Culture-Independent Quantitative PCR Detected Mobilized Colistin Resistance Genes (mcr-1, mcr-2, mcr-3, mcr-4, and mcr-5) in Chicken Gut Contents in Bangladesh
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Area and Sampling
2.2. DNA Extraction from Chicken Gut Samples
2.3. Primer Design for Assessing ARGs
2.4. Optimization of qPCR Conditions for mcr-1 to mcr-5 Assays
2.5. Efficiency and Validation of qPCR Assays
2.6. Statistical Analysis
3. Results
3.1. Study Farms and Samples
3.2. Analytical Performance of mcr-1 to mcr-5 RT-PCR Assays
3.3. Distribution of mcr Genes in Chicken Gut Samples
3.4. Comparative Distribution of mcr Genes in Farm and Backyard Chicken Droppings
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- OECD/FAO. OECD-FAO Agricultural Outlook 2021–2030; OECD Agriculture Statistics (Database). 2021. Available online: https://www.oecd-ilibrary.org/agriculture-and-food/data/oecd-agriculture-statistics/oecd-fao-agricultural-outlook-edition-2021_4bde2d83-en (accessed on 3 August 2024).
- OECD/FAO. OECD-FAO Agricultural Outlook 2024–2033; OECD Agriculture Statistics (Database). 2024. Available online: https://www.oecd-ilibrary.org/agriculture-and-food/oecd-fao-agricultural-outlook-2024-2033_4c5d2cfb-en (accessed on 3 August 2024).
- Mulchandani, R.; Wang, Y.; Gilbert, M.; Van Boeckel, T.P. Global trends in antimicrobial use in food-producing animals: 2020 to 2030. PLOS Glob. Public Health 2023, 3, e0001305. [Google Scholar] [CrossRef] [PubMed]
- WOAH. Annual Report on Antimicrobial Agents Intended for Use in Animals, 7th Report; World Organization for Animal Health: Paris, France, 2023. [Google Scholar]
- WOAH. Annual Report on Antimicrobial Agents Intended for Use in Animals, 8th Report; World Organization for Animal Health: Paris, France, 2024. [Google Scholar]
- Van Boeckel, T.P.; Glennon, E.E.; Chen, D.; Gilbert, M.; Robinson, T.P.; Grenfell, B.T.; Levin, S.A.; Bonhoeffer, S.; Laxminarayan, R. Reducing antimicrobial use in food animals. Science 2017, 357, 1350–1352. [Google Scholar] [CrossRef] [PubMed]
- Tiseo, K.; Huber, L.; Gilbert, M.; Robinson, T.P.; Van Boeckel, T.P. Global trends in antimicrobial use in food animals from 2017 to 2030. Antibiotics 2020, 9, 918. [Google Scholar] [CrossRef] [PubMed]
- Ardakani, Z.; Canali, M.; Aragrande, M.; Tomassone, L.; Simoes, M.; Balzani, A.; Beber, C.L. Evaluating the contribution of antimicrobial use in farmed animals to global antimicrobial resistance in humans. One Health 2023, 17, 100647. [Google Scholar] [CrossRef]
- Hoelzer, K.; Wong, N.; Thomas, J.; Talkington, K.; Jungman, E.; Coukell, A. Antimicrobial drug use in food-producing animals and associated human health risks: What, and how strong, is the evidence? BMC Vet. Res. 2017, 13, 1–38. [Google Scholar] [CrossRef]
- Levy, S.B. Factors impacting on the problem of antibiotic resistance. J. Antimicrob. Chemother. 2002, 49, 25–30. [Google Scholar] [CrossRef]
- Nobrega, D.B.; Tang, K.L.; Caffrey, N.P.; De Buck, J.; Cork, S.C.; Ronksley, P.E.; Polachek, A.J.; Ganshorn, H.; Sharma, N.; Kastelic, J.P. Prevalence of antimicrobial resistance genes and its association with restricted antimicrobial use in food-producing animals: A systematic review and meta-analysis. J. Antimicrob. Chemother. 2021, 76, 561–575. [Google Scholar] [CrossRef] [PubMed]
- Oloso, N.O.; Fagbo, S.; Garbati, M.; Olonitola, S.O.; Awosanya, E.J.; Aworh, M.K.; Adamu, H.; Odetokun, I.A.; Fasina, F.O. Antimicrobial resistance in food animals and the environment in Nigeria: A review. Int. J. Environ. Res. Public Health 2018, 15, 1284. [Google Scholar] [CrossRef]
- Ali, R.I.; El-Abdelaziz, S.A.; Kamel, M.A.; Murad, S.K.; Abdallah, H.M.; Salem, G.A. Phenotypic and genotypic characterization of extended spectrum beta-lactamase producing E. coli harboring carbapenem and colistin-resistant genes from poultry farms in Egypt. Open Vet. J. 2024, 14, 459. [Google Scholar] [CrossRef]
- WHO. Critically Important Antimicrobials for Human Medicine, 6th ed.; World Health Organization: Geneva, Switzerland, 2019. [Google Scholar]
- Sharland, M.; Gandra, S.; Huttner, B.; Moja, L.; Pulcini, C.; Zeng, M.; Mendelson, M.; Cappello, B.; Cooke, G.; Magrini, N. Encouraging AWaRe-ness and discouraging inappropriate antibiotic use—The new 2019 Essential Medicines List becomes a global antibiotic stewardship tool. Lancet Infect. Dis. 2019, 19, 1278–1280. [Google Scholar] [CrossRef]
- Zanichelli, V.; Sharland, M.; Cappello, B.; Moja, L.; Getahun, H.; Pessoa-Silva, C.; Sati, H.; van Weezenbeek, C.; Balkhy, H.; Simão, M. The WHO AWaRe (Access, Watch, Reserve) antibiotic book and prevention of antimicrobial resistance. Bull. World Health Organ. 2023, 101, 290. [Google Scholar] [CrossRef]
- Davies, R.; Wales, A. Antimicrobial resistance on farms: A review including biosecurity and the potential role of disinfectants in resistance selection. Compr. Rev. Food Sci. Food Saf. 2019, 18, 753–774. [Google Scholar] [CrossRef]
- EMA Committee for Medicinal Products for Veterinary Use (CVMP) and EFSA Panel on Biological Hazards (BIOHAZ); Murphy, D.; Ricci, A.; Auce, Z.; Beechinor, J.G.; Bergendahl, H.; Breathnach, R.; Bureš, J.; Duarte Da Silva, J.P.; Hederová, J.; et al. EMA and EFSA Joint Scientific Opinion on measures to reduce the need to use antimicrobial agents in animal husbandry in the European Union, and the resulting impacts on food safety (RONAFA). EFSA J. 2017, 15, e04666. [Google Scholar] [PubMed]
- Armbruster, W.J.; Roberts, T. The political economy of US antibiotic use in animal feed. Food Saf. Econ. 2018, 293–322. [Google Scholar] [CrossRef]
- Laxminarayan, R.; Van Boeckel, T.; Teillant, A. The Economic Costs of Withdrawing Antimicrobial Growth Promoters from the Livestock Sector; OECD Food, Agriculture and Fisheries Papers, No. 78; OECD Publishing: Paris, France, 2015. [Google Scholar] [CrossRef]
- DGDA. Banning of Veterinary Antibiotic Combination in Bangladesh. 2019. Available online: https://dgdagov.info/ (accessed on 3 August 2024).
- Sarker, S.; Neeloy, R.M.; Habib, M.B.; Urmi, U.L.; Asad, M.A.; Mosaddek, A.S.M.; Khan, M.R.K.; Nahar, S.; Godman, B.; Islam, S. Mobile Colistin-Resistant Genes mcr-1, mcr-2, and mcr-3 Identified in Diarrheal Pathogens among Infants, Children, and Adults in Bangladesh: Implications for the Future. Antibiotics 2024, 13, 534. [Google Scholar] [CrossRef]
- Velkov, T.; Thompson, P.E.; Nation, R.L.; Li, J. Structure-activity relationships of polymyxin antibiotics. J. Med. Chem. 2010, 53, 1898–1916. [Google Scholar] [CrossRef]
- Bialvaei, A.Z.; Samadi Kafil, H. Colistin, mechanisms and prevalence of resistance. Curr. Med. Res. Opin. 2015, 31, 707–721. [Google Scholar] [CrossRef]
- Timmermans, M.; Wattiau, P.; Denis, O.; Boland, C. Colistin resistance genes mcr-1 to mcr-5, including a case of triple occurrence (mcr-1, -3 and -5), in Escherichia coli isolates from faeces of healthy pigs, cattle and poultry in Belgium, 2012–2016. Int. J. Antimicrob. Agents 2021, 57, 106350. [Google Scholar] [CrossRef]
- Liu, Y.Y.; Wang, Y.; Walsh, T.R.; Yi, L.X.; Zhang, R.; Spencer, J.; Doi, Y.; Tian, G.; Dong, B.; Huang, X.; et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef]
- Hembach, N.; Schmid, F.; Alexander, J.; Hiller, C.; Rogall, E.T.; Schwartz, T. Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany. Front. Microbiol. 2017, 8, 1282. [Google Scholar] [CrossRef]
- Hadjadj, L.; Riziki, T.; Zhu, Y.; Li, J.; Diene, S.M.; Rolain, J.M. Study of mcr-1 Gene-Mediated Colistin Resistance in Enterobacteriaceae Isolated from Humans and Animals in Different Countries. Genes 2017, 8, 394. [Google Scholar] [CrossRef] [PubMed]
- Hussein, N.H.; Al-Kadmy, I.M.; Taha, B.M.; Hussein, J.D. Mobilized colistin resistance (mcr) genes from 1 to 10: A comprehensive review. Mol. Biol. Rep. 2021, 48, 2897–2907. [Google Scholar] [CrossRef]
- Xu, T.; Song, J.; Liu, J.; Huang, L.; Li, Z.; Zhou, K. First report of multidrug-resistant carbapenemase-producing Aeromonas caviae co-harboring mcr-3.43 and mcr-7.2. Microbiol. Spectr. 2024, 12, e0368523. [Google Scholar] [CrossRef] [PubMed]
- Lv, D.; Duan, R.; Fan, R.; Mu, H.; Liang, J.; Xiao, M.; He, Z.; Qin, S.; Yang, J.; Jing, H. bla NDM and mcr-1 to mcr-5 Gene Distribution Characteristics in Gut Specimens from Different Regions of China. Antibiotics 2021, 10, 233. [Google Scholar] [CrossRef]
- Huang, X.; Yu, L.; Chen, X.; Zhi, C.; Yao, X.; Liu, Y.; Wu, S.; Guo, Z.; Yi, L.; Zeng, Z.; et al. High Prevalence of Colistin Resistance and mcr-1 Gene in Escherichia coli Isolated from Food Animals in China. Front. Microbiol. 2017, 8, 562. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Tian, G.B.; Zhang, R.; Shen, Y.; Tyrrell, J.M.; Huang, X.; Zhou, H.; Lei, L.; Li, H.Y.; Doi, Y.; et al. Prevalence, risk factors, outcomes, and molecular epidemiology of mcr-1-positive Enterobacteriaceae in patients and healthy adults from China: An epidemiological and clinical study. Lancet Infect. Dis. 2017, 17, 390–399. [Google Scholar] [CrossRef] [PubMed]
- Walsh, T.R.; Wu, Y. China bans colistin as a feed additive for animals. Lancet Infect. Dis. 2016, 16, 1102–1103. [Google Scholar] [CrossRef]
- Ribeiro, S.; Mourão, J.; Novais, Â.; Campos, J.; Peixe, L.; Antunes, P. From farm to fork: Colistin voluntary withdrawal in Portuguese farms reflected in decreasing occurrence of mcr-1-carrying Enterobacteriaceae from chicken meat. Environ. Microbiol. 2021, 23, 7563–7577. [Google Scholar] [CrossRef]
- Usui, M.; Nozawa, Y.; Fukuda, A.; Sato, T.; Yamada, M.; Makita, K.; Tamura, Y. Decreased colistin resistance and mcr-1 prevalence in pig-derived Escherichia coli in Japan after banning colistin as a feed additive. J. Glob. Antimicrob. Resist. 2021, 24, 383–386. [Google Scholar] [CrossRef]
- Wang, Y.; Xu, C.; Zhang, R.; Chen, Y.; Shen, Y.; Hu, F.; Liu, D.; Lu, J.; Guo, Y.; Xia, X. Changes in colistin resistance and mcr-1 abundance in Escherichia coli of animal and human origins following the ban of colistin-positive additives in China: An epidemiological comparative study. Lancet Infect. Dis. 2020, 20, 1161–1171. [Google Scholar] [CrossRef]
- Umair, M.; Hassan, B.; Farzana, R.; Ali, Q.; Sands, K.; Mathias, J.; Afegbua, S.; Haque, M.N.; Walsh, T.R.; Mohsin, M. International manufacturing and trade in colistin, its implications in colistin resistance and One Health global policies: A microbiological, economic, and anthropological study. Lancet Microbe 2023, 4, e264–e276. [Google Scholar] [CrossRef] [PubMed]
- Valiakos, G.; Kapna, I. Colistin resistant mcr genes prevalence in livestock animals (swine, bovine, poultry) from a multinational perspective. A systematic review. Vet. Sci. 2021, 8, 265. [Google Scholar] [CrossRef] [PubMed]
- El-Sayed Ahmed, M.A.E.-G.; Zhong, L.-L.; Shen, C.; Yang, Y.; Doi, Y.; Tian, G.-B. Colistin and its role in the Era of antibiotic resistance: An extended review (2000–2019). Emerg. Microbes Infect. 2020, 9, 868–885. [Google Scholar] [CrossRef]
- Nang, S.C.; Li, J.; Velkov, T. The rise and spread of mcr plasmid-mediated polymyxin resistance. Crit. Rev. Microbiol. 2019, 45, 131–161. [Google Scholar] [CrossRef]
- Binsker, U.; Oelgeschlager, K.; Neumann, B.; Werner, G.; Kasbohrer, A.; Hammerl, J.A. Genomic Evidence of mcr-1.26 IncX4 Plasmid Transmission between Poultry and Humans. Microbiol. Spectr. 2023, 11, e0101523. [Google Scholar] [CrossRef]
- Papathanakos, G.; Andrianopoulos, I.; Papathanasiou, A.; Priavali, E.; Koulenti, D.; Koulouras, V. Colistin-resistant Acinetobacter baumannii bacteremia: A serious threat for critically ill patients. Microorganisms 2020, 8, 287. [Google Scholar] [CrossRef]
- Capone, A.; Giannella, M.; Fortini, D.; Giordano, A.; Meledandri, M.; Ballardini, M.; Venditti, M.; Bordi, E.; Capozzi, D.; Balice, M. High rate of colistin resistance among patients with carbapenem-resistant Klebsiella pneumoniae infection accounts for an excess of mortality. Clin. Microbiol. Infect. 2013, 19, E23–E30. [Google Scholar] [CrossRef] [PubMed]
- Shields, R.K.; Paterson, D.L.; Tamma, P.D. Navigating available treatment options for carbapenem-resistant Acinetobacter baumannii-calcoaceticus complex infections. Clin. Infect. Dis. 2023, 76, S179–S193. [Google Scholar] [CrossRef]
- Kon, H.; Hameir, A.; Nutman, A.; Temkin, E.; Keren Paz, A.; Lellouche, J.; Schwartz, D.; Weiss, D.S.; Kaye, K.S.; Daikos, G.L. Prevalence and clinical consequences of colistin heteroresistance and evolution into full resistance in carbapenem-resistant Acinetobacter baumannii. Microbiol. Spectr. 2023, 11, e05093-22. [Google Scholar] [CrossRef]
- Li, J.; Shi, X.; Yin, W.; Wang, Y.; Shen, Z.; Ding, S.; Wang, S. A multiplex SYBR green real-time PCR assay for the detection of three colistin resistance genes from cultured bacteria, feces, and environment samples. Front. Microbiol. 2017, 8, 2078. [Google Scholar] [CrossRef]
- Tolosi, R.; Apostolakos, I.; Laconi, A.; Carraro, L.; Grilli, G.; Cagnardi, P.; Piccirillo, A. Rapid detection and quantification of plasmid-mediated colistin resistance genes (mcr-1 to mcr-5) by real-time PCR in bacterial and environmental samples. J. Appl. Microbiol. 2020, 129, 1523–1529. [Google Scholar] [CrossRef] [PubMed]
- Gehring, R.; Mochel, J.P.; Schmerold, I. Understanding the background and clinical significance of the WHO, WOAH, and EMA classifications of antimicrobials to mitigate antimicrobial resistance. Front. Vet. Sci. 2023, 10, 1153048. [Google Scholar] [CrossRef] [PubMed]
- Unicomb, L.E.; Nizame, F.A.; Uddin, M.R.; Nahar, P.; Lucas, P.J.; Khisa, N.; Akter, S.M.S.; Islam, M.A.; Rahman, M.; Rousham, E.K. Motivating antibiotic stewardship in Bangladesh: Identifying audiences and target behaviours using the behaviour change wheel. BMC Public Health 2021, 21, 968. [Google Scholar] [CrossRef] [PubMed]
- Islam, M.A.; Akhtar, Z.; Hassan, M.Z.; Chowdhury, S.; Rashid, M.M.; Aleem, M.A.; Ghosh, P.K.; Mah, E.M.S.; Parveen, S.; Ahmmed, M.K.; et al. Pattern of Antibiotic Dispensing at Pharmacies According to the WHO Access, Watch, Reserve (AwaRe) Classification in Bangladesh. Antibiotics 2022, 11, 247. [Google Scholar] [CrossRef]
- Islam, S.; Urmi, U.L.; Rana, M.; Sultana, F.; Jahan, N.; Hossain, B.; Iqbal, S.; Hossain, M.M.; Mosaddek, A.S.M.; Nahar, S. High abundance of the colistin resistance gene mcr-1 in chicken gut-bacteria in Bangladesh. Sci. Rep. 2020, 10, 17292. [Google Scholar] [CrossRef]
- Nadkarni, M.A.; Martin, F.E.; Jacques, N.A.; Hunter, N. Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology 2002, 148, 257–266. [Google Scholar] [CrossRef]
- Rutledge, R.; Cote, C. Mathematics of quantitative kinetic PCR and the application of standard curves. Nucleic Acids Res. 2003, 31, e93. [Google Scholar] [CrossRef]
- Skandalis, N.; Maeusli, M.; Papafotis, D.; Miller, S.; Lee, B.; Theologidis, I.; Luna, B. Environmental spread of antibiotic resistance. Antibiotics 2021, 10, 640. [Google Scholar] [CrossRef]
- Martinez, J.L. The role of natural environments in the evolution of resistance traits in pathogenic bacteria. Proc. R. Soc. B 2009, 276, 2521–2530. [Google Scholar] [CrossRef]
- Normark, B.H.; Normark, S. Evolution and spread of antibiotic resistance. J. Intern. Med. 2002, 252, 91–106. [Google Scholar] [CrossRef]
- Gillings, M.R.; Stokes, H. Are humans increasing bacterial evolvability? Trends Ecol. Evol. 2012, 27, 346–352. [Google Scholar] [CrossRef] [PubMed]
- Larsson, D.; Flach, C.-F. Antibiotic resistance in the environment. Nat. Rev. Microbiol. 2022, 20, 257–269. [Google Scholar] [CrossRef]
- Mendelson, M.; Brink, A.; Gouws, J.; Mbelle, N.; Naidoo, V.; Pople, T.; Schellack, N.; van Vuuren, M.; Rees, H.; Banoo, S. The One Health stewardship of colistin as an antibiotic of last resort for human health in South Africa. Lancet Infect. Dis. 2018, 18, e288–e294. [Google Scholar] [CrossRef]
- Uddin, M.B.; Alam, M.N.; Hasan, M.; Hossain, S.B.; Debnath, M.; Begum, R.; Samad, M.A.; Hoque, S.F.; Chowdhury, M.S.R.; Rahman, M.M. Molecular detection of colistin resistance mcr-1 gene in multidrug-resistant Escherichia coli Isolated from chicken. Antibiotics 2022, 11, 97. [Google Scholar] [CrossRef] [PubMed]
- Dutta, A.; Islam, M.Z.; Barua, H.; Rana, E.A.; Jalal, M.S.; Dhar, P.K.; Das, A.; Das, T.; Sarma, S.M.; Biswas, S.K. Acquisition of plasmid-mediated colistin resistance gene mcr-1 in Escherichia coli of livestock origin in Bangladesh. Microb. Drug Resist. 2020, 26, 1058–1062. [Google Scholar] [CrossRef]
- Kawser, Z.; Shamsuzzaman, S. Association of Virulence with Antimicrobial Resistance among Klebsiella pneumoniae Isolated from Hospital Settings in Bangladesh. Int. J. Appl. Basic Med. Res. 2022, 12, 123–129. [Google Scholar] [CrossRef]
- Ara, B.; Urmi, U.L.; Haque, T.A.; Nahar, S.; Rumnaz, A.; Ali, T.; Alam, M.S.; Mosaddek, A.S.M.; Rahman, N.A.A.; Haque, M. Detection of mobile colistin-resistance gene variants (mcr-1 and mcr-2) in urinary tract pathogens in Bangladesh: The last resort of infectious disease management colistin efficacy is under threat. Expert Rev. Clin. Pharmacol. 2021, 14, 513–522. [Google Scholar] [CrossRef] [PubMed]
- Lagier, J.-C.; Edouard, S.; Pagnier, I.; Mediannikov, O.; Drancourt, M.; Raoult, D. Current and past strategies for bacterial culture in clinical microbiology. Clin. Microbiol. Rev. 2015, 28, 208–236. [Google Scholar] [CrossRef]
- Farzana, R.; Jones, L.S.; Barratt, A.; Rahman, M.A.; Sands, K.; Portal, E.; Boostrom, I.; Espina, L.; Pervin, M.; Uddin, A.N. Emergence of Mobile Colistin Resistance (mcr-8) in a Highly Successful Klebsiella pneumoniae Sequence Type 15 Clone from Clinical Infections in Bangladesh. Msphere 2020, 5, e00023-20. [Google Scholar] [CrossRef]
- Muktan, B.; Thapa Shrestha, U.; Dhungel, B.; Mishra, B.C.; Shrestha, N.; Adhikari, N.; Banjara, M.R.; Adhikari, B.; Rijal, K.R.; Ghimire, P. Plasmid mediated colistin resistant mcr-1 and co-existence of OXA-48 among Escherichia coli from clinical and poultry isolates: First report from Nepal. Gut Pathog. 2020, 12, 44 . [Google Scholar] [CrossRef]
- Hameed, F.; Khan, M.A.; Muhammad, H.; Sarwar, T.; Bilal, H.; Rehman, T.U. Plasmid-mediated mcr-1 gene in Acinetobacter baumannii and Pseudomonas aeruginosa: First report from Pakistan. Rev. Soc. Bras. Med. Trop. 2019, 52, e20190237. [Google Scholar] [CrossRef] [PubMed]
- Gogry, F.A.; Siddiqui, M.T.; Haq, Q.M.R. Emergence of mcr-1 conferred colistin resistance among bacterial isolates from urban sewage water in India. Environ. Sci. Pollut. Res. 2019, 26, 33715–33717. [Google Scholar] [CrossRef] [PubMed]
- MoHFW. National Action Plan: Antimicrobial Resistance Containment in Bangladesh 2017–2022; Ministry of Health and Family Welfare: Dhaka, Bangladesh, 2017. [Google Scholar]



| Primers | Sequences (5′-3′) | Amplicon Size (bp) | References |
|---|---|---|---|
| mcr-1-qf a | AAAGACGCGGTACAAGCAAC | 213 | [47,48] |
| mcr-1-qr b | GCTGAACATACACGGCACAG | ||
| mcr-2-qf | CGACCAAGCCGAGTCTAAGG | 92 | [47,48] |
| mcr-2-qr | CAACTGCGACCAACACACTT | ||
| mcr-3-qf | ACCTCCAGCGTGAGATTGTTCCA | 169 | [47,48] |
| mcr-3-qr | GCGGTTTCACCAACGACCAGAA | ||
| mcr-4-qf | AGAATGCCAGTCGTAACCCG | 230 | [48] |
| mcr-4-qr | GCGAGGATCATAGTCTGCCC | ||
| mcr-5-qf | CTGTGGCCAGTCATGGATGT | 98 | [48] |
| mcr-5-qr | CGAATGCCCGAGATGACGTA | ||
| 16S-qf c | CGGTGAATACGTTCYCGC | 467 | [48,53] |
| 16S-qr | GGWTACCTTGTTACGACTT |
| Types of Chickens | ||
|---|---|---|
| History of Antibiotic Usage in the Chickens over the Last Three Months | Poultry (n = 80), Number (%) | Household (n = 40), Number (%) |
| Oxytetracycline | 30 (37.5) | 2 (5.0) |
| Amoxicillin and oxytetracycline | 14 (17.5) | 0 |
| Amoxicillin, gentamicin, oxytetracycline, and ciprofloxacin | 26 (32.5) | 0 |
| Colistin, oxytetracycline, ciprofloxacin, and amoxicillin | 10 (12.5) | 0 |
| No major antibiotic used | 0 | 38 (95.0) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Al Asad, M.; Shuvo, M.S.H.; Mitu, S.Y.; Sumia; Zihadi, M.A.H.; Shanta, A.S.; Islam, N.; Nahar, S.; Godman, B.; Islam, S. Culture-Independent Quantitative PCR Detected Mobilized Colistin Resistance Genes (mcr-1, mcr-2, mcr-3, mcr-4, and mcr-5) in Chicken Gut Contents in Bangladesh. Sci 2024, 6, 76. https://doi.org/10.3390/sci6040076
Al Asad M, Shuvo MSH, Mitu SY, Sumia, Zihadi MAH, Shanta AS, Islam N, Nahar S, Godman B, Islam S. Culture-Independent Quantitative PCR Detected Mobilized Colistin Resistance Genes (mcr-1, mcr-2, mcr-3, mcr-4, and mcr-5) in Chicken Gut Contents in Bangladesh. Sci. 2024; 6(4):76. https://doi.org/10.3390/sci6040076
Chicago/Turabian StyleAl Asad, Mamun, Md Sarower Hossen Shuvo, Shomaia Yasmin Mitu, Sumia, Md Asief Hossain Zihadi, Ayasha Siddique Shanta, Nahidul Islam, Shamsun Nahar, Brian Godman, and Salequl Islam. 2024. "Culture-Independent Quantitative PCR Detected Mobilized Colistin Resistance Genes (mcr-1, mcr-2, mcr-3, mcr-4, and mcr-5) in Chicken Gut Contents in Bangladesh" Sci 6, no. 4: 76. https://doi.org/10.3390/sci6040076
APA StyleAl Asad, M., Shuvo, M. S. H., Mitu, S. Y., Sumia, Zihadi, M. A. H., Shanta, A. S., Islam, N., Nahar, S., Godman, B., & Islam, S. (2024). Culture-Independent Quantitative PCR Detected Mobilized Colistin Resistance Genes (mcr-1, mcr-2, mcr-3, mcr-4, and mcr-5) in Chicken Gut Contents in Bangladesh. Sci, 6(4), 76. https://doi.org/10.3390/sci6040076

