Isoprenylcysteine Carboxyl Methyltransferase and Its Substrate Ras Are Critical Players Regulating TLR-Mediated Inflammatory Responses
Abstract
:1. Introduction
2. Materials and Methods
2.1. Mice and Reagents
2.2. Construction of Expression Vectors
2.3. Preparation of Peritoneal Macrophages
2.4. Cell Culture and Drug Preparation
2.5. Induction and Monitoring of DNCB-Induced Atopic Dermatitis (AD) in Mice
2.6. Induction of Ulcerative Colitis
2.7. EtOH/HCl-Induced Gastritis
2.8. LPS-Induced Hepatitis Mouse Model
2.9. LPS-Induced Septic Shock Mouse Model
2.10. Histopathology
2.11. Generation of Stable Cell Lines
2.12. CRISPR-Cas9-Mediated Depletion of ICMT
2.13. RNA Interference
2.14. mRNA Analysis by Semi-Quantitative or Quantitative Reverse Transcriptase-Polymerase Chain Reaction
2.15. Preparation of Cell Lysates and Nuclear Fractions from Cells/Tissues for Immunoblotting Analyses
2.16. Immunoprecipitation Assays
2.17. Luciferase Reporter Gene Activity Assay
2.18. Confocal Microscopy
2.19. Microarray Analysis
2.20. ICMT Activity Assay
2.21. Statistical Analyses
3. Results
3.1. ICMT Is Highly Increased in TLR-Mediated Inflammatory Responses in Macrophages and in Mouse Disease Models
3.2. ICMT Regulates Inflammatory Response In Vitro
3.3. ICMT-Mediated Inflammatory Response Is Mediated by Ras
3.4. ICMT-Methylated Ras-Mediated Inflammatory Response Is Managed by the MAPK-AP-1 Pathway
3.5. ICMT-Methylated Ras-Mediated Inflammatory Responses Are Both MyD88- and TRIF-Dependent
3.6. The TIR Domains of Both MyD88 and TRIF Play Functionally Important Roles in ICMT-Methylated Ras-Mediated Inflammatory Responses
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Akira, S.; Takeda, K.; Kaisho, T. Toll-like receptors: Critical proteins linking innate and acquired immunity. Nat. Immunol. 2001, 2, 675–680. [Google Scholar] [CrossRef] [PubMed]
- Jin, J.; Xiao, Y.; Hu, H.; Zou, Q.; Li, Y.; Gao, Y.; Ge, W.; Cheng, X.; Sun, S.-C. Proinflammatory TLR signalling is regulated by a TRAF2-dependent proteolysis mechanism in macrophages. Nat. Commun. 2015, 6, 5930. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kondo, T.; Kawai, T.; Akira, S. Dissecting negative regulation of Toll-like receptor signaling. Trends Immunol. 2012, 33, 449–458. [Google Scholar] [CrossRef] [PubMed]
- Tang, S.; Chen, T.; Yu, Z.; Zhu, X.; Yang, M.; Xie, B.; Li, N.; Cao, X.; Wang, J. RasGRP3 limits Toll-like receptor-triggered inflammatory response in macrophages by activating Rap1 small GTPase. Nat. Commun. 2014, 5, 4657. [Google Scholar] [CrossRef]
- Takeda, K.; Akira, S. Toll Receptors. In Current Protocols in Immunology; Wiley: Hoboken, NJ, USA, 2020. [Google Scholar]
- Karin, M. The regulation of AP-1 activity by mitogen-activated protein kinases. J. Biol. Chem. 1995, 270, 16483–16486. [Google Scholar] [CrossRef] [Green Version]
- Karin, M.; Liu, Z.-g.; Zandi, E. AP-1 function and regulation. Curr. Opin. Cell Biol. 1997, 9, 240–246. [Google Scholar] [CrossRef]
- Shaulian, E.; Karin, M. AP-1 as a regulator of cell life and death. Nat. Cell Biol. 2002, 4, E131–E136. [Google Scholar] [CrossRef]
- Boespflug, A.; Caramel, J.; Dalle, S.; Thomas, L. Treatment of NRAS-mutated advanced or metastatic melanoma: Rationale, current trials and evidence to date. Adv. Med. Oncol. 2017, 9, 481–492. [Google Scholar] [CrossRef] [Green Version]
- Cho, S.O.; Lim, J.W.; Kim, K.H.; Kim, H. Involvement of Ras and AP-1 in Helicobacter pylori-induced expression of COX-2 and iNOS in gastric epithelial AGS cells. Dig. Dis. Sci. 2010, 55, 988–996. [Google Scholar] [CrossRef]
- Okumura, T.; Ericksen, R.E.; Takaishi, S.; Wang, S.S.; Dubeykovskiy, Z.; Shibata, W.; Betz, K.S.; Muthupalani, S.; Rogers, A.B.; Fox, J.G.; et al. K-ras mutation targeted to gastric tissue progenitor cells results in chronic inflammation, an altered microenvironment, and progression to intraepithelial neoplasia. Cancer Res. 2010, 70, 8435–8445. [Google Scholar] [CrossRef] [Green Version]
- Geppert, T.D.; Whitehurst, C.E.; Thompson, P.; Beutler, B. Lipopolysaccharide signals activation of tumor necrosis factor biosynthesis through the ras/raf-1/MEK/MAPK pathway. Mol. Med. 1994, 1, 93–103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oron, T.; Elad-Sfadia, G.; Haklai, R.; Aizman, E.; Brazowski, E.; Kloog, Y.; Reif, S. Prevention of induced colitis in mice by the ras antagonist farnesylthiosalicylic acid. Dig. Dis. Sci. 2012, 57, 320–326. [Google Scholar] [CrossRef] [PubMed]
- Basso, A.D.; Kirschmeier, P.; Bishop, W.R. Thematic review series: Lipid posttranslational modifications. Farnesyl transferase inhibitors. J. Lipid Res. 2006, 47, 15–31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anderson, J.L.; Henriksen, B.S.; Gibbs, R.A.; Hrycyna, C.A. The Isoprenoid Substrate Specificity of Isoprenylcysteine Carboxylmethyltransferase DEVELOPMENT OF NOVEL INHIBITORS. J. Biol. Chem. 2005, 280, 29454–29461. [Google Scholar] [CrossRef] [Green Version]
- Doll, R.J.; Kirschmeier, P.; Bishop, W. Farnesyltransferase inhibitors as anticancer agents: Critical crossroads. Curr. Opin. Drug Discov. Dev. 2004, 7, 478–486. [Google Scholar]
- Mazieres, J.; Pradines, A.; Favre, G. Perspectives on farnesyl transferase inhibitors in cancer therapy. Cancer Lett. 2004, 206, 159–167. [Google Scholar] [CrossRef]
- Lene, L.J. Design and Synthesis of Cysmethynil and Analogues as Inhibitors of Isoprenylcysteine Carboxyl Methyltransferase (ICMT). Ph.D. Thesis; National University of Singapore: Singapore, 2009. [Google Scholar]
- Young, S.G.; Ambroziak, P.; Kim, E.; Clarke, S. 7 Postisoprenylation protein processing: CXXX (CaaX) endoproteases and isoprenylcysteine carboxyl methyltransferase. Enzym 2001, 21, 155–213. [Google Scholar]
- Ahearn, I.M.; Haigis, K.; Bar-Sagi, D.; Philips, M.R. Regulating the regulator: Post-translational modification of RAS. Nat. Rev. Mol. Cell Biol. 2012, 13, 39. [Google Scholar] [CrossRef] [Green Version]
- Winter-Vann, A.M.; Casey, P.J. Post-prenylation-processing enzymes as new targets in oncogenesis. Nat. Rev. Cancer 2005, 5, 405–412. [Google Scholar] [CrossRef]
- Clarke, S. Perspectives on the Biological Function and Enzymology of Protein Carboxyl Methylation Reactions in Eucaryotic and Procaryotic Cells. In Advances in Post-Translational Modifications of Proteins and Aging; Springer: New York, NY, USA, 1988; pp. 213–228. [Google Scholar]
- Ashby, M.N. CaaX converting enzymes. Curr. Opin. Lipidol. 1998, 9, 99–102. [Google Scholar] [CrossRef]
- Bergo, M.O.; Leung, G.K.; Ambroziak, P.; Otto, J.C.; Casey, P.J.; Young, S.G. Targeted inactivation of the isoprenylcysteine carboxyl methyltransferase gene causes mislocalization of K-Ras in mammalian cells. J. Biol. Chem. 2000, 275, 17605–17610. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wright, L.P.; Court, H.; Mor, A.; Ahearn, I.M.; Casey, P.J.; Philips, M.R. Topology of mammalian isoprenylcysteine carboxyl methyltransferase determined in live cells with a fluorescent probe. Mol. Cell. Biol. 2009, 29, 1826–1833. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Diver, M.M.; Pedi, L.; Koide, A.; Koide, S.; Long, S.B. Atomic structure of the eukaryotic intramembrane RAS methyltransferase ICMT. Nature 2018, 553, 526–529. [Google Scholar] [CrossRef] [PubMed]
- Eisenberg, S.; Laude, A.J.; Beckett, A.J.; Mageean, C.J.; Aran, V.; Hernandez-Valladares, M.; Henis, Y.I.; Prior, I.A. The role of palmitoylation in regulating Ras localization and function. Biochem. Soc. Trans. 2013, 41, 79–83. [Google Scholar] [CrossRef]
- Chiu, V.K.; Silletti, J.; Dinsell, V.; Wiener, H.; Loukeris, K.; Ou, G.; Philips, M.R.; Pillinger, M.H. Carboxyl methylation of Ras regulates membrane targeting and effector engagement. J. Biol. Chem. 2004, 279, 7346–7352. [Google Scholar] [CrossRef] [Green Version]
- Bergo, M.O.; Gavino, B.J.; Hong, C.; Beigneux, A.P.; McMahon, M.; Casey, P.J.; Young, S.G. Inactivation of Icmt inhibits transformation by oncogenic K-Ras and B-Raf. J. Clin. Investig. 2004, 113, 539–550. [Google Scholar] [CrossRef]
- Goodman, L.E.; Judd, S.R.E.; Farnsworth, C.C.; Powers, S.; Gelb, M.H.; Glomset, J.A.; Tamanoi, F. Mutants of Saccharomyces cerevisiae defective in the farnesylation of Ras proteins. Proc. Natl. Acad. Sci. USA 1990, 87, 9665–9669. [Google Scholar] [CrossRef] [Green Version]
- Wahlstrom, A.M.; Cutts, B.A.; Liu, M.; Lindskog, A.; Karlsson, C.; Sjogren, A.-K.M.; Andersson, K.M.; Young, S.G.; Bergo, M.O. Inactivating Icmt ameliorates K-RAS–induced myeloproliferative disease. Blood 2008, 112, 1357–1365. [Google Scholar] [CrossRef] [Green Version]
- Zhang, F.L.; Casey, P.J. Protein prenylation: Molecular mechanisms and functional consequences. Annu. Rev. Biochem. 1996, 65, 241–269. [Google Scholar] [CrossRef]
- Winter-Vann, A.M.; Baron, R.A.; Wong, W.; dela Cruz, J.; York, J.D.; Gooden, D.M.; Bergo, M.O.; Young, S.G.; Toone, E.J.; Casey, P.J. A small-molecule inhibitor of isoprenylcysteine carboxyl methyltransferase with antitumor activity in cancer cells. Proc. Natl. Acad. Sci. USA 2005, 102, 4336–4341. [Google Scholar] [CrossRef] [Green Version]
- Bos, J.L. Ras oncogenes in human cancer: A review. Cancer Res. 1989, 49, 4682–4689. [Google Scholar] [PubMed]
- Bishop, W.R.; Kirschmeier, P.; Baum, C. Farnesyl transferase inhibitors: Mechanism of action, translational studies and clinical evaluation. Cancer Biol. Ther. 2003, 2, 95–103. [Google Scholar] [CrossRef]
- Gibbs, J.B.; Oliff, A.; Kohl, N.E. Farnesyltransferase inhibitors: Ras research yields a potential cancer therapeutic. Cell 1994, 77, 175–178. [Google Scholar] [CrossRef]
- Kortlever, R.M.; Sodir, N.M.; Wilson, C.H.; Burkhart, D.L.; Pellegrinet, L.; Brown Swigart, L.; Littlewood, T.D.; Evan, G.I. Myc Cooperates with Ras by Programming Inflammation and Immune Suppression. Cell 2017, 171, 1301–1315.e1314. [Google Scholar] [CrossRef]
- Court, H.; Amoyel, M.; Hackman, M.; Lee, K.E.; Xu, R.; Miller, G.; Bar-Sagi, D.; Bach, E.A.; Bergo, M.O.; Philips, M.R. Isoprenylcysteine carboxylmethyltransferase deficiency exacerbates KRAS-driven pancreatic neoplasia via Notch suppression. J. Clin. Investig. 2013, 123, 4681–4694. [Google Scholar] [CrossRef] [Green Version]
- Choi, J.H.; Song, Y.S.; Lee, H.J.; Kim, G.C.; Hong, J.W. The topical application of low-temperature argon plasma enhances the anti-inflammatory effect of Jaun-ointment on DNCB-induced NC/Nga mice. BMC Complement. Altern. Med. 2017, 17, 340. [Google Scholar] [CrossRef] [Green Version]
- Baek, K.S.; Yi, Y.S.; Son, Y.J.; Yoo, S.; Sung, N.Y.; Kim, Y.; Hong, S.; Aravinthan, A.; Kim, J.H.; Cho, J.Y. In vitro and in vivo anti-inflammatory activities of Korean Red Ginseng-derived components. J. Ginseng Res. 2016, 40, 437–444. [Google Scholar] [CrossRef] [Green Version]
- Yu, T.; Rhee, M.H.; Lee, J.; Kim, S.H.; Yang, Y.; Kim, H.G.; Kim, Y.; Kim, C.; Kwak, Y.-S.; Kim, J.-H. Ginsenoside Rc from Korean red ginseng (Panax ginseng CA Meyer) attenuates inflammatory symptoms of gastritis, hepatitis and arthritis. Am. J. Chin. Med. 2016, 44, 595–615. [Google Scholar] [CrossRef]
- Hossen, M.J.; Yang, W.S.; Kim, D.; Aravinthan, A.; Kim, J.-H.; Cho, J.Y. Thymoquinone: An IRAK1 inhibitor with in vivo and in vitro anti-inflammatory activities. Sci. Rep. 2017, 7, 42995. [Google Scholar] [CrossRef] [Green Version]
- Hossen, M.J.; Hong, Y.D.; Baek, K.S.; Yoo, S.; Hong, Y.H.; Kim, J.H.; Lee, J.O.; Kim, D.; Park, J.; Cho, J.Y. In vitro antioxidative and anti-inflammatory effects of the compound K-rich fraction BIOGF1K, prepared from Panax ginseng. J. Ginseng Res. 2017, 41, 43–51. [Google Scholar] [CrossRef] [Green Version]
- Tall, A.R.; Yvan-Charvet, L. Cholesterol, inflammation and innate immunity. Nat. Rev. Immunol. 2015, 15, 104–116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, M.H.; Son, Y.J.; Lee, S.Y.; Yang, W.S.; Yi, Y.S.; Yoon, D.H.; Yang, Y.; Kim, S.H.; Lee, D.; Rhee, M.H.; et al. JAK2-targeted anti-inflammatory effect of a resveratrol derivative 2,4-dihydroxy-N-(4-hydroxyphenyl)benzamide. Biochem. Pharm. 2013, 86, 1747–1761. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.; Li, L.; Sung, G.H.; Kim, T.W.; Byeon, S.E.; Cho, J.Y.; Park, C.W.; Park, H.J. Inhibition of 2,4-dinitrofluorobenzene-induced atopic dermatitis by topical application of the butanol extract of Cordyceps bassiana in NC/Nga mice. J. Ethnopharmacol. 2011, 134, 504–509. [Google Scholar] [CrossRef] [PubMed]
- Anderson, J.L.; Hrycyna, C.A. 9 Structure and function of isoprenylcysteine carboxylmethyltransferase (Icmt): A key enzyme in CaaX processing. Enzymes 2006, 24, 245–272. [Google Scholar]
- Lau, H.Y.; Tang, J.; Casey, P.J.; Wang, M. Isoprenylcysteine carboxylmethyltransferase is critical for malignant transformation and tumor maintenance by all RAS isoforms. Oncogene 2017, 36, 3934–3942. [Google Scholar] [CrossRef] [Green Version]
- Cho, J.Y.; Grigura, V.; Murphy, T.L.; Murphy, K. Identification of cooperative monomeric Brachyury sites conferring T-bet responsiveness to the proximal IFN-gamma promoter. Int. Immunol. 2003, 15, 1149–1160. [Google Scholar] [CrossRef] [Green Version]
- Bergo, M.O.; Leung, G.K.; Ambroziak, P.; Otto, J.C.; Casey, P.J.; Gomes, A.Q.; Seabra, M.C.; Young, S.G. Isoprenylcysteine carboxyl methyltransferase deficiency in mice. J. Biol. Chem. 2001, 276, 5841–5845. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.H.; Kim, J.H.; Kim, S.C.; Yi, Y.-S.; Yang, W.S.; Yang, Y.; Kim, H.G.; Lee, J.Y.; Kim, K.-H.; Yoo, B.C. Adenosine dialdehyde suppresses MMP-9-mediated invasion of cancer cells by blocking the Ras/Raf-1/ERK/AP-1 signaling pathway. Biochem. Pharmacol. 2013, 86, 1285–1300. [Google Scholar] [CrossRef]
- Yang, W.S.; Yeo, S.G.; Yang, S.; Kim, K.H.; Yoo, B.C.; Cho, J.Y. Isoprenyl carboxyl methyltransferase inhibitors: A brief review including recent patents. Amino Acids 2017, 49, 1469–1485. [Google Scholar] [CrossRef] [Green Version]
- Karin, M. The regulation of AP-1 activity by mitogen-activated protein kinases. Philos. Trans. R. Soc. Lond. B Biol. Sci. 1996, 351, 127–134. [Google Scholar] [CrossRef] [Green Version]
- Goodsell, D.S. The molecular perspective: The src oncogene. Oncology 2001, 6, 474–476. [Google Scholar] [CrossRef] [PubMed]
- Loree, J.M.; Kopetz, S. Recent developments in the treatment of metastatic colorectal cancer. Adv. Med. Oncol. 2017, 9, 551–564. [Google Scholar] [CrossRef] [PubMed]
- Rocks, O.; Peyker, A.; Bastiaens, P.I. Spatio-temporal segregation of Ras signals: One ship, three anchors, many harbors. Curr. Opin. Cell Biol. 2006, 18, 351–357. [Google Scholar] [CrossRef] [PubMed]
- Chang, E.H.; Gonda, M.A.; Ellis, R.W.; Scolnick, E.M.; Lowy, D.R. Human genome contains four genes homologous to transforming genes of Harvey and Kirsten murine sarcoma viruses. Proc. Natl. Acad. Sci. USA 1982, 79, 4848–4852. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Harris, H.E.; Andersson, U.; Pisetsky, D.S. HMGB1: A multifunctional alarmin driving autoimmune and inflammatory disease. Nat. Rev. Rheumatol. 2012, 8, 195–202. [Google Scholar] [CrossRef] [PubMed]
- Trussoni, C.E.; Tabibian, J.H.; Splinter, P.L.; O’Hara, S.P. Lipopolysaccharide (LPS)-Induced Biliary Epithelial Cell NRas Activation Requires Epidermal Growth Factor Receptor (EGFR). PLoS ONE 2015, 10, e0125793. [Google Scholar] [CrossRef] [Green Version]
- O’Hara, S.P.; Splinter, P.L.; Trussoni, C.E.; Gajdos, G.B.; Lineswala, P.N.; LaRusso, N.F. Cholangiocyte N-Ras protein mediates lipopolysaccharide-induced interleukin 6 secretion and proliferation. J. Biol. Chem. 2011, 286, 30352–30360. [Google Scholar] [CrossRef] [Green Version]
- Wang, D.; Lou, J.; Ouyang, C.; Chen, W.; Liu, Y.; Liu, X.; Cao, X.; Wang, J.; Lu, L. Ras-related protein Rab10 facilitates TLR4 signaling by promoting replenishment of TLR4 onto the plasma membrane. Proc. Natl. Acad. Sci. USA 2010, 107, 13806–13811. [Google Scholar] [CrossRef] [Green Version]
- Xue, X.; Lai, K.T.; Huang, J.F.; Gu, Y.; Karlsson, L.; Fourie, A. Anti-inflammatory activity in vitro and in vivo of the protein farnesyltransferase inhibitor tipifarnib. J. Pharm. Exp. 2006, 317, 53–60. [Google Scholar] [CrossRef] [Green Version]
- Tartey, S.; Takeuchi, O. Pathogen recognition and Toll-like receptor targeted therapeutics in innate immune cells. Int. Rev. Immunol. 2017, 36, 57–73. [Google Scholar] [CrossRef]
- Rokavec, M.; Oner, M.G.; Hermeking, H. lnflammation-induced epigenetic switches in cancer. Cell. Mol. Life Sci. 2016, 73, 23–39. [Google Scholar] [CrossRef]
- Wang, K.; Karin, M. Tumor-Elicited Inflammation and Colorectal Cancer. Adv. Cancer Res. 2015, 128, 173–196. [Google Scholar]
- Shrihari, T.G. Dual role of inflammatory mediators in cancer. Ecancermedicalscience 2017, 11, 721. [Google Scholar] [CrossRef]
- Hong, H.; He, C.; Zhu, S.; Zhang, Y.; Wang, X.; She, F.; Chen, Y. CCR7 mediates the TNF-alpha-induced lymphatic metastasis of gallbladder cancer through the “ERK1/2—AP-1” and “JNK—AP-1” pathways. J. Exp. Clin. Cancer Res. 2016, 35, 51. [Google Scholar] [CrossRef] [Green Version]
- Qiao, Y.; He, H.; Jonsson, P.; Sinha, I.; Zhao, C.; Dahlman-Wright, K. AP-1 Is a Key Regulator of Proinflammatory Cytokine TNFalpha-mediated Triple-negative Breast Cancer Progression. J. Biol. Chem. 2016, 291, 5068–5079. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choi, E.; Hendley, A.M.; Bailey, J.M.; Leach, S.D.; Goldenring, J.R. Expression of Activated Ras in Gastric Chief Cells of Mice Leads to the Full Spectrum of Metaplastic Lineage Transitions. Gastroenterology 2016, 150, 918–930.e913. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, Y.; Weng, W.; Peng, J.; Hong, L.; Yang, L.; Toiyama, Y.; Gao, R.; Liu, M.; Yin, M.; Pan, C.; et al. Fusobacterium nucleatum Increases Proliferation of Colorectal Cancer Cells and Tumor Development in Mice by Activating Toll-Like Receptor 4 Signaling to Nuclear Factor-kappaB, and Up-regulating Expression of MicroRNA-21. Gastroenterology 2017, 152, 851–866.e824. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, S.T.; Pham, H.; Pandol, S.J.; Ptasznik, A. Src as the link between inflammation and cancer. Front. Physiol. 2013, 4, 416. [Google Scholar] [CrossRef] [Green Version]
- Byeon, S.E.; Yi, Y.S.; Oh, J.; Yoo, B.C.; Hong, S.; Cho, J.Y. The role of Src kinase in macrophage-mediated inflammatory responses. Mediat. Inflamm. 2012, 2012, 512926. [Google Scholar] [CrossRef] [Green Version]
- Lu, R.; Zhang, Y.G.; Sun, J. STAT3 activation in infection and infection-associated cancer. Mol. Cell. Endocrinol. 2017, 451, 80–87. [Google Scholar] [CrossRef]
- Guven-Maiorov, E.; Keskin, O.; Gursoy, A.; VanWaes, C.; Chen, Z.; Tsai, C.-J.; Nussinov, R. The architecture of the TIR domain signalosome in the Toll-like Receptor-4 signaling pathway. Sci. Rep. 2015, 5, 13128. [Google Scholar] [CrossRef] [Green Version]
- Lin, S.-C.; Lo, Y.-C.; Wu, H. Helical assembly in the MyD88–IRAK4–IRAK2 complex in TLR/IL-1R signalling. Nature 2010, 465, 885–890. [Google Scholar] [CrossRef] [Green Version]
- Gay, N.J.; Symmons, M.F.; Gangloff, M.; Bryant, C.E. Assembly and localization of Toll-like receptor signalling complexes. Nat. Rev. Immunol. 2014, 14, 546–558. [Google Scholar] [CrossRef]
- Yamamoto, M.; Takeda, K. Current views of toll-like receptor signaling pathways. Gastroenterol. Res. Pract. 2010, 2010, 240365. [Google Scholar] [CrossRef] [Green Version]
- Kaisho, T.; Akira, S. Toll-like receptor function and signaling. J. Allergy Clin. Immunol. 2006, 117, 979–987. [Google Scholar] [CrossRef]
- Kfoury, A.; Le Corf, K.; El Sabeh, R.; Journeaux, A.; Badran, B.; Hussein, N.; Lebecque, S.; Manie, S.; Renno, T.; Coste, I. MyD88 in DNA repair and cancer cell resistance to genotoxic drugs. J. Natl. Cancer Inst. 2013, 105, 937–946. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kfoury, A.; Virard, F.; Renno, T.; Coste, I. Dual function of MyD88 in inflammation and oncogenesis: Implications for therapeutic intervention. Curr. Opin. Oncol. 2014, 26, 86–91. [Google Scholar] [CrossRef] [PubMed]
- Higgins, M.J.; Serrano, A.; Boateng, K.Y.; Parsons, V.A.; Phuong, T.; Seifert, A.; Ricca, J.M.; Tucker, K.C.; Eidelman, A.S.; Carey, M.A.; et al. A Multifaceted Role for Myd88-Dependent Signaling in Progression of Murine Mammary Carcinoma. Breast Cancer (Auckl.) 2016, 10, 157–167. [Google Scholar] [CrossRef] [Green Version]
- Frantz, A.L.; Rogier, E.W.; Weber, C.R.; Shen, L.; Cohen, D.A.; Fenton, L.A.; Bruno, M.E.; Kaetzel, C.S. Targeted deletion of MyD88 in intestinal epithelial cells results in compromised antibacterial immunity associated with downregulation of polymeric immunoglobulin receptor, mucin-2, and antibacterial peptides. Mucosal Immunol. 2012, 5, 501–512. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salcedo, R.; Worschech, A.; Cardone, M.; Jones, Y.; Gyulai, Z.; Dai, R.M.; Wang, E.; Ma, W.; Haines, D.; O’HUigin, C.; et al. MyD88-mediated signaling prevents development of adenocarcinomas of the colon: Role of interleukin 18. J. Exp. Med. 2010, 207, 1625–1636. [Google Scholar] [CrossRef] [PubMed]
Target Protein or Domain | siRNA Sequence | |
---|---|---|
ICMT (human) | Sense | 5′-CCAUAGCUUAUAUUCUCA-3′ |
Antisense | 5′-UUGAGAAUAUAAGCUAUGG-3′ | |
ICMT (mouse) | Sense | 5′-GCUACCAGAUAGCCAUCAG-3′ |
Antisense | 5′-CUGAUGGCUAUCUGGUAGC-3′ | |
RAS (human) | Sense | 5′-GUUGGAGCUGGUGGCGUAG-3′ |
Antisense | 5′-CTACGCCACCAGCTCCA-3′ | |
RAS (mouse) | Sense | 5′-GUGCAAUGAAGGGACCAGUA-3′ |
Antisense | 5′-UACUGGUCCCUCAUUGCAC-3′ | |
TIR (human) | Sense | 5′-GCGCGCGGAUGAACAUAUUUU-3′ |
Antisense | 5′-AAUAUGUUCAUCCGCGCGCUU-3′ | |
Control (human) | Sense | 5′-CCUACGCCACCAAUUUCGU-3′ |
Antisense | 5′-ACGAAAUUGGUGGCGUAGG-3′ | |
Control (mouse) | Sense | 5′-UUCUCCGAACGUGUCACGU-3′ |
Antisense | 5′-ACGUGACACGUUCGGAGAA-3′ |
Targets | Sequence (5′ to 3′) | |
---|---|---|
aoc3 (Mus musculus) | F | CAGCTCGGGACAGTGAGATA |
R | CCAGGTCTCAGCAAAGACAA | |
aox1 (Mus musculus) | F | CAACCTTCCATCCAACACTG |
R | CCACATTTGATTGCCACTTC | |
acox-2 (Mus musculus) | F | CACTACATCCTGACCCACTT |
R | ATGCTCCTGCTTGAGTATGT | |
cox-2 (Homo sapiens) | F | AGGAGGTCTTTGGTCTGGTG |
R | TAGCCTGCTTGTCTGGAACA | |
gapdh (Mus musculus) | F | CAATGAATACGGCTACAGCAAC |
R | AGGGAGATGCTCAGTGTTGG | |
gapdh (Homo sapiens) | F | CGGGAAACTGTGGCGTGATG |
R | ATGACCTTGCCCACAGCCTT | |
ho-1 (Mus musculus) | F | CAGAGAGTCAGCATGCCAAT |
R | ACTCAGCATCATGCCAGTTC | |
h-ras (Mus musculus) | F | GCCATCAACAACACCAAGTC |
R | GAATCTTTCACCCGCTTGAT | |
icmt (Mus musculus) | F | GATGGTGGTCTTCGGAGAAT |
R | CCACATGGTTGAAGTTGGAG | |
icmt (Homo sapiens) | F | GGTGACCAGTGGAGTGTACG |
R | GGGTTACACAGCATCACCTG | |
il-1β (Mus musculus) | F | GGCCTTGGGCCTCAAAGGAA |
R | GCTTGGGATCCACACTCTCCA | |
il-1β (Homo sapiens) | F | TGGACCTCTGCCCTCTGGAT |
R | AAGGTCTGTGGGCAGGGAAC | |
il-4 (Mus musculus) | F | GCCATATCCACGGATGCAACG |
R | TTGCTGTGAGGACGTTTGGC | |
il-6 (Mus musculus) | F | GACAAAGCCAGAGTCCTTCAGAGA |
R | CTAGGTTTGCCGAGTAGATCTC | |
il-6 (Homo sapiens) | F | AAGCCAGAGCTGTGCAGATG |
R | CCTTGGTCACCGACGTCCTGT | |
Inos (Mus musculus) | F | GGAGCCTTTAGACCTCAACAGA |
R | TGAACGAGGAGGGTGGTG | |
k-ras (Mus musculus) | F | CAGGTGTTGAGGAGACCAGA |
R | CAGTAGCGTTCGTCACAGGT | |
k-ras (Homo sapiens) | F | TAGGCAAGAGTGCCTTGACG |
R | CCCTCCCCAGTCCTCATGTA | |
myd88 (Homo sapiens) | F | CAGCTCTGAGCCATTCACAC |
R | CCAGCATGTAGTCCAGCAAC | |
n-ras (Mus musculus) | F | CAGAACGTGTGAGCTTGGTT |
R | GAACGCACACAGCTTCTGAT | |
rasa1 (Mus musculus) | F | TCAGGTAGCAGCCTGTGTTC |
R | CTGGAATGTGGGAAAGTGTG | |
ranbp1 (Mus musculus) | F | CCTGATGCCTTCCTTGTAGG |
R | AAAGCCCTTTCACTGCTGTT | |
rhoc (Mus musculus) | F | CCTGAGGCAAGATGAGCATA |
R | AGGTAGCCAAAGGCACTGAT | |
tirap (Homo sapiens) | F | TTCACAGCCTACCTCACAGG |
R | CACCAGGTCTTCCTCACTGT | |
tnf-α (Mus musculus) | F | TGCCTATGTCTCAGCCTCTT |
R | GAGGCCATTTGGGAACTTCT | |
tnf-α (Homo sapiens) | F | GGCCCAGGCAGTCAGATCAT |
R | TCTCTCAGCTCCACGCCATT | |
tram (Homo sapiens) | F | TCAGAGCGTGGAAGAGATGT |
R | CCACATGGCATCTCAGCAAA | |
trif (Homo sapiens) | F | CCATGATGAGCAACCTCACG |
R | ATCTGGGAGTGTTCGTCCAG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, W.S.; Kim, H.G.; Kim, E.; Han, S.Y.; Aziz, N.; Yi, Y.-S.; Kim, S.; Lee, Y.; Yoo, B.C.; Han, J.-W.; et al. Isoprenylcysteine Carboxyl Methyltransferase and Its Substrate Ras Are Critical Players Regulating TLR-Mediated Inflammatory Responses. Cells 2020, 9, 1216. https://doi.org/10.3390/cells9051216
Yang WS, Kim HG, Kim E, Han SY, Aziz N, Yi Y-S, Kim S, Lee Y, Yoo BC, Han J-W, et al. Isoprenylcysteine Carboxyl Methyltransferase and Its Substrate Ras Are Critical Players Regulating TLR-Mediated Inflammatory Responses. Cells. 2020; 9(5):1216. https://doi.org/10.3390/cells9051216
Chicago/Turabian StyleYang, Woo Seok, Han Gyung Kim, Eunji Kim, Sang Yun Han, Nur Aziz, Young-Su Yi, Sunggyu Kim, Yunmi Lee, Byong Chul Yoo, Jeung-Whan Han, and et al. 2020. "Isoprenylcysteine Carboxyl Methyltransferase and Its Substrate Ras Are Critical Players Regulating TLR-Mediated Inflammatory Responses" Cells 9, no. 5: 1216. https://doi.org/10.3390/cells9051216