytotoxic thiol alkylators. Mini Rev. Med. Chem. 2007, 7, 131–139. [Google Scholar] [CrossRef] [Scilit]
- Mathema, V.B.; Koh, Y.S.; Thakuri, B.C.; Sillanpää, M. Parthenolide, a sesquiterpene lactone, expresses multiple anti-cancer and anti-inflammatory activities. Inflammation 2012, 35, 560–565. [Google Scholar] [CrossRef] [Scilit]
- Kupchan, S.M.; Hemingway, R.J.; Werner, D.; Karim, A.; McPhail, A.T.; Sim, G.A. Vernolepin, a novel elemanolide dilactone tumor inhibitor from Vernonia hymenolepis. J. Am. Chem. Soc. 1968, 90, 3596–3597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weinheimer, A.J.; Chang, C.W.J.; Matson, J. Naturally occurring cembranes. Fortschr. Chem. Org. Naturst. 1979, 36, 285–387. [Google Scholar]
- Quintana, J.; Estévez, F. Recent Advances on Cytotoxic Sesquiterpene Lactones. Curr. Pharm. Des. 2018, 24, 4355–4361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, Y.; Yu, J.; Kinghorn, A.D. Development of Anticancer Agents from Plant-Derived Sesquiterpene Lactones. Curr. Med. Chem. 2016, 23, 2397–2420. [Google Scholar] [CrossRef] [Scilit]
- Grech-Baran, M.; Pietrosiuk, A. Arglabina–lakton seskwiterpenowy o właściwościach przeciwnowotworowych. Biul. Wydz. Farm. WUM 2010, 3, 22–26. [Google Scholar]
- Modranka, J.; Albrecht, A.; Jakubowski, R.; Krawczyk, H.; Różalski, M.; Krajewska, U.; Janecka, A.; Wyrębska, A.; Różalska, B.; Janecki, T. Synthesis and biological evaluation of α-methylidene-δ-lactones with 3,4-dihydrocoumarin skeleton. Bioorg. Med. Chem. 2012, 20, 5017–5026. [Google Scholar] [CrossRef] [Scilit]
- Deredas, D.; Huben, K.; Janecka, A.; Długosz, A.; Pomorska, D.K.; Mirowski, M.; Krajewska, U.; Janecki, T.; Krawczyk, H. Synthesis and anticancer properties of 3-methylene-4-(2-oxoalkyl)-3,4-dihydrocoumarins. Chem. Commun. 2016, 7, 1745–1758. [Google Scholar] [CrossRef] [Scilit]
- Wyrębska, A.; Gach, K.; Lewandowska, U.; Szewczyk, K.; Hrabem, E.; Modranka, J.; Jakubowski, R.; Janecki, T.; Szymański, J.; Janecka, A. Anticancer Activity of New Synthetic α-Methylene-δ-Lactones on Two Breast Cancer Cell Lines. Basic Clin. Pharmacol. Toxicol. 2013, 113, 391–400. [Google Scholar] [CrossRef] [Scilit]
- Dlugosz, A.; Gach-Janczak, K.; Szymanski, J.; Deredas, D.; Krawczyk, H.; Janecki, T.; Janecka, A. Anticancer Properties of a New Hybrid Analog AD-013 Combining a Coumarin Scaffold with an α-methylene-δ-lactone Motif. Anticancer Agents Med. Chem. 2018, 18, 450–457. [Google Scholar] [CrossRef] [Scilit]
- Długosz, A.; Drogosz, J.; Deredas, D.; Janecki, T.; Janecka, A. Involvement of a coumarin analog AD-013 in the DNA damage response pathways in MCF-7 cells. Mol. Biol. Rep. 2018, 45, 1187–1195. [Google Scholar] [CrossRef] [Scilit]
- Jakubowski, R.; Pomorska, D.K.; Długosz, A.; Janecka, A.; Krajewska, U.; Różalski, M.; Mirowski, M.; Bartosik, T.; Janecki, T. Synthesis of 4,4-Disubstituted 3-Methylidenechroman-2-ones as Potent Anticancer Agents. Chem. Med. Chem. 2017, 12, 599–605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, W.; Kavanagh, J.J. Anticancer therapy targeting the apoptotic pathway. Lancet Oncol. 2003, 4, 721–729. [Google Scholar] [CrossRef] [Scilit]
- Zaman, S.; Wang, R.; Gandhi, V. Targeting the apoptosis pathway in hematologic malignancies. Leuk. Lymphoma 2014, 55, 1980–1992. [Google Scholar] [CrossRef] [Scilit]
- Degterev, A.; Boyce, M.; Yuan, J. A decade of caspases. Oncogene 2003, 22, 8543–8567. [Google Scholar] [CrossRef] [Scilit]
- Fischer, U.; Jänicke, R.U.; Schulze-Osthoff, K. Many cuts to ruin: A comprehensive update of caspase substrates. Cell Death Differ. 2003, 10, 76–100. [Google Scholar] [CrossRef] [Scilit]
- Fulda, S.; Debatin, K.M. Extrinsic versus intrinsic apoptosis pathways in anticancer chemotherapy. Oncogene 2006, 25, 4798–4811. [Google Scholar] [CrossRef] [Scilit]
- Saelens, X.; Festjens, N.; Vande Walle, L.; van Gurp, M.; van Loo, G.; Vandenabeele, P. Toxic proteins released from mitochondria in cell death. Oncogene 2004, 23, 2861–2874. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Youle, R.J. The role of mitochondria in apoptosis. Annu. Rev. Genet. 2009, 43, 95–118. [Google Scholar] [CrossRef] [Scilit]
- Chinnaiyan, A.M. The apoptosome: Heart and soul of the cell death machine. Neoplasia 1999, 1, 5–15. [Google Scholar] [CrossRef] [Scilit]
- Roos, W.P.; Kaina, B. DNA damage-induced cell death by apoptosis. Trends Mol. Med. 2006, 12, 440–450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Westphal, D.; Dewson, G.; Czabotar, P.E.; Kluck, R.M. Molecular biology of Bax and Bak activation and action. Biochim. Biophys. Acta 2011, 1813, 521–531. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yip, K.W.; Reed, J.C. Bcl-2 family proteins and cancer. Oncogene 2008, 27, 6398–6406. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valko, M.; Leibfritz, D.; Moncol, J.; Cronin, M.T.; Mazur, M.; Telser, J. Free radicals and antioxidants in normal physiological functions and human disease. Int. J. Biochem. Cell Biol. 2007, 39, 44–84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schumacker, P.T. Reactive oxygen species in cancer cells: Live by the sword, die by the sword. Cancer Cell 2006, 10, 175–176. [Google Scholar] [CrossRef] [Scilit]
- Thorburn, A. Death receptor-induced cell killing. Cell. Signal. 2004, 16, 139–144. [Google Scholar] [CrossRef] [Scilit]
- Bayat Mokhtari, R.; Homayouni, T.S.; Baluch, N.; Morgatskaya, E.; Kumar, S.; Das, B.; Yeger, H. Combination therapy in combating cancer. Oncotarget 2017, 8, 38022–38043. [Google Scholar] [CrossRef] [Scilit]
- Housman, G.; Byler, S.; Heerboth, S.; Lapinska, K.; Longacre, M.; Snyder, N.; Sarkar, S. Drug resistance in cancer: An overview. Cancers 2014, 6, 1769–1792. [Google Scholar] [CrossRef] [Scilit]
- Li, F.; Zhao, C.; Wang, L. Molecular-targeted agents combination therapy for cancer: Developments and potentials. Int. J. Cancer 2014, 134, 1257–1269. [Google Scholar] [CrossRef] [Scilit]
- Longley, D.B.; Harkin, D.P.; Johnston, P.G. 5-Fluorouracil: Mechanisms of action and clinical strategies. Nat. Rev. Cancer 2003, 3, 330–338. [Google Scholar] [CrossRef] [Scilit]
- Weaver, B.A. How Taxol/paclitaxel kills cancer cells. Mol. Biol. Cell 2014, 25, 2677–2681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alcindor, T.; Beauger, N. Oxaliplatin: A review in the era of molecularly targeted therapy. Curr. Oncol. 2011, 18, 18–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Greco, W.R.; Bravo, G.; Parsons, J.C. The search for synergy: A critical review from a response surface perspective. Pharmacol. Rev. 1995, 47, 331–385. [Google Scholar] [PubMed]
- Estey, E.; Döhner, H. Acute myeloid leukaemia. Lancet 2006, 368, 1894–1907. [Google Scholar] [CrossRef] [Scilit]
- DeVita, V.T., Jr.; Chu, E. A history of cancer chemotherapy. Cancer Res. 2008, 68, 8643–8653. [Google Scholar] [CrossRef] [Scilit]
- Pinkel, D.; Hernandez, K.; Borella, L.; Holton, C.; Aur, R.; Samoy, G.; Pratt, C. Drug dose and remission duration in childhood lymphocytic leukemia. Cancer 1971, 27, 247–256. [Google Scholar] [CrossRef] [Scilit]
- DeVita, V.T.; Serpick, A.A.; Carbone, P.P. Combination chemotherapy in the treatment of advanced Hodgkin’s disease. Ann. Intern. Med. 1970, 73, 881–895. [Google Scholar] [CrossRef] [Scilit]
- Choi, J.H.; Choi, Y.W.; Kang, S.Y.; Jeong, G.S.; Lee, H.W.; Jeong, S.H.; Park, J.S.; Ahn, M.S.; Sheen, S.S. Combination versus single-agent as palliative chemotherapy for gastric cancer. BMC Cancer 2020, 20, 167. [Google Scholar] [CrossRef] [Scilit]
- Bashraheel, S.S.; Domling, A.; Goda, S.K. Update on targeted cancer therapies, single or in combination, and their fine tuning for precision medicine. BioMed. Pharmacother. 2020, 125, 110009. [Google Scholar] [CrossRef] [Scilit]
- Qiang, H.; Chang, Q.; Xu, J.; Qian, J.; Zhang, Y.; Lei, Y.; Han, B.; Chu, T. New advances in antiangiogenic combination therapeutic strategies for advanced non-small cell lung cancer. J. Cancer Res. Clin. Oncol. 2020, 146, 631–645. [Google Scholar] [CrossRef] [Scilit]
- Hu, M.; Huang, P.; Wang, Y.; Su, Y.; Zhou, L.; Zhu, X.; Yan, D. Synergistic Combination Chemotherapy of Camptothecin and Floxuridine through Self-Assembly of Amphiphilic Drug-Drug Conjugate. Bioconjug. Chem. 2015, 26, 2497–2506. [Google Scholar] [CrossRef] [Scilit]
- Sallman, D.A.; Lancet, J.E. What are the most promising new agents in acute myeloid leukemia? Curr. Opin. Hematol. 2017, 24, 99–107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jackson, S.P.; Bartek, J. The DNA-damage response in human biology and disease. Nature 2009, 461, 1071–1078. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gottifredi, V.; Prives, C. The S phase checkpoint: When the crowd meets at the fork. Semin. Cell Dev. Biol. 2005, 16, 355–368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Costantino, V.V.; Mansilla, S.F.; Speroni, J.; Amaya, C.; Cuello-Carrión, D.; Ciocca, D.R.; Priestap, H.A.; Barbieri, M.A.; Gottifredi, V.; Lopez, L.A. The sesquiterpene lactone dehydroleucodine triggers senescence and apoptosis in association with accumulation of DNA damage markers. PLoS ONE 2013, 8, e53168. [Google Scholar] [CrossRef] [Scilit]
- Dalton, W.B.; Nandan, M.O.; Moore, R.T.; Yang, V.W. Human cancer cells commonly acquire DNA damage during mitotic arrest. Cancer Res. 2007, 67, 11487–11492. [Google Scholar] [CrossRef] [Scilit]
- Asik, A.; Kayabasi, C.; Ozmen Yelken, B.; Yılmaz Susluer, S.; Dogan Sigva, Z.O.; Balcı Okcanoglu, T.; Saydam, G.; Biray Avci, C.; Gunduz, C. Antileukemic effect of paclitaxel in combination with metformin in HL-60 cell line. Gene 2018, 647, 213–220. [Google Scholar] [CrossRef] [Scilit]
- Wyrębska, A.; Gach, K.; Janecka, A. Combined effect of parthenolide and various anti-cancer drugs or anticancer candidate substances on malignant cells in vitro and in vivo. Mini Rev. Med. Chem. 2014, 14, 222–228. [Google Scholar] [CrossRef] [Scilit]
- Patel, N.M.; Nozaki, S.; Shortle, N.H.; Bhat-Nakshatri, P.; Newton, T.R.; Rice, S.; Gelfanov, V.; Boswell, S.H.; Goulet, R.J., Jr.; Sledge, G.W., Jr.; et al. Paclitaxel sensitivity of breast cancer cells with constitutively active NF-kappaB is enhanced by IkappaBalpha super-repressor and parthenolide. Oncogene 2000, 19, 4159–4169. [Google Scholar] [CrossRef] [Scilit]
- Sweeney, C.J.; Mehrotra, S.; Sadaria, M.R.; Kumar, S.; Shortle, N.H.; Roman, Y.; Sheridan, C.; Campbell, R.A.; Murry, D.J.; Badve, S.; et al. The sesquiterpene lactone parthenolide in combination with docetaxel reduces metastasis and improves survival in a xenograft model of breast cancer. Mol. Cancer Ther. 2005, 4, 1004–1012. [Google Scholar] [CrossRef] [Scilit]
- Zhang, D.; Qiu, L.; Jin, X.; Guo, Z.; Guo, C. Nuclear factor-kappaB inhibition by parthenolide potentiates the efficacy of Taxol in non-small cell lung cancer in vitro and in vivo. Mol. Cancer Res. 2009, 7, 1139–1149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, Z.W.; Zhang, D.L.; Guo, C.B. Paclitaxel efficacy is increased by parthenolide via nuclear factor-kappaB pathways in in vitro and in vivo human non-small cell lung cancer models. Curr. Cancer Drug Targets 2010, 10, 705–715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Sample Availability: Samples of the compounds are not available from the authors. |










| Compound | IC50 (µM) | |
|---|---|---|
| HL-60 | HUVEC | |
| DL-247 | 1.15 ± 0.06 | 2.87 ± 0.03 |
| PTL | 4.75 ± 0.01 | 5.15 ± 0.12 |
| Inhibition of Proliferation | Induction of DNA Damage | Induction of Apoptosis | ||||
|---|---|---|---|---|---|---|
| Combination | Fa | Cl | Fa | Cl | Fa | Cl |
| DL-247 + Tx | 0.83 | 0.80 | 0.47 | 0.55 | 0.84 | 0.66 |
| DL-247 + 5-Fu | 0.56 | 1.09 | 0.71 | 0.95 | 0.99 | 1.00 |
| DL-247 + Ox | 0.38 | 2.23 | 0.70 | 1.09 | 0.87 | 1.04 |
| Gene | Primer Sequences | |
|---|---|---|
| Forward | Reverse | |
| Bax | 5′ ACCCGGTGCCTCAGGATGCGT 3′ | 5′ GGCAAAGTAGAAAAGGGCGAC 3′ |
| Bcl-2 | 5′ CATGCTGGGGCCGTACAG 3′ | 5′ GAACCGGCACCTGCACAC 3′ |
| GAPDH | 5′ GTCGCTGTTGAAGTCAGAGGAG 3′ | 5′ CGTGTCAGTGGTGGACCTGAC 3′ |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gach-Janczak, K.; Drogosz-Stachowicz, J.; Długosz-Pokorska, A.; Jakubowski, R.; Janecki, T.; Szymański, J.; Janecka, A. A New Hybrid δ-Lactone Induces Apoptosis and Potentiates Anticancer Activity of Taxol in HL-60 Human Leukemia Cells. Molecules 2020, 25, 1479. https://doi.org/10.3390/molecules25071479
Gach-Janczak K, Drogosz-Stachowicz J, Długosz-Pokorska A, Jakubowski R, Janecki T, Szymański J, Janecka A. A New Hybrid δ-Lactone Induces Apoptosis and Potentiates Anticancer Activity of Taxol in HL-60 Human Leukemia Cells. Molecules. 2020; 25(7):1479. https://doi.org/10.3390/molecules25071479
Chicago/Turabian StyleGach-Janczak, Katarzyna, Joanna Drogosz-Stachowicz, Angelika Długosz-Pokorska, Rafał Jakubowski, Tomasz Janecki, Jacek Szymański, and Anna Janecka. 2020. "A New Hybrid δ-Lactone Induces Apoptosis and Potentiates Anticancer Activity of Taxol in HL-60 Human Leukemia Cells" Molecules 25, no. 7: 1479. https://doi.org/10.3390/molecules25071479
APA StyleGach-Janczak, K., Drogosz-Stachowicz, J., Długosz-Pokorska, A., Jakubowski, R., Janecki, T., Szymański, J., & Janecka, A. (2020). A New Hybrid δ-Lactone Induces Apoptosis and Potentiates Anticancer Activity of Taxol in HL-60 Human Leukemia Cells. Molecules, 25(7), 1479. https://doi.org/10.3390/molecules25071479

