Point-of-Care Diagnosis of Malaria Using a Simple, Purification-Free DNA Extraction Method Coupled with Loop-Mediated Isothermal Amplification-Lateral Flow
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Alternative DNA Extraction Coupled with LAMP-LF Assay
2.3. Preparation of 40 nm Diameter Gold Nanoparticles
2.4. Conjugation of Streptavidin with Gold Nanoparticles
2.5. Construction of Lateral Flow Strips
2.6. LAMP Assay
2.7. Clinical Sensitivity and Specificity
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- World Health Organization. World Malaria Report 2021; World Health Organization: Geneva, Switzerland, 2021; pp. 1–322. [Google Scholar]
- Daher, R.K.; Stewart, G.; Boissinot, M.; Bergeron, M.G. Recombinase polymerase amplification for diagnostic applications. Clin. Chem. 2016, 62, 947–948. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lai, M.Y.; Ooi, C.H.; Lau, Y.L. Recombinase polymerase amplification combined with a lateral flow strip for the detection of Plasmodium knowlesi. Am. J. Trop. Med. Hyg. 2018, 98, 700–703. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lalremruata, A.; Nguyen, T.T.; McCall, M.B.B.; Mombo-Ngoma, G.; Agnandji, S.T.; Adegnika, A.A.; Lell, B.; Ramharter, M.; Hoffman, S.L.; Kremsner, P.G.; et al. Recombinase polymerase amplification and lateral flow assay for ultrasensitive detection of low-density Plasmodium falciparum infection from controlled human malaria infection studies and naturally acquired infections. J. Clin. Microbiol. 2020, 58, e01879-19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Kumar, N.; Gopalakrishnan, A.; Ginocchio, C.; Manji, R.; Bythrow, M.; Lemieux, B.; Kong, H. Detection and species identification of malaria parasites by isothermal tHDA amplification directly from human blood without sample preparation. J. Mol. Diagn. 2013, 15, 634–641. [Google Scholar] [CrossRef] [Scilit]
- Garrido-Maestu, A.; Azinheiro, S.; Fuciños, P.; Carvalho, J.; Prado, M. Comparative study of multiplex real-time recombinase polymerase amplification and ISO11290-1 methods for the detection of Listeria monocytogenes in dairy products. Food Microbiol. 2020, 92, 103570. [Google Scholar] [CrossRef] [Scilit]
- Crannell, Z.A.; Castellanos-Gonzales, A.; Nair, G.; Mejia, R.; White, A.C.; Richards-Kortum, R. A multiplexed recombinase polymerase amplification assay to detect intestinal protozoa. Anal. Chem. 2016, 88, 1610–1616. [Google Scholar] [CrossRef] [Scilit]
- Schneider, P.; Wolters, L.; Schoone, G.; Schallig, H.; Sillekens, P.; Hermsen, R.; Sauerwein, R. Real-time nucleic acid sequence-based amplification is more convenient than real-time PCR for quantification of Plasmodium falciparum. J. Clin. Microbiol. 2005, 43, 402–405. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Xu, Y.; Fohlerova, Z.; Chang, H.; Iliescu, C.; Neuzil, P. LAMP-on-a-chip: Revising microfluidic platforms for loop-mediated DNA amplification. TrAC Trends Anal. Chem. 2019, 113, 44–53. [Google Scholar] [CrossRef] [Scilit]
- Puri, M.; Kaur, B.H.; Madan, E.; Srinivasan, R.; Rawat, K.; Gorthi, S.S.; Kumari, G.; Sah, R.; Ojha, S.B.; Panigrahi, S.; et al. Rapid diagnosis of Plasmodium falciparum malaria using a point-of-care loop-mediated isothermal amplification device. Front. Cell. Infect. Microbiol. 2022, 12, 961832. [Google Scholar] [CrossRef] [Scilit]
- Notomi, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, 12. [Google Scholar] [CrossRef] [Scilit]
- Goto, M.; Honda, E.; Ogura, A.; Nomoto, A.; Hanaki, K.I. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 2009, 46, 167–172. [Google Scholar] [CrossRef] [Scilit]
- Tanner, N.A.; Zhang, Y.; Evans, T.C. Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes. BioTechniques 2015, 58, 59–68. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Cao, J.; Zhu, M.; Xu, M.; Shi, F. Loop-mediated isothermal amplification-lateral-flow dipstick (LAMP-LFD) to detect Mycoplasma ovipneumoniae. World J. Microbiol. Biotechnol. 2019, 35, 31. [Google Scholar] [CrossRef] [Scilit]
- Xue, Y.; Kong, Q.; Ding, H.; Xie, C.; Zheng, B.; Zhuo, X.; Ding, J.; Tong, Q.; Lou, D.; Lu, S.; et al. A novel loop-mediated isothermal amplification-lateral-flow-dipstick (LAMP-LFD) device for rapid detection of Toxoplasma gondii in the blood of stray cats and dogs. Parasite. 2021, 28, 41. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Li, Q.; Wang, S.; Chen, X.; Du, A. Rapid and sensitive detection of Babesia bovis and Babesia bigemina by loop-mediated isothermal amplification combined with a lateral flow dipstick. Vet. Parasitol. 2016, 219, 71–76. [Google Scholar] [CrossRef] [Scilit]
- Njiru, Z.K. Rapid and sensitive detection of human African trypanosomiasis by loop-mediated isothermal amplification combined with a lateral-flow dipstick. Diagn. Microbiol. Infect. Dis. 2011, 69, 205–209. [Google Scholar] [CrossRef] [Scilit]
- Jiao, W.W.; Wang, Y.; Wang, G.R.; Wang, Y.C.; Xiao, J.; Sun, L.; Li, J.Q.; Wen, S.A.; Zhang, T.T.; Ma, Q.; et al. Development and clinical validation of multiple cross displacement amplification combined with nanoparticles-based biosensor for detection of Mycobacterium tuberculosis: Preliminary results. Front. Microbiol. 2019, 10, 2135. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Liu, Y.; Wang, Y.; Chen, H.; Liu, C.; Wang, Y. Lateral flow biosensor combined with loop-mediated isothermal amplification for simple, rapid, sensitive, and reliable detection of Brucella spp. Infect. Drug Resist. 2019, 12, 2343–2353. [Google Scholar] [CrossRef] [Scilit]
- Zou, Y.; Mason, M.G.; Wang, Y.; Wee, E.; Turni, C.; Blackall, P.J.; Trau, M.; Botella, J.R. Nucleic acid purification from plants, animals and microbes in under 30 seconds. PloS Biol. 2017, 15, e2003916. [Google Scholar] [CrossRef] [Scilit]
- Naseri, M.; Ziora, Z.M.; Simon, G.P.; Batchelor, W. Assured-compliant point-of-care diagnostics for the detection of human viral infections. Rev. Med. Virol. 2021, 32, 2. [Google Scholar] [CrossRef] [Scilit]
- Otoo, J.A.; Schlappi, T.S. REASSURED Multiplex Diagnostics: A critical review and forecast. Biosensors 2022, 12, 124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kettler, H.; White, K.; Hawkes, S. Mapping the Landscape of Diagnostics for Sexually Transmitted Infections: Key Findings and Recommendations. World Health Organization. 2004. Available online: https://apps.who.int/iris/handle/10665/68990 (accessed on 10 February 2021).
- Snounou, G.; Viriyakosol, S.; Zhu, X.P.; Jarra, W.; Pinheiro, L.; do Rosario, V.E.; Thaithong, S.; Brown, K.N. High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Mol. Biochem. Parasitol. 1993, 61, 315–320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Imwong, M.; Tanomsing, N.; Pukrittayakamee, S.; Day, N.P.J.; White, N.J.; Snounou, G. Spurious amplification of a Plasmodium vivax small-subunit RNA gene by use of primers currently used to detect P. knowlesi. J. Clin. Microbiol. 2009, 47, 4173–4175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hajian-Tilaki, K. Sample size estimation in diagnostic test studies of biomedical informatics. J. Biomed. Inform. 2014, 48, 193–204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hermanson, G.T. Microparticles and nanoparticles. In Bioconjugate Techniques; Academic Press: Cambridge, MA, USA, 2008; pp. 582–626. [Google Scholar] [CrossRef] [Scilit]
- Yokota, S. Preparation of colloidal gold particles and conjugation to protein A/g/L, IGG, F(AB′)2, and streptavidin. Methods Mol. Biol. 2016, 1476, 61–71. [Google Scholar] [CrossRef] [Scilit]
- Lau, Y.L.; Lai, M.Y.; Fong, M.Y.; Jelip, J.; Mahmud, R. Loop-mediated isothermal amplification assay for identification of five human Plasmodium species in Malaysia. Am. J. Trop. Med. Hyg. 2016, 94, 336–339. [Google Scholar] [CrossRef] [Scilit]
- Singh, B.; Daneshvar, C. Human infections and detection of Plasmodium knowlesi. Clin. Microbiol. Rev. 2013, 26, 165–184. [Google Scholar] [CrossRef] [Scilit]
- Sharma, S.; Kumar, S.; Ahmed, M.Z.; Bhardwaj, N.; Singh, J.; Kumari, S.; Savargaonkar, D.; Anvikar, A.R.; Das, J. Advanced multiplex loop-mediated isothermal amplification (mLAMP) combined with lateral flow detection (LFD) for rapid detection of two prevalent malaria species in India and melting curve analysis. Diagnostics 2021, 12, 32. [Google Scholar] [CrossRef] [Scilit]
- Yongkiettrakul, S.; Jaroenram, W.; Arunrut, N.; Chareanchim, W.; Pannengpetch, S.; Suebsing, R.; Kiatpathomchai, W.; Pornthanakasem, W.; Yuthavong, Y.; Kongkasuriyachai, D. Application of loop-mediated isothermal amplification assay combined with lateral flow dipstick for detection of Plasmodium falciparum and Plasmodium vivax. Parasitol. Int. 2014, 63, 777–784. [Google Scholar] [CrossRef] [Scilit]
- Mallepaddi, P.C.; Lai, M.Y.; Podha, S.; Ooi, C.H.; Liew, J.W.; Polavarapu, R.; Lau, Y.L. Development of loop-mediated isothermal amplification-based lateral flow device method for the detection of malaria. Am. J. Trop. Med. Hyg. 2018, 99, 704–708. [Google Scholar] [CrossRef] [Scilit]




| Species | Primer | Sequence 5’ to 3’ |
|---|---|---|
| Plasmodium spp. | FIP | TACGGCCCGACGGTAAGATCGTAACCATGCCAACAC |
| BIP | AGGAGTCTCACACTAGCGACAAAATTCCTTGTCGGGTAATCTC | |
| FLP | Biotin-CCGTCATAGCCATGTTAG | |
| BLP | DIG-ACCACATCTAAGGAAGGCAG | |
| F3 | TGTCAACTACCATGTTACGAC | |
| B3 | AACGGTCCTAAGGTAGCAA | |
| P. knowlesi | FIP | GTTGTTGCCTTAAACTTCCTTGTGTTCTTGATTGTAAAGCTTCTTAGAGG |
| BIP | TGATGTCCTTAGATGAACTAGGCTTTGCAAGCAGCTAAAATCGT | |
| FLP | Biotin-TAGACACACATCGTT | |
| BLP | FAM-GCACGCGTGCTACACT | |
| F3 | CCATCTATTTCTTTTTTGCGTATG | |
| B3 | CAGTGGAGGAAAAGTACGAA | |
| P. vivax | FIP | GCCATGTTAGGCCAATACCCTAATGTGTGTATCAATCGAGTTTCT |
| BIP | TAACGGGGAATTAGAGTTCGATTCCTGTAATTTACGCGCCTGCT | |
| FLP | Biotin-CATCAAAAGCTGATAGGTC | |
| BLP | DNP-GGAGAGGGAGCCTGAGAAATAGC | |
| F3 | AGCGACACGTAATGGATC | |
| B3 | CTTGTCACTACCTCTCTTCT | |
| P. falciparum | FIP | AGTAGTCCGTCTCCAGAAAATCTTACTTTGGGGGCATTCGTATT |
| BIP | GCGAAAGCATTTGCCTAATCTATTTAAGATTACGACGGTATCTGATC | |
| FLP | Biotin-TCACCTCTGACATCTG | |
| BLP | Cy5- GTTAAGGGAGTGAAGACG | |
| F3 | GCTTAGTTACGATTAATAGGAGTA | |
| B3 | AGTCGGCATAGTTTATGGT |
| Multiplex LAMP-LF | Microscopy | ||||||
|---|---|---|---|---|---|---|---|
| Pf | Pk | Pv | Pm | Po | Negative | No. Cases by Multiplex LAMP-LF | |
| Pf | 9 | 0 | 0 | 0 | 0 | 0 | 9 |
| Pk | 0 | 26 | 0 | 0 | 0 | 0 | 26 |
| Pv | 0 | 0 | 9 | 0 | 0 | 0 | 9 |
| Pm | 0 | 0 | 0 | 2 | 0 | 0 | 2 |
| Po | 0 | 0 | 0 | 0 | 2 | 0 | 2 |
| Negative | 0 | 0 | 0 | 0 | 0 | 20 | 20 |
| Total | 9 | 26 | 9 | 2 | 2 | 20 | 68 |
| Samples | Microscopy | Nested PCR | Multiplex LAMP-LF | |
|---|---|---|---|---|
| P. knowlesi | Positive | 31 + β1 | #1 + *1 + 31 | *1 + β1 + 31 |
| Negative | 0 | 0 | 0 | |
| P. falciparum | Positive | *1 + 2 | 2 | 2 |
| Negative | 0 | 0 | 0 | |
| P. vivax | Positive | 7 | α1 + 7 | 7 |
| Negative | 0 | 0 | 0 | |
| Negative | Positive | 0 | 0 | 0 |
| Negative | #1 + α1 + 42 | 42 + β1 | #1 + α1 + 42 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lai, M.Y.; Zen, L.P.Y.; Abdul Hamid, M.H.; Jelip, J.; Mudin, R.N.; Ivan, V.J.S.; Francis, L.N.P.; Saihidi, I.; Lau, Y.L. Point-of-Care Diagnosis of Malaria Using a Simple, Purification-Free DNA Extraction Method Coupled with Loop-Mediated Isothermal Amplification-Lateral Flow. Trop. Med. Infect. Dis. 2023, 8, 199. https://doi.org/10.3390/tropicalmed8040199
Lai MY, Zen LPY, Abdul Hamid MH, Jelip J, Mudin RN, Ivan VJS, Francis LNP, Saihidi I, Lau YL. Point-of-Care Diagnosis of Malaria Using a Simple, Purification-Free DNA Extraction Method Coupled with Loop-Mediated Isothermal Amplification-Lateral Flow. Tropical Medicine and Infectious Disease. 2023; 8(4):199. https://doi.org/10.3390/tropicalmed8040199
Chicago/Turabian StyleLai, Meng Yee, Lee Phone Youth Zen, Mohd Hafizi Abdul Hamid, Jenarun Jelip, Rose Nani Mudin, Vun Jan Shui Ivan, Lee Ngie Ping Francis, Izreena Saihidi, and Yee Ling Lau. 2023. "Point-of-Care Diagnosis of Malaria Using a Simple, Purification-Free DNA Extraction Method Coupled with Loop-Mediated Isothermal Amplification-Lateral Flow" Tropical Medicine and Infectious Disease 8, no. 4: 199. https://doi.org/10.3390/tropicalmed8040199
APA StyleLai, M. Y., Zen, L. P. Y., Abdul Hamid, M. H., Jelip, J., Mudin, R. N., Ivan, V. J. S., Francis, L. N. P., Saihidi, I., & Lau, Y. L. (2023). Point-of-Care Diagnosis of Malaria Using a Simple, Purification-Free DNA Extraction Method Coupled with Loop-Mediated Isothermal Amplification-Lateral Flow. Tropical Medicine and Infectious Disease, 8(4), 199. https://doi.org/10.3390/tropicalmed8040199
