Next Article in Journal
Development of Reverse Transcriptase Recombinase Polymerase Amplification Combined with Lateral Flow Dipstick for Rapid Detection of Tilapia Lake Virus (TiLV): Pilot Study
Previous Article in Journal
Evaluation of the Preoperative Antiseptic Efficacy of Ozone on Dog Skin in Comparison with Traditional Methods
Previous Article in Special Issue
Escherichia coli Strains Originating from Raw Sheep Milk, with Special Reference to Their Genomic Characterization, Such as Virulence Factors (VFs) and Antimicrobial Resistance (AMR) Genes, Using Whole-Genome Sequencing (WGS)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Veterinary Sciences
Volume 12
Issue 9
10.3390/vetsci12090844
vetsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Serotyping and Antibiotic Resistance Profiles of Salmonella spp. and Listeria monocytogenes Strains Isolated from Pet Food and Feed Samples: A One Health Perspective †

by
Nikolaos D. Andritsos
1,*,
Antonia Mataragka
1,2,
Nikolaos Tzimotoudis
3,
Anastasia-Spyridoula Chatzopoulou
2,
Maria Kotsikori
2 and
John Ikonomopoulos
2
1
Department of Food Science and Technology, School of Agricultural Sciences, University of Patras, 2 G. Seferi Str., GR-30100 Agrinio, Greece
2
Laboratory of Anatomy and Physiology of Farm Animals, Department of Animal Science, School of Animal Biosciences, Agricultural University of Athens, 78 Iera Odos Str., GR-11855 Athens, Greece
3
Hellenic Army Biological Research Centre, 6 Taxiarchou Velliou Str., P. Penteli, GR-15236 Attica, Greece
*
Author to whom correspondence should be addressed.
†
This paper is an extended version of the conference paper: Mataragka, A.; Tzimotoudis, N.; Ikonomopoulos, J.; Andritsos, N.D. Phenotypic characterization and serotyping of Salmonella spp. and Listeria monocytogenes isolates from feed samples. In Proceedings of the 4th International Electronic Conference on Antibiotics, Online, 21–23 May 2025.
Vet. Sci. 2025, 12(9), 844; https://doi.org/10.3390/vetsci12090844 (registering DOI)
Submission received: 4 July 2025 / Revised: 25 August 2025 / Accepted: 29 August 2025 / Published: 1 September 2025
(This article belongs to the Special Issue Occurrence and Antimicrobial Resistance of Bacterial Pathogens in Primary Animal Food Production)
Browse Figures
Review Reports Versions Notes

Simple Summary

Salmonella and Listeria monocytogenes are two ubiquitous bacteria, pathogenic to animals and humans alike, that can be found in food and animal feeding stuff. Furthermore, antimicrobial resistance (AMR) is a growing global issue of great concern with serious public health implications. This work addresses the problem of detecting different serological variants of the above pathogens in pet food and feed, while also screening for antibiotic-resistant phenotypes among the microbial isolates. Three clinically important Salmonella serovars were identified in salmonellae strains recovered from pet food and feed samples (S. Enteritidis, S. Typhimurium, S. Thompson), whereas L. monocytogenes isolates were assigned to the four most prevalent serotypes of the pathogen encountered in foods (1/2a, 1/2b, 1/2c, 4b). Screening for AMR revealed the resistance to three out of nine tested antibiotics (33.3%) for Salmonella spp. (ampicillin, tetracycline, trimethoprim-sulfamethoxazole) and five out of seven antibiotics (71.4%) for L. monocytogenes (ciprofloxacin, meropenem, penicillin, tetracycline, trimethoprim-sulfamethoxazole). No multidrug resistance (MDR, i.e., resistance to at least three antimicrobial classes) was recorded in strains of Salmonella, but one strain of L. monocytogenes isolated from pet food was classified as an MDR strain. The results of the present study demonstrate the presence of AMR foodborne pathogenic bacteria in animal feeding stuffs, highlighting the potential of detecting antibiotic-resistant and MDR bacterial pathogens, such as Salmonella spp. and L. monocytogenes, in foods.

Abstract

Foodborne pathogenic bacteria, like Salmonella spp. and Listeria monocytogenes, can be detected in the primary food production environment. On the other hand, and in the current context of One Health, antimicrobial resistance (AMR) is gaining increased attention worldwide, as it poses significant threat to public health. The purpose of this study was to confirm the presence of Salmonella spp. and L. monocytogenes in pet food and feed samples, by means of biochemical and/or serological testing of the microbial isolates, and then to screen for AMR against a panel of selected antibiotics. Serotyping of the isolates with multiplex polymerase chain reaction revealed the presence of three of the most common clinical Salmonella serovars (S. Enteritidis, S. Typhimurium, S. Thompson) and the major epidemiologically important L. monocytogenes serotypes (1/2a, 1/2b, 1/2c, 4b) in 15 and 9 confirmed isolates of the pathogens, respectively. Strains of Salmonella spp. showed resistance to tetracycline (n = 3) and combined AMR to tetracycline with either ampicillin (n = 2) or trimethoprim-sulfamethoxazole (n = 3), without any multidrug resistance (MDR) being recorded whatsoever. AMR in L. monocytogenes was documented in 55.5% of the bacterial strains (n = 5) tested against ciprofloxacin, meropenem, penicillin, trimethoprim-sulfamethoxazole, and tetracycline. Alarmingly, one strain of L. monocytogenes was MDR to the latter five antibiotics and deemed resistant in three antibiotic groups (carbapenems, penicillins, tetracyclines), after exhibiting minimum inhibitory concentrations (MICs) to meropenem (MIC = 4 μg/mL), penicillin (MIC = 4 μg/mL), and tetracycline (MIC = 48 μg/mL). To the best of our knowledge, finding an MDR L. monocytogenes in pet food is something reported for the first time herein. The results presented in this study highlight the presence of important foodborne bacterial pathogens, such as Salmonella spp. and L. monocytogenes, with increased AMR to antibiotics and possible MDR at the primary production and at the farm level, due to the misuse of pharmacological substances used to treat zoonotic diseases, probably resulting in detection of resistant strains of these pathogenic bacteria in animal-originated food products (e.g., meat, milk, eggs).

1. Introduction

The European Food Safety Authority (EFSA) and the European Centre for Disease Control and Prevention (ECDC) publish each year the European Union (EU) summary report on trends and sources of zoonoses, zoonotic agents, and foodborne outbreaks. In this EU report, the term “One Health” has been included in its title from 2019 and onwards [1]. Therefore, the annual report can be found today under the ‘EU One Health zoonoses report’ title. According to the World Health Organization (WHO), One Health is an integrated, unifying approach that aims to sustainably balance and optimize the health of people, animals, and ecosystems [2]. It recognizes that the health of humans, domestic and wild animals, plants, and the wider environment (including ecosystems) are closely linked and interdependent (Figure 1). The One Health approach addresses the interconnection between people, animal, plants, and their shared environment [3].
Nowadays, the concept of One Health is attracting more and more the attention of scientists and statutory and regulatory authorities, since the transition of environmental contaminants and pollutants as well as human and animal pathogens from one circle to the other (Figure 1) is common and its effect has been widely proved (e.g., COVID-19 and other pandemics) [4]. Besides, in this concept, animal feed is considered as food and many human infections have been caused due to the exposure of people to microbial pathogens via handling contaminated pet food and pet treats [5] or through the consumption of contaminated raw food of animal origin (e.g., milk and meat).
Thus, in the current context of One Health, antimicrobial resistance (AMR) is also gaining increasing attention worldwide, as it poses significant threat to public health. The development of AMR in the primary animal food production environment is primarily related to the misuse of antibiotics during treatment of zoonoses [6,7]. Misuse of antibiotics may refer to (i) over-prescription of antibiotics (i.e., high dose/increased intake of antibiotic), (ii) not finishing the entire antibiotic scheme (i.e., low dose/decreased intake of antibiotic), (iii) overuse of antibiotics in livestock, and (iv) failure to comply with antibiotic treatment regimen and waiting times (withdrawal periods) for animals under antibiotic treatment. Whatever the case may be, microorganisms may end up developing resistance to the prescribed antibiotics, rendering them ineffective for treatment of animal disease.
Among other microorganisms, pathogenic bacteria can be found in the primary animal food production environment and feed as well. Increased AMR of bacterial pathogens in food animals can lead to human infections through the consumption of food with antibiotic-resistant microorganisms, which may confer diseases difficult to treat [8]. Moreover, increased AMR can be the result of cross-resistance developed in the food processing environment for some pathogens, when cells of the microorganisms are exposed to sublethal concentrations of residual disinfectants [9,10,11,12,13]. The most common microorganisms with documented AMR in the EU include Escherichia coli, Campylobacter jejuni, C. coli, Salmonella spp., and Staphylococcus aureus [6,8,14]. Foodborne pathogenic bacteria, like Salmonella spp. and Listeria monocytogenes, can be detected in the primary animal food production environment (e.g., breeding and dairy farms, slaughterhouses) and pet foods and feed [15,16,17,18,19,20,21,22]. Despite being a well-reputed biological hazard for its risk of infection, with a recorded case–fatality rate of circa 20% in humans [23], interestingly, L. monocytogenes is not included in the EU’s yearly monitoring on AMR in bacteria from humans, animals, and food [6].
Taking all the above into account, the aim of this work was to detect and identify serological variants for two of the most common foodborne pathogenic bacteria, namely Salmonella spp. and L. monocytogenes, in pet foods and feed and then to screen for AMR of these pathogens against a panel of selected antibiotics. To the best of our knowledge, this is the first attempt to systematically document the contamination status of Salmonella spp. and L. monocytogenes in pet foods and feed in Greece and highlight the serotypes and AMR profiles of the isolates.

2. Materials and Methods

2.1. Sampling, Pathogen Isolation, and Confirmation of the Isolates

Samples of commercial pet food (BARF, i.e., biologically appropriate raw food for dogs and cats), animal feed (fodder in the form of compressed and pelleted feeds, e.g., poultry feed), and a raw feed ingredient (chicken) were collected from January 2015 until May 2022 and microbiologically analyzed for the detection of Salmonella spp. and L. monocytogenes (Supplementary Tables S1 and S2). Sampling and microbiological analysis were conducted by Eurofins Athens Analysis Laboratories and the Hellenic Army Biological Research Centre. ISO 6579 and ISO 11290-1 protocols were used for the detection of Salmonella spp. [24,25] and L. monocytogenes [26] from the samples, respectively, as described elsewhere [27]. Briefly, Salmonella detection included the overnight pre-enrichment and final enrichment of the initial suspension of the sample in buffered peptone water (Merck, Darmstadt, Germany) and Rappaport-Vassiliadis broth (Merck) at 30 °C and 41.5 °C, respectively, followed by streaking in duplicate onto xylose lysine deoxycholate (XLD) agar (Merck). Detection of L. monocytogenes was carried out after primary and secondary enrichment in half-Fraser (BioKar Diagnostics, Pantin, France) and full concentration Fraser broth (BioKar Diagnosticks) at 30 °C for 24 h and at 37 °C for 48 h, respectively, followed by streaking in duplicate onto COMPASS® Listeria agar (Biokar Diagnostics). Suspect colonies of Salmonella on xylose lysine deoxycholate (XLD) agar (Merck) (i.e., black colonies with reddish transparent zone around them) were subcultured on nutrient agar (LabM, Lancashire, UK) for biochemical and serological confirmation of the isolates. Biochemical testing of the isolates took place by performing utilization of triple sugar iron (TSI) agar (Merck), urea agar (Merck), and L-lysine decarboxylation medium (LDC; Merck) [24,25], while it was also achieved by assigning isolates to the genus Salmonella using in parallel the RapID™ ONE System (Remel Inc., Thermo Fisher Scientific, San Diego, CA, USA) [28]. Isolates showing typical biochemical reactions for Salmonella spp. were subsequently serologically tested with a polyvalent slide agglutination test comprising of poly A-S+Vi and poly H antisera (Statens Serum Institute, Copenhagen, Denmark), for the presence of Salmonella O-antigen (somatic), H-antigen (flagellar), and Vi-antigen (capsular). Strains that were confirmed as Salmonella spp., showing typical biochemical reactions and positive/negative serological reactions to all or some of the antigens [25], were further typed to serovar level.
Colonies of presumptive L. monocytogenes on ALOA-type media (i.e., media formulated and performing like agar Listeria according to Ottaviani and Agosti), such as COMPASS® Listeria agar (Biokar Diagnostics) used in the study, were confirmed through biochemical testing of the isolates as previously described by Andritsos & Mataragas [29]. Strains that were confirmed as L. monocytogenes were further characterized to serogroup level [30,31].

2.2. Antimicrobial Susceptibility Testing (AST) and Antibiotic Resistance Profiles of Salmonella spp. and L. monocytogenes Strains

The antimicrobial susceptibility testing (AST) and antibiotic resistance of Salmonella spp. and L. monocytogenes pet food and feed isolates, along with the determination of minimum inhibitory concentration (MIC) for those antibiotics inducing resistance to any of the pathogens, were conducted using the Kirby–Bauer disk diffusion method for AST [32] and the E-test method for MIC determination to each specific antimicrobial agent [33], following the guidelines and criteria of the European Committee on Antimicrobial Susceptibility Testing (EUCAST v.15.0) [34]. The experimental procedure being followed was previously described in detail for L. monocytogenes [29] and was the same also for strains of Salmonella spp., with the exception of using Mueller–Hinton agar plates (MH; Oxoid, Basingstoke, UK) instead of MH agar plates supplemented with 5% defibrinated horse blood and 20 mg/L β-NAD (MH-F; Bioprepare, Keratea, Attica, Greece) that were used for AST of L. monocytogenes.
AST for bacterial pathogens comprised the following antibiotic disks supplied by Oxoid (Basingstoke): Salmonella strains were screened against amoxycillin-clavulanate (AMC; 30 μg), ampicillin (AMP; 10 μg), cefotaxime (CTX; 5 μg), cefoxitin (FOX; 30 μg), ceftazidime (CAZ; 10 μg), ciprofloxacin (CIP; 5 μg), gentamicin (CN; 10 μg), tetracycline (TE; 30 μg), and trimethoprim-sulfamethoxazole 1:19 (SXT; 25 μg), while AST for L. monocytogenes strains included screening against AMP (2 μg), benzylpenicillin (P; 1U), CIP (5 μg), erythromycin (E; 15 μg), meropenem (MEM; 10 μg), SXT (25 μg), and TE (30 μg).

2.3. Serotyping of Salmonella spp. and L. monocytogenes Isolates

DNA was extracted from the bacterial isolates by using a commercially available kit (Nucleospin® Tissue, Macheray-Nagel GmbH & Co. KG, Düren, Germany), as per the manufacturer’s instructions and as previously reported [35]. Serotyping of Salmonella spp. and L. monocytogenes isolates was achieved through multiplex polymerase chain reaction (mPCR). More specifically, serotyping of Salmonella strains was performed according to Shimizu et al. [36] for the detection of Salmonella serovars Enteritidis, Infantis, Typhimurium, and Thompson (Table 1A). Serotypes of L. monocytogenes were determined by applying the well-established protocol of Doumith et al. [30] for the identification and differentiation of the pathogen’s major serotypes 1/2a, 1/2b, 1/2c, and 4b in foods (Table 1B).

3. Results

3.1. Salmonella spp. and L. monocytogenes Isolates from Pet Food and Feed Samples

Twenty-four bacterial strains of Salmonella spp. (15 isolates) and L. monocytogenes (9 isolates), each isolate recovered from different sample of pet food, animal feed, or raw feed ingredient, were isolated from pet food and feed samples. Biochemical and/or serological testing of the isolates (Supplementary Tables S1 and S2) confirmed the presence of the aforementioned pathogens in the samples.

3.2. AST of Microbial Isolates

AST of the microbial isolates revealed that the majority of Salmonella strains exhibited resistance to TE (53.3%; 8/15 strains). Resistance was also recorded for Salmonella against AMP (13.3%) and SXT (20%) (Table 2A). All Salmonella isolates were found to be susceptible (100%) to AMC, CAZ, CIP, CN, CTX, and FOX, with susceptibility ratings for the remaining antibiotics (AMP, SXT, TE) ranging from 46.7% to 86.7% (Table 2A).
Regarding AST results for the nine L. monocytogenes isolates, the highest resistance was observed against SXT (55.6%; 5/9 strains). Resistance to other tested antibiotics ranged from 11.1% (MEM, P, TE) to 22.2% and 77.8% (i.e., strong and intermediate resistance to CIP, respectively) (Table 2B). All L. monocytogenes isolates were susceptible (100%) to AMP and E. Susceptibility to the remaining antibiotics varied, with percentages ranging from 0% for CIP to 88.9% for MEM, P, and TE (Table 2B).

3.3. Antibiotic Resistance Profiles of the Pet Food and Feed Bacterial Isolates

Out of the 15 Salmonella isolates, 8 exhibited resistances to at least one antibiotic (53.3%), with TE showing the highest resistance rate in Salmonella spp., as all 8 isolates were resistant to this particular antimicrobial (Figure 2a). Similarly, among the nine L. monocytogenes isolates, five exhibited strong resistance to at least one antibiotic (55.6%), with those five L. monocytogenes strains showing resistance against SXT (Figure 2b).
Regarding the appearance of AMR and multidrug resistance (MDR), five out of the eight Salmonella isolates and 33.3% of strains in total were, apart from TE, also resistant to one more antibiotic, either AMP or SXT (Figure 2a). None of the Salmonella strains met the criteria to be classified as an MDR strain, since non-susceptibility (i.e., resistance) to at least one agent from three antibiotic groups was not documented [37]. On the other hand, two out of the five L. monocytogenes isolates and 22.2% of strains in total were, apart from SXT, also highly resistant to at least CIP (Figure 2b). Moreover, one strain of L. monocytogenes (BF11) was identified as MDR since it demonstrated resistance to five antibiotics (CIP, MEM, P, SXT, TE) and more than three classes of antimicrobials (Figure 2b and Figure 3).
MICs for Salmonella strains isolated from pet food and feed, which presented resistance through AST, ranged from <0.016 to 96 μg/mL, whereas resistance was finally recorded against only one antibiotic, as seven out of the eight strains were finally deemed resistant to TE (MIC ≥ 64 μg/mL) and one strain (str. AAL 10077) was resistant to SXT (MIC = 38 μg/mL). Additionally, MIC values estimated for the highly resistant L. monocytogenes strains isolated from pet food and feed ranged from <0.064 to 128 μg/mL, whereas four out of the five strains (str. AAL 20148, AAL 20850, AAL 21180, BF9) were finally deemed resistant to SXT (MIC ≥ 0.5 μg/mL). The MDR L. monocytogenes strain BF11 ultimately demonstrated resistance against MEM, P, and TE, with recorded MIC values of 4, 4, and 48 μg/mL, respectively (Figure 3).

3.4. Serotyping of Salmonella spp. and L. monocytogenes Strains Isolated from Pet Food and Feed Samples

mPCR identified three major Salmonella serovars in pet food and feed samples; S. Enteritidis, S. Typhimurium, and S. Thompson. Serotyping of L. monocytogenes strains isolated from pet food and feed samples detected the four most common serotypes of the pathogen found in foods, namely serotypes 1/2a, 1/2b, 1/2c, and 4b, categorizing them into four distinct serogroups; PCR-serogroups IIa (ser. 1/2a, 3a), IIb (ser. 1.2b, 3b, 7), IIc (ser., 1/2c, 3c), and IVb (ser. 4b, 4d, 4e) [31].
More specifically, serotyping of Salmonella isolates (n = 15) classified them as S. Enteritidis (6.7%, n = 1), S. Typhimurium (6.7%, n = 1), and S. Thompson (60%, n = 9), while four isolates (26.7%) did not belong to the serovars identified through the experimental protocol and remained unclassified as Salmonella spp. (Figure 4a). For the nine L. monocytogenes isolates, serogroup distribution is depicted in Figure 4b and corresponds to 44.4 (n = 4), 11.1 (n = 1), 11.1 (n = 1), and 33.3% (n = 3) of the strains belonging to PCR-serogroups IIa, IIb, IIc, and IVb, respectively. The MDR L. monocytogenes strain BF11 belonged to serotypes 1/2b, 3b.

4. Discussion

In the present study, 24 microbial strains of the most commonly detected foodborne bacterial pathogens Salmonella spp. and L. monocytogenes were isolated from pet foods and animal feeding stuffs. Hence, this underscores a critical issue and point of concern that at the same time constitutes a principal component of the One Health concept [4]; pet food and feed can serve as reservoir for microbial hazards, which may subsequently end up in the food production setting and eventually the food consumer itself, either directly through petting or handling of animals and their raw feeding [38,39,40], or indirectly through human consumption of contaminated food coming from animals fed with contaminated animal feed [5,41,42]. In any case, raw pet feeding may jeopardize food safety through zoonotic transmission of the pathogens [43,44]. However, contrary to what is expected, other confounding factors such as the unattended presence and behavior of children and pets is highly more likely to contribute to the contamination and cross-contamination of food in the domestic environment, rather than the perceived inadequate hygiene practices of food consumers coming in physical contact with pet food and pets [42,45,46]. Furthermore, pet food storage and preservation in the households could play a significant role in microbial proliferation and transmission of bacterial pathogens, considering that in almost half of the cases, pet food is stored in the kitchen and some types of pet food (e.g., kibbles, treats) might be kept under elevated temperatures during their storage [40,47]. In addition, when it comes to feeding raw meat to pets, the majority of pet owners frequently reports thawing frozen meat at room temperature on the kitchen counter [48], positively contributing to the aforementioned proliferation of presumptive pathogens on the food matrix.
Despite quality assurance and the implementation of safety systems (the latter evidently following a hazard analysis critical control point (HACCP)-based approach), as well as compliance with good manufacturing and hygiene practices (GMPs/GHPs), the pet food industry faces challenges in controlling microbial hazards in animal feed [49]. Data collected from the Rapid Alert System for Food and Feed (RASFF) classify cumulatively feed materials and pet food as the second source of notifications in the EU, following only notifications related on poultry meat, whereas the most frequently notified pathogenic microorganism in the RASFF (and thus, in feed as well) was Salmonella [50]. A recent review of the United States (US) Food and Drug Administration (FDA) on pet food recalls in a twenty-year period (2003–2022) identified biological contamination as the primary reason for the recalls, while again, Salmonella serovars accounted for the majority of recall incidents followed by L. monocytogenes [16]. Apart from Salmonella spp. and L. monocytogenes, other bacterial pathogens, like toxigenic E. coli and Clostridium botulinum, can also be detected in pet foods [5,16]. The presence of foodborne pathogenic bacteria in pet food and animal feeding stuff can occur at any stage during the manufacturing process, storage, or even preparation of feed [51] and similar bacterial genotypes for the pathogens can be recovered and traced back in the food production chain, for example from the slaughterhouse to the animal breeding farm and its feed, highlighting specific farm management factors and practices as key points for concern [52]. Pet food is, therefore, increasingly recognized as an important vehicle for the transmission of foodborne pathogens to humans, leading to disease outbreaks of salmonellosis in most instances [53,54,55]. Consequently, there is an urged practical need for strict compliance with GMPs/GHPs to improve microbiological quality and safety of pet food and feed.
Food processing preservation methods, such as freezing and drying, may reduce the bacterial contamination in raw pet food [56,57]; nevertheless, microorganisms may still survive and pose an immediate or indirect (through cross-contamination) threat to the pet owner [49,58,59]. Moreover, the significantly reduced water activity in many low-moisture foods, including pet foods, induces cross-resistance (e.g., heat resistance) in bacterial pathogens like Salmonella [60,61]. Controlling this prevalent microbial pathogen and other pathogenic bacteria in dry pet foods with the use of ‘clean-label’ antimicrobials or novel non-thermal processing methods, such as high-pressure processing, seems a promising alternative to the extensive application of ‘traditional’ and chemically synthesized preservatives currently being employed [62,63,64,65].
The trend of feeding pet dogs and cats raw meat (BARF) and animal by-products because of suggested health benefits to pets as a diet more closely related to their wild-living nature has been linked with the risk of introducing antimicrobial-resistant pathogenic bacteria not only to the raw-fed pets [43,54,66,67,68,69] but also in the home food production environment [54,70]. In this study, AST results revealed notable resistance patterns among the bacterial isolates from pet food and feed. Over half of Salmonella isolates (53.3%) exhibited resistance to TE, while a subset of these strains (five out of eight) showed resistance to an additional antibiotic (AMP or SXT), though they remained uniformly sensitive to all other tested antimicrobial agents (AMC, CAZ, CIP, CN, CTX, FOX) (Figure 2a). Bacci et al. [67] and Fathi et al. [71] noticed similar resistance patterns to AMP and SXT. The antibiotic resistance profiles of Salmonella isolates obtained in this work suggest that while some frontline antibiotics commonly used to treat Salmonella infections (e.g., AMC and CIP) [72] remained effective, there is an emerging resistance to widely used antimicrobial agents like tetracyclines [73,74,75,76,77], which are extensively administered as pharmacological substances to treat zoonotic diseases in primary food production at the farm level [19,78,79]. Such an extensive and non-prudent use of antibiotics often leads to the occurrence of residues in food commodities [80,81]. Besides, increased AMR against SXT was observed also in more than half of L. monocytogenes isolates (55.6%). Implications for resistance of L. monocytogenes against fluoroquinolones (tested with CIP; Figure 2b) suggests that EUCAST correctly points out, in the breakpoint tables provided for the pathogen, that there is insufficient evidence that the organism is a good target for therapy with this specific antibiotic group [34]. Thankfully, all L. monocytogenes isolates were susceptible to E and AMP, which are the drugs of choice for treatment of listeriosis [82]. Finally, resistance of the MDR L. monocytogenes strain BF11 originally to five and then to three antimicrobial agents, following AST and MIC determination (Figure 2b and Figure 3), respectively, with each agent corresponding to a different antimicrobial class, further emphasizes the difficulties in antibiotic therapeutic schemes followed for treatment of listeriosis. L. monocytogenes strain BF11 was finally deemed resistant against penicillin, tetracyclines, and carbapenems (tested with MEM; see Figure 3). Finding MDR L. monocytogenes in pet food is something unusual and less commonly reported than MDR Salmonella [55]. In fact, this is something reported herein for the first time, to the best of our knowledge, which implies better adaptation of L. monocytogenes to environmental stresses and inferred development of cross-resistance, possibly assisting in the wider dissemination of the pathogen in the food chain. This finding also provides an important basis for risk early warning of drug-resistant pathogens transmitted through pet food under the “One Health” framework. Resistance of this particular L. monocytogenes strain (BF11) to the antibiotic group of carbapenems is alarming, since carbapenem antibiotics and MEM in particular are considered the last line of defense antimicrobial agents against AMR and MDR bacteria. Especially MEM is useful in treating L. monocytogenes meningitis when AMP seems ineffective or if the patient is allergic to AMP [83].
Taking together the antibiotic resistance profiles for Salmonella spp. and L. monocytogenes, the spread of antibiotic-resistant foodborne pathogenic bacteria in pet foods and feed was above 50%. In line with the reported findings by Mataragka et al. [84], the results indicate that AMR testing in animal feeding stuff is recommended to ensure antimicrobial stewardship, apart from final product sample testing. Despite the absence of molecular detection of resistance genes, the phenotypic antimicrobial resistance observed in Salmonella spp. and L. monocytogenes remains of significant clinical and public health concern. These findings highlight the potential for treatment challenges and underpin the importance of continued AMR surveillance, even in the absence of genotypic data. The latter, provided through the detection of common resistance genes (e.g., tetA and tetB), allow for a deeper understanding of bacterial gene expression and this could be the subject of future research.
Salmonellosis together with campylobacteriosis are the most reported zoonoses to humans in the EU and US [23,85]. Among the top 20 most frequently reported Salmonella serovars, the 2 most important and unquestionably prevalent Salmonella serovars associated with increased incidence of salmonellosis cases are S. Enteritidis and S. Typhimurium [23,86]. The latter along with S. Infantis are considered high-virulence serovars, which necessitate careful monitoring [87,88], not to mention the rapid increase in the prevalence of S. Infantis in poultry meat due to the presence of the pESI plasmid in a clonal dominating strain [89,90]. However, the transmission of S. Infantis in poultry meat through contaminated feed does not seem to be supported by our findings, since this serovar was not recovered from any poultry feed tested (Figure 4). On the other hand, phylogenetic analysis of S. Typhimurium is suggesting potential shared routes of transmission among human, chicken, farm, and slaughterhouse environments [91], most probably also involving animal feeding stuffs. Furthermore, in recent years, S. Thompson has emerged among the top 10 prevalent serotypes in China and the US [92]. As such, mPCR-based methods have been developed to differentiate between the most common clinical Salmonella serovars [36,93]. In our study, serotyping revealed S. Thompson as the predominant serovar in pet food and feed (60% of Salmonella spp. isolates), which correlates with the aforementioned steadily increased detection of this particular serovar [87]. While four major Salmonella serovars of public health relevance, namely S. Enteritidis, S. Infantis, S. Typhimurium, and S. Thompson, were screened and three of them were successfully identified in pet food and feed (Figure 4), a number of isolates (n = 4) remained unclassified. This represents a limitation of the applied molecular approach, as the primers used targeted a specific subset of serovars [36]. Therefore, the presence of unclassified isolates may indicate an underrepresentation of the full Salmonella diversity within the sampled population. Further characterization using broader or complementary typing methods would be necessary to fully elucidate the epidemiological significance of these strains.
As far as L. monocytogenes is concerned, the four most prevalent serotypes of the pathogen encountered in foods are 1/2a, 1/2b, 1/2c, and 4b belonging to PCR-serogroups IIa, IIb, IIc, and IVb, respectively [30,31]. The mPCR protocol of Doumith et al. [30] cannot distinguish between certain serotypes within the species L. monocytogenes (Table 1B), although the protocol can differentiate the four major serotypes of the pathogen from each other (serotypes 1/2a, 1/2b, 1/2c, 4b). However, serotypes 3a, 3b, 3c, 4a, 4c, 4e, 4d, and 7 are infrequently detected in food and are rarely implicated in human listeriosis cases [30], assigning in that context each one of the major serotypes of L. monocytogenes in the four distinct PCR-serogroups [31]. In the present study, L. monocytogenes PCR-serogroups IIa (44.4%) and IVb (33.3%), practically corresponding to serotypes 1/2a and 4b, were most commonly detected in pet food and feed. L. monocytogenes ser. 4b isolates are most frequently associated with clinical human listeriosis cases, while serotype 1/2a is mostly isolated from food products [94,95]. These serotypes are known for their role in foodborne outbreaks and, when coupled with antibiotic resistance, raise concerns about their potential impact on public health.
Present findings strenuously suggest that in the current context of One Health, the need for actions regarding policy changes and pathogen surveillance is of outmost importance. At least at the EU level, animal feed is regarded as food and is governed by the same legislation [96]. Nevertheless, there is a misconception that pet food and animal feeding stuffs may be of an inferior microbiological quality compared to the food intended for human consumption. Effective monitoring of pathogen presence and control of the microbiological quality in foods requires standardized methods. Aligned to the concept of One Health, the International Organization for Standardization (ISO) has revised from 2017 all its protocols regarding foodborne bacterial pathogen detection in foods to include the term “microbiology of the food chain” instead of the previously used term “microbiology of food and animal feeding stuffs”, so as to denote its integrated approach towards foods and feed.
As all scientific and research studies, this one has its own limitations and constraints. In terms of methodology and research process, limited access to information regarding sample size, with the non-disclosure of the total number of samples analyzed explicitly stated in this study, does not allow for further statistical processing of data, such as estimating the prevalence rates of Salmonella spp. and L. monocytogenes in pet food and feed. Lastly, the limited geographical scope of the research conducted herein, expanded only to a single country (Greece) and not a wider area or group of countries, and together with the lack of previous studies on the topic in Greece, both pose limitations in data comparisons and generally broad-term inferences regarding detection and recovery of Salmonella spp. and L. monocytogenes serotypes from pet food and feed.

5. Conclusions

Foodborne bacterial pathogens, like Salmonella spp. and L. monocytogenes, can be detected in the primary food production environment and feed as well. In general, pathogenic bacteria with increased AMR can be recovered from pet foods and animal feeding stuffs [67,82,83]. In strict alignment with the concept of One Health, in order to improve antimicrobial stewardship and mitigate risks stemming from inappropriate use of antibiotics in the food production chain and thus prevent potential development of MDR bacterial strains, monitoring AMR in pet food and feed is equally important as testing for AMR in clinical samples.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/vetsci12090844/s1, Table S1: Salmonella spp. isolates from pet food and feed samples used in the study, Table S2: Listeria monocytogenes isolates from pet food and feed samples used in the study. Table S3: Salmonella spp. isolates (n = 15) from pet food and feed samples used in the study per antibiotic tested, Table S4. L. monocytogenes isolates (n = 9) from pet food and feed samples used in the study per antibiotic tested.

Author Contributions

Conceptualization, N.D.A. and J.I.; methodology, A.M. and N.D.A.; validation, A.M., N.D.A. and J.I.; formal analysis, N.D.A.; investigation, A.M., A.-S.C. and M.K.; resources, N.D.A., N.T. and J.I.; data curation, A.M. and N.D.A.; writing—original draft preparation; A.M., A.-S.C. and N.D.A.; writing—review and editing; A.M., N.D.A., N.T. and J.I.; visualization: A.M. and N.D.A.; supervision, N.D.A. and J.I.; project administration, N.D.A., funding acquisition; N.D.A. and J.I. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Restrictions apply to the availability of data. Data on the number of tested samples (pet food and feed) are not readily available because those data are confidential. Requests to access this data could be directed to Eurofins Athens Analysis Laboratories and the Hellenic Army Biological Research Centre. All other contributions and datasets deriving from the original data which are presented in the study are included in the article/Supplementary Materials, and any further inquiries can be directed to the corresponding author.

Acknowledgments

The authors deeply acknowledge Eurofins Athens Analysis Laboratories and the Hellenic Army Biological Research Centre for performing sampling and analysis and providing the microbial strains used in this study.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
AMCamoxycillin-clavulanate
AMPampicillin
AMRantimicrobial resistance
ASTantimicrobial susceptibility testing
BARFbiologically appropriate raw food
CAZceftazidime
COVID-19Coronavirus disease 2019
CNgentamicin
CTXcefotaxime
Eerythromycin
ECDCEuropean Centre for Disease Control and Prevention
EFSAEuropean Food Safety Authority
EUEuropean Union
EUCASTEuropean Committee on Antimicrobial Susceptibility Testing
FOXcefoxitin
ISOInternational Organization for Standardization
LDCL-lysine decarboxylation medium
MDRmultidrug resistance
MHMueller–Hinton
MH-FMueller–Hinton with 5% defibrinated horse blood and 20 mg/L β-NAD
mPCRmultiplex polymerase chain reaction
Pbenzylpenicillin
SXTtrimethoprim-sulfamethoxazole 1:19
TEtetracycline
TSItriple sugar iron

References

  1. EFSA (European Food Safety Authority); ECDC (European Centre for Disease Prevention and Control). The European Union One Health 2018 zoonoses report. EFSA J. 2019, 17, 5926. [Google Scholar] [CrossRef]
  2. WHO (World Health Organization). Available online: https://www.who.int/health-topics/one-health#tab=tab_1 (accessed on 28 June 2025).
  3. USGS (United States Geological Survey). Available online: https://www.usgs.gov/media/images/one-health-conceptual-diagram (accessed on 28 June 2025).
  4. Mackenzie, J.S.; Jeggo, M. The One Health approach–Why is it so important? Trop. Med. Infect. Dis. 2019, 4, 88. [Google Scholar] [CrossRef]
  5. Nemser, S.M.; Doran, T.; Grabenstein, M.; McConnell, T.; McGrath, T.; Pamboukian, R.; Smith, A.C.; Achen, M.; Danzeisen, G.; Kim, S.; et al. Investigation of Listeria, Salmonella, and toxigenic Escherichia coli in various pet foods. Foodborne Pathog. Dis. 2014, 11, 706–709. [Google Scholar] [CrossRef]
  6. EFSA (European Food Safety Authority); ECDC (European Centre for Disease Prevention and Control). The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2022–2023. EFSA J. 2025, 23, e9237. [Google Scholar] [CrossRef]
  7. Alabi, E.D.; Rabiu, A.G.; Adesoji, A.T. A review of antimicrobial resistance challenges in Nigeria: The need for one health approach. One Health 2025, 20, 101053. [Google Scholar] [CrossRef]
  8. Lekshmi, M.; Ammini, P.; Kumar, S.; Varela, M.F. The food production environment and the development of antimicrobial resistance in human pathogens of animal origin. Microorganisms 2017, 5, 11. [Google Scholar] [CrossRef]
  9. Bland, R.; Waite-Cusic, J.; Weisberg, A.J.; Riutta, E.R.; Chang, J.H.; Kovacevic, J. Adaptation to a commercial quaternary ammonium compound sanitizer leads to cross-resistance to select antibiotics in Listeria monocytogenes isolated from fresh produce environments. Front. Microbiol. 2022, 12, 782920. [Google Scholar] [CrossRef] [PubMed]
  10. Braoudaki, M.; Hilton, A.C. Adaptive resistance to biocides in Salmonella enterica and Escherichia coli O157 and cross-resistance to antimicrobial agents. J. Clin. Microbiol. 2004, 42, 73–78. [Google Scholar] [CrossRef] [PubMed]
  11. Guérin, A.; Bridier, A.; Le Grandois, P.; Sévellec, Y.; Palma, F.; Félix, B.; LISTADAPT Study Group; Roussel, S.; Soumet, C. Exposure to quaternary ammonium compounds selects resistance to ciprofloxacin in Listeria monocytogenes. Pathogens 2021, 10, 220. [Google Scholar] [CrossRef] [PubMed]
  12. Kode, D.; Nannapaneni, R.; Bansal, M.; Chang, S.; Cheng, W.-H.; Sharma, C.S.; Kiess, A. Low-level tolerance to fluoroquinolone antibiotic ciprofloxacin in QAC-adapted subpopulations of Listeria monocytogenes. Microorganisms 2021, 9, 1052. [Google Scholar] [CrossRef]
  13. Xiao, X.; Bai, L.; Wang, S.; Liu, L.; Qu, X.; Zhang, J.; Xiao, Y.; Tang, B.; Li, Y.; Yang, H.; et al. Chlorine tolerance and cross-resistance to antibiotics in poultry-associated Salmonella isolates in China. Front. Microbiol. 2022, 12, 833743. [Google Scholar] [CrossRef]
  14. Qamar, M.U.; Aatika; Chughtai, M.I.; Ejaz, H.; Mazhari, B.B.Z.; Maqbool, U.; Alanazi, A.; Alruwaili, Y.; Junaid, K. Antibiotic-resistant bacteria, antimicrobial resistance genes, and antibiotic residue in food from animal sources: One health food safety concern. Microorganisms 2023, 11, 161. [Google Scholar] [CrossRef] [PubMed]
  15. Carraturo, F.; Gargiulo, G.; Giorgio, A.; Aliberti, F.; Guida, M. Prevalence, distribution, and diversity of Salmonella spp. in meat samples collected from Italian slaughterhouses. J. Food Sci. 2016, 81, M2545–M2551. [Google Scholar] [CrossRef] [PubMed]
  16. DeBeer, J.; Finke, M.; Maxfield, A.; Osgood, A.-M.; Baumgartel, D.M.; Blickem, E.R. A review of pet food recalls from 2003 through 2022. J. Food Prot. 2024, 87, 100199. [Google Scholar] [CrossRef] [PubMed]
  17. dos Santos, R.L.; Davanzo, E.F.A.; Palma, J.M.; Castro, V.H.dL.; da Costa, H.M.B.; Dallago, B.S.L.; Perecmanis, S.; Santana, Â.P. Molecular characterization and biofilm-formation analysis of Listeria monocytogenes, Salmonella spp., and Escherichia coli isolated from Brazilian swine slaughterhouses. PLoS ONE 2022, 17, e0274636. [Google Scholar] [CrossRef]
  18. Guidi, F.; Centorotola, G.; Chiaverini, A.; Iannetti, L.; Schirone, M.; Visciano, P.; Cornacchia, A.; Scattolini, S.; Pomilio, F.; D’Alterio, N.; et al. The slaughterhouse as hotspot of CC1 and CC6 Listeria monocytogenes strains with hypervirulent profiles in an integrated poultry chain of Italy. Microorganisms 2023, 11, 1543. [Google Scholar] [CrossRef]
  19. Hailu, W.; Helmy, Y.A.; Carney-Knisely, G.; Kauffman, M.; Fraga, D.; Rajashekara, G. Prevalence and antimicrobial resistance profiles of foodborne pathogens isolated from dairy cattle and poultry manure amended farms in northeastern Ohio, the United States. Antibiotics 2021, 10, 1450. [Google Scholar] [CrossRef]
  20. Horlbog, J.A.; Stephan, R.; Stevens, M.J.A.; Overesch, G.; Kittl, S.; Napoleoni, M.; Silenzi, V.; Nüesch-Inderbinen, M.; Albini, S. Feedborne Salmonella enterica serovar Jerusalem outbreak in different organic poultry flocks in Switzerland and Italy linked to soya expeller. Microorganisms 2021, 9, 1367. [Google Scholar] [CrossRef]
  21. Kousta, M.; Mataragas, M.; Skandamis, P.; Drosinos, E.H. Prevalence and sources of cheese contamination with pathogens at farm and processing levels. Food Control 2010, 21, 805–815. [Google Scholar] [CrossRef]
  22. Varsaki, A.; Ortiz, S.; Santorum, P.; López, P.; López-Alonso, V.; Hernández, M.; Abad, D.; Rodríguez-Grande, J.; Ocampo-Sosa, A.A.; Martínez-Suárez, J.V. Prevalence and population diversity of Listeria monocytogenes isolated from dairy cattle farms in the Cantabria region of Spain. Animals 2022, 12, 2477. [Google Scholar] [CrossRef] [PubMed]
  23. EFSA (European Food Safety Authority); ECDC (European Centre for Disease Prevention and Control). The European Union One Health 2023 zoonoses report. EFSA J. 2024, 22, e9106. [Google Scholar] [CrossRef]
  24. ISO 6579:2002; Microbiology of Food and Animal Feeding Stuffs—Horizontal Method for the Detection of Salmonella spp. ISO: Geneva, Switzerland, 2002.
  25. ISO 6579-1:2017; Microbiology of the Food Chain–Horizontal Method for the Detection, Enumeration and Serotyping of Salmonella. Part 1: Detection of Salmonella spp. ISO: Geneva, Switzerland, 2017.
  26. ISO 11290-1:2017; Microbiology of the Food Chain–Horizontal Method for the Detection and Enumeration of Listeria monocytogenes and of Listeria spp. Part 1: Detection Method. ISO: Geneva, Switzerland, 2017.
  27. Andritsos, N.D.; Stasinou, V.; Tserolas, D.; Giaouris, E. Temperature distribution and hygienic status of domestic refrigerators in Lemnos island, Greece. Food Control 2021, 127, 108121. [Google Scholar] [CrossRef]
  28. Kitch, T.T.; Jacobs, M.R.; Appelbaum, P.C. Evaluation of RapID onE system for identification of 379 strains in the family Enterobacteriaceae and oxidase-negative, Gram-negative nonfermenters. J. Clin. Microbiol. 1994, 32, 931–934. [Google Scholar] [CrossRef]
  29. Andritsos, N.D.; Mataragas, M. Characterization and antibiotic resistance of Listeria monocytogenes strains isolated from Greek Myzithra soft whey cheese and related food processing surfaces over two-and-a-half years of safety monitoring in a cheese processing facility. Foods 2023, 12, 1200. [Google Scholar] [CrossRef]
  30. Doumith, M.; Buchrieser, C.; Glaser, P.; Jacquet, C.; Martin, P. Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. J. Clin. Microbiol. 2004, 42, 3819–3822. [Google Scholar] [CrossRef]
  31. Doumith, M.; Jacquet, C.; Gerner-Smidt, P.; Graves, L.M.; Loncarevic, S.; Mathisen, T.; Morvan, A.; Salcedo, C.; Torpdahl, M.; Vazquez, J.A.; et al. Multicenter validation of a multiplex PCR assay for differentiating the major Listeria monocytogenes serovars 1/2a, 1/2b, 1/2c, and 4b: Toward an international standard. J. Food Prot. 2005, 68, 2648–2650. [Google Scholar] [CrossRef] [PubMed]
  32. Hudzicki, J. Kirby-Bauer Disk Diffusion Susceptibility Test Protocol. Am. Soc. Microbiol. 2009, 15, 23. Available online: https://asm.org/protocols/kirby-bauer-disk-diffusion-susceptibility-test-pro (accessed on 28 August 2025).
  33. Brown, D.F.; Brown, L. Evaluation of the E test, a novel method of quantifying antimicrobial activity. J. Antimicrob. Chemother. 1991, 27, 185–190. [Google Scholar] [CrossRef] [PubMed]
  34. EUCAST (European Committee on Antimicrobial Susceptibility Testing). Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 15.0. 2025. Available online: https:///www.eucast.org (accessed on 28 June 2025).
  35. Tzimotoudis, N.; Mataragka, A.; Andritsos, N.D.; Ikonomopoulos, J. Antibiotic susceptibility testing of Escherichia coli and coliform isolates detected in samples of drinking water from central Greece. Appl. Sci. 2025, 15, 2664. [Google Scholar] [CrossRef]
  36. Shimizu, R.; Osawa, K.; Shigemura, K.; Yoshida, H.; Fujiwara, M.; Iijima, Y.; Fujisawa, M.; Shirakawa, T. Development of multiplex PCR for rapid identification of four Salmonella serovars most commonly isolated in Japan. Southeast Asian J. Trop. Med. Public Health 2014, 45, 654–661. [Google Scholar]
  37. Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbath, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
  38. Anturaniemi, J.; Barrouin-Melo, S.M.; Zaldivar-López, S.; Sinkko, A.; Hielm-Björkman, A. Owners’ perception of acquiring infections through raw pet food: A comprehensive internet-based survey. Vet. Rec. 2019, 185, 658. [Google Scholar] [CrossRef]
  39. Bulochova, V.; Evans, E.W. Raw meat-based pet feeding and food safety: Netnography study of pet owner comments and review of manufacturers’ information provision. J. Food Prot. 2021, 84, 2099–2108. [Google Scholar] [CrossRef]
  40. Conrad, C.C.; Stanford, K.; Narvaez-Bravo, C.; Callaway, T.; McAllister, T. Farm fairs and petting zoos: A review of animal contact as a source of zoonotic enteric disease. Foodborne Pathog. Dis. 2017, 14, 59–73. [Google Scholar] [CrossRef]
  41. Parker, E.M.; Mollenkopf, D.F.; Li, C.; Ballash, G.A.; Wittum, T.E. Pet treats, Salmonella, and antimicrobial resistance; a One Health problem. Prev. Vet. Med. 2025, 244, 106622. [Google Scholar] [CrossRef]
  42. Ma, J.; Almanza, B.A.; Ge, L.; Her, E.; Liu, Y.; Lando, A.; Wu, F.; Verrill, L. Pet ownership and pet type influence food safety in the home: Evidence from a national survey. J. Food Prot. 2020, 83, 1553–1560. [Google Scholar] [CrossRef] [PubMed]
  43. Davies, R.H.; Lawes, J.R.; Wales, A.D. Raw diets for dogs and cats: A review, with particular reference to microbiological hazards. J. Small Anim. Pract. 2019, 60, 329–339. [Google Scholar] [CrossRef]
  44. Lambertini, E.; Buchanan, R.L.; Narrod, C.; Pradhan, A.K. Transmission of bacterial zoonotic pathogens between pets and humans: The role of pet food. Crit. Rev. Food Sci. Nutr. 2016, 56, 364–418. [Google Scholar] [CrossRef] [PubMed]
  45. Castrica, M.; Menchetti, L.; Panseri, S.; Cami, M.; Balzaretti, C.M. When pet snacks look like children’s toys! The potential role of pet snacks in transmission of bacterial zoonotic pathogens in the household. Foodborne Pathog. Dis. 2021, 18, 56–62. [Google Scholar] [CrossRef]
  46. Menini, A.; Mascarello, G.; Giaretta, M.; Brombin, A.; Marcolin, S.; Personeni, F.; Pinto, A.; Crovato, S. The critical role of consumers in the prevention of foodborne diseases: An ethnographic study of Italian families. Foods 2022, 11, 1006. [Google Scholar] [CrossRef] [PubMed]
  47. Morelli, G.; Stefanutti, D.; Ricci, R. A survey among dog and cat owners on pet food storage and preservation in the households. Animals 2021, 11, 273. [Google Scholar] [CrossRef]
  48. Ovca, A.; Bulochova, V.; Pirnat, T.; Evans, E.W. Risk perception and food safety practices among Slovenian pet owners: Does raw meat feeding of pets make a difference? J. Consum. Prot. Food Saf. 2024, 19, 293–302. [Google Scholar] [CrossRef]
  49. Leiva, A.; Molina, A.; Redondo-Solano, M.; Artavia, G.; Rojas-Bogantes, R.; Granados-Chinchilla, F. Pet food quality assurance and safety and quality assurance survey within the Costa Rican pet food industry. Animals 2019, 9, 980. [Google Scholar] [CrossRef]
  50. Pigłowski, M. Pathogenic and non-pathogenic microorganisms in the Rapid Alert System for Food and Feed. Int. J. Environ. Res. Public Health 2019, 16, 477. [Google Scholar] [CrossRef] [PubMed]
  51. Kananub, S.; Pinniam, N.; Phothitheerabut, S.; Krajanglikit, P. Contamination factors associated with surviving bacteria in Thai commercial raw pet foods. Vet. World 2020, 13, 1988–1991. [Google Scholar] [CrossRef] [PubMed]
  52. Hellström, S.; Laukkanen, R.; Siekkinen, K.-M.; Ranta, J.; Maijala, R.; Korkeala, H. Listeria monocytogenes contamination in pork can originate from farms. J. Food Prot. 2010, 73, 641–648. [Google Scholar] [CrossRef] [PubMed]
  53. Cavallo, S.J.; Daly, E.R.; Seiferth, J.; Nadeau, A.M.; Mahoney, J.; Finnigan, J.; Wikoff, P.; Kiebler, C.A.; Simmons, L. Human outbreak of Salmonella Typhimurium associated with exposure to locally made chicken jerky pet treats, New Hampshire, 2013. Foodborne Path. Dis. 2015, 12, 441–446. [Google Scholar] [CrossRef]
  54. Dhakal, J.; Cancio, L.P.M.; Deliephan, A.; Chaves, B.D.; Tubene, S. Salmonella presence and risk mitigation in pet foods; a growing challenge with implications for human health. Compr. Rev. Food Sci. Food Saf. 2024, 23, e70060. [Google Scholar] [CrossRef] [PubMed]
  55. Nichols, M.; Stapleton, G.S.; Rotstein, D.S.; Gollarza, L.; Adams, J.; Caidi, H.; Chen, J.; Hodges, A.; Glover, M.; Peloquin, S.; et al. Outbreak of multidrug-resistant Salmonella infections in people linked to pig ear pet treats, United States, 2015-2019: Results of a multistate investigation. Lancet Reg. Health Am. 2024, 34, 100769. [Google Scholar] [CrossRef] [PubMed]
  56. Medić, H.; Kušec, I.D.; Pleadin, J.; Kozačinski, L.; Njari, B.; Hengl, B.; Kušec, G. The impact of frozen storage duration on physical, chemical and microbiological properties of pork. Meat Sci. 2018, 140, 119–127. [Google Scholar] [CrossRef] [PubMed]
  57. Miyamoto-Shinohara, Y.; Sukenobe, J.; Imaizumi, T.; Nakahara, T. Survival of freeze-dried bacteria. J. Gen. Appl. Microbiol. 2008, 54, 9–24. [Google Scholar] [CrossRef]
  58. Mahmoud, S.; Aboul-Ella, H.; Marouf, S.; Armanious, W. Low temperature-survivability behavior of Salmonella enterica subsp. enterica serovar Typhimurium and Salmonella enterica subsp. enterica serovar Enteritidis in a minced beef meat model as an evaluation of the cold chain’s preserving-effectiveness. Int. J. Vet. Sci. 2023, 12, 853–859. [Google Scholar] [CrossRef]
  59. Taormina, P.J. Survival rate of Salmonella on cooked pig ear pet treats at refrigerated and ambient temperature storage. J. Food Prot. 2014, 77, 50–56. [Google Scholar] [CrossRef] [PubMed]
  60. Gautam, B.; Govindan, B.N.; Gänzle, M.; Roopesh, M.S. Influence of water activity on the heat resistance of Salmonella enterica in selected low-moisture foods. Int. J. Food Microbiol. 2020, 334, 108813. [Google Scholar] [CrossRef] [PubMed]
  61. Liu, S.; Tang, J.; Tadapanemi, R.K.; Yang, R.; Zhu, M.-J. Exponentially increased thermal resistance of Salmonella spp. and Enterococcus faecium at reduced water activity. Appl. Environ. Microbiol. 2018, 84, e02742-17. [Google Scholar] [CrossRef] [PubMed]
  62. Chen, C.-H.; Yin, H.-B.; Upadhayay, A.; Brown, S.; Venkitanarayanan, K. Efficacy of plant-derived antimicrobials for controlling Salmonella Schwarzengrund on dry pet food. Int. J. Food Microbiol. 2019, 296, 1–7. [Google Scholar] [CrossRef]
  63. Kiprotich, S.S.; Aldrich, C.G. A review of food additives to control the proliferation and transmission of pathogenic microorganisms with emphasis on applications to raw meat-based diets for companion animals. Front. Vet. Sci. 2022, 9, 1049731. [Google Scholar] [CrossRef]
  64. Lee, A.; Marks-Warren, N.; Aguilar, V.; Piszczor, K.; Swicegood, B.; Ye, M.; Warren, J.; O’Neill, E.; Fleck, M.; Tejayadi, S. Inactivation of Salmonella, Shiga toxin-producing E. coli, and Listeria monocytogenes in raw diet pet foods using high-pressure processing. J. Food Prot. 2023, 86, 100124. [Google Scholar] [CrossRef]
  65. Owens, T.G.; King, B.A.; Radford, D.R.; Strange, P.; Arvaj, L.; Pezzali, J.G.; Edwards, A.M.; Ganesh, D.; DeVries, T.J.; McBride, B.W.; et al. Use of 2-hydroxy-4-(methylthio)-butanoic acid to inhibit Salmonella and Listeria in raw meat for feline diets and palatability in domestic cats. J. Anim. Sci. 2021, 99, skab253. [Google Scholar] [CrossRef]
  66. Fisher, C.D.; Call, D.R.; Omulo, S. Detection of antibiotic resistant Enterobacterales in commercial raw pet food: A preliminary study. Front. Vet. Sci. 2024, 11, 1294575. [Google Scholar] [CrossRef]
  67. Bacci, C.; Vismarra, A.; Dander, S.; Barilli, E.; Superchi, P. Occurrence and antimicrobial profile of bacterial pathogens in former foodstuff meat products used for pet diets. J. Food Prot. 2019, 82, 316–324. [Google Scholar] [CrossRef]
  68. Bernaquez, I.; Dumaresq, J.; Picard, I.; Gaulin, C.; Dion, R.; Weaver, K.; Walker, M.; Kearney, A.; Bharat, A.; Fafard, J.; et al. Dogs fed raw meat-based diets are vectors of drug-resistant Salmonella infection in humans. Commun. Med. 2025, 5, 214. [Google Scholar] [CrossRef]
  69. Indra, R.; Sroithongkham, P.; Leelapsawas, C.; Yindee, J.; Wetchasirigul, S.; Chuanchuen, R.; Chanchaithong, P. Contamination with antimicrobial-resistant Escherichia coli, Salmonella, and Enterococcus in raw meat-based diets for pets. J. Anim. Physiol. Anim. Nutr. 2025, in press. [Google Scholar] [CrossRef] [PubMed]
  70. Ribeiro-Almeida, M.; Mourão, J.; Magalhães, M.; Freitas, A.R.; Novais, C.; Peixe, L.; Antunes, P. Raw meat-based diet for pets: A neglected source of human exposure to Salmonella and pathogenic Escherichia coli clones carrying mcr, Portugal, September 2019 to January 2020. Euro Surveill. 2024, 29, 2300561. [Google Scholar] [CrossRef]
  71. Fathi, M.M.; Samir, A.; Marouf, S.; Ali, A.R.; Al-Amry, K. Phenotypic and Genotypic Characteristics of Antimicrobial Resistance of Gram-Negative Bacteria Isolated from Pet Animal. J. Adv. Vet. Sci. 2022, 12, 597–604. Available online: https://www.advetresearch.com/index.php/AVR/article/view/1073 (accessed on 28 August 2025).
  72. Sivanandy, P.; Yuk, L.S.; Yi, C.S.; Kaur, I.; Ern, F.H.S.; Manirajan, P. A systematic review of recent outbreaks and the efficacy and safety of drugs approved for the treatment of Salmonella infections. IJID Reg. 2024, 14, 100516. [Google Scholar] [CrossRef] [PubMed]
  73. Morasi, R.M.; da Silva, A.Z.; Nuñez, K.V.M.; Dantas, S.T.A.; Faganello, C.; Juliano, L.C.B.; Tiba-Casas, M.R.; Pantoja, J.C.F.; Amarante, A.F.; Júnior, A.F.; et al. Overview of antimicrobial resistance and virulence factors in Salmonella spp. isolated in the last two decades from chicken in Brazil. Food Res. Int. 2022, 162, 111955. [Google Scholar] [CrossRef] [PubMed]
  74. Peruzy, M.F.; Capuano, F.; Proroga, Y.T.R.; Cristiano, D.; Carullo, M.R.; Murru, N. Antimicrobial susceptibility testing for Salmonella serovars isolated from food samples: Five-year monitoring (2015–2019). Antibiotics 2020, 9, 365. [Google Scholar] [CrossRef]
  75. Tayeb, B.A.; Mohamed-Sharif, Y.H.; Choli, F.R.; Haji, S.S.; Ibrahim, M.M.; Haji, S.K.; Rasheed, M.J.; Mustafa, N.A. Antimicrobial susceptibility profile of Listeria monocytogenes isolated from meat products: A systematic review and meta-analysis. Foodborne Pathog. Dis. 2023, 20, 315–333. [Google Scholar] [CrossRef]
  76. Tîrziu, E.; Bărbălan, G.; Morar, A.; Herman, V.; Cristina, R.T.; Imre, K. Occurrence and antimicrobial susceptibility profile of Salmonella spp. in raw and ready-to-eat foods and Campylobacter spp. in retail raw chicken meat in Transylvania, Romania. Foodborne Pathog. Dis. 2020, 17, 479–484. [Google Scholar] [CrossRef]
  77. Xiao, Q.; Yu, Y.; Xu, B.; Fang, Z.; Chen, W.; Feng, J.; Zhu, Y.; Liu, Y.; Gu, Q.; Luo, J.; et al. Serotype and antimicrobial resistance of Salmonella from poultry meats in 2021 Shanghai, China. Food Agric. Immunol. 2023, 34, 2220568. [Google Scholar] [CrossRef]
  78. Gutierrez, A.; De, J.; Schneider, K.R. Prevalence, concentration, and antimicrobial resistance profiles of Salmonella isolated from Florida poultry litter. J. Food Prot. 2020, 83, 2179–2186. [Google Scholar] [CrossRef]
  79. Romero-Barrios, P.; Deckert, A.; Parmley, E.J.; Leclair, D. Antimicrobial resistance profiles of Escherichia coli and Salmonella isolates in Canadian broiler chickens and their products. Foodborne Pathog. Dis. 2020, 17, 672–678. [Google Scholar] [CrossRef]
  80. Bishnoi, K.; Moudgil, P.; Soni, D.; Jadhav, V.J. Occurrence and risk assessment of tetracycline residues in layer eggs in Haryana, India. J. Food Prot. 2025, 88, 100449. [Google Scholar] [CrossRef] [PubMed]
  81. Sarkar, S.; Kania, S.A.; Abouelkhair, M.A.; Whitlock, B.; Okafor, C.C. Residues of tetracycline, erythromycin, and sulfonamides in beef, eggs, and honey from grocery stores in Knoxville, Tennessee, USA: Failure of cooking to decrease drug concentrations. Vet. Sci. 2024, 11, 660. [Google Scholar] [CrossRef] [PubMed]
  82. Dhama, K.; Karthik, K.; Tiwari, R.; Shabbir, M.Z.; Barbuddhe, S.; Malik, S.V.S.; Singh, R.K. Listeriosis in animals, its public health significance (food-borne zoonosis) and advances in diagnosis and control: A comprehensive review. Vet. Q. 2015, 35, 211–235. [Google Scholar] [CrossRef] [PubMed]
  83. Matano, S.; Satoh, S.; Harada, Y.; Nagata, H.; Sugimoto, T. Antibiotic treatment for bacterial meningitis caused by Listeria monocytogenes in a patient with multiple myeloma. J. Infect. Chemother. 2010, 16, 123–125. [Google Scholar] [CrossRef]
  84. Mataragka, A.; Tzimotoudis, N.; Mavrommatis, A.; Tsiplakou, E.; Symeonidou, A.; Kotsikori, M.; Zervas, G.; Ikonomopoulos, J. Investigating the spread of antimicrobial drug-resistant microorganisms in dairy sheep farms: A follow-up study. Appl. Sci. 2023, 13, 8165. [Google Scholar] [CrossRef]
  85. Scallan Walter, E.J.; Cui, Z.; Tierney, R.; Griffin, P.M.; Hoekstra, R.M.; Payne, D.C.; Rose, E.B.; Devine, C.; Namwase, A.S.; Mirza, S.A.; et al. Foodborne illness acquired in the United States – Major pathogens, 2019. Emerg. Inf. Dis. 2025, 31, 669–677. [Google Scholar] [CrossRef]
  86. Luvsansharav, U.O.; Vieira, A.; Bennett, S.; Huang, J.; Healy, J.M.; Hoekstra, R.M.; Bruce, B.B.; Cole, D. Salmonella serotypes: A novel measure of association with foodborne transmission. Foodborne Pathog. Dis. 2020, 17, 151–155. [Google Scholar] [CrossRef]
  87. Ferrari, R.G.; Rosario, D.K.A.; Cunha-Neto, A.; Mano, S.B.; Figueiredo, E.E.S.; Conte-Junior, C.A. Worldwide epidemiology of Salmonella serovars in animal-based foods: A meta-analysis. Appl. Environ. Microbiol. 2019, 85, e00591-19. [Google Scholar] [CrossRef]
  88. Kim, M.; Barnett-Neefs, C.; Chavez, R.A.; Kealey, E.; Wiedmann, M.; Stasiewicz, M. Risk assessment predicts most of the salmonellosis risk in raw chicken parts is concentrated in those few products with high levels of high-virulence serotypes of Salmonella. J. Food Prot. 2024, 87, 100304. [Google Scholar] [CrossRef] [PubMed]
  89. Fenske, G.J.; Pouzou, J.G.; Pouillot, R.; Taylor, D.D.; Costard, S.; Zagmutt, F.J. The genomic and epidemiological virulence patterns of Salmonella enterica serovars in the United States. PLoS ONE 2023, 18, e0294624. [Google Scholar] [CrossRef]
  90. McMillan, E.A.; Weinroth, M.D.; Frye, J.G. Increased prevalence of Salmonella Infantis isolated from raw chicken and turkey products in the United States is due to a single clonal lineage carrying the pESI plasmid. Microorganisms 2022, 10, 1478. [Google Scholar] [CrossRef]
  91. Lim, Y.C.; Ong, K.H.; Khor, W.C.; Chua, F.Y.X.; Lim, J.Q.; Tan, L.K.; Chen, S.L.; Wong, W.K.; Maiwald, M.; Barkham, T.; et al. Sequence types and antimicrobial resistance profiles of Salmonella Typhimurium in the food chain in Singapore. Microorganisms 2024, 12, 1912. [Google Scholar] [CrossRef]
  92. Zhai, W.; Lu, M.; Zhao, L.; Du, P.; Cui, S.; Liu, Y.; Tan, D.; Zeng, X.; Yang, B.; Li, R.; et al. Tracing the evolution: The rise of Salmonella Thompson co-resistant to clinically important antibiotics in China, 1997–2020. mSystems 2025, 10, e0101824. [Google Scholar] [CrossRef] [PubMed]
  93. Kim, S.; Frye, J.G.; Hu, J.; Fedorka-Gray, P.J.; Gautom, R.; Boyle, D.S. Multiplex PCR-based method for identification of common clinical serotypes of Salmonella enterica subsp. enterica. J. Clin. Microbiol. 2006, 44, 3608–3615. [Google Scholar] [CrossRef] [PubMed]
  94. Andritsos, N.D.; Paramithiotis, S.; Mataragas, M.; Drosinos, E.H. Listeria monocytogenes serogroup 1/2 strains have a competitive growth advantage over serotype 4b during refrigerated storage of an artificially contaminated ready-to-eat pork meat product. Appl. Sci. 2021, 11, 6096. [Google Scholar] [CrossRef]
  95. Orsi, R.H.; den Bakker, H.C.; Wiedmann, M. Listeria monocytogenes lineages: Genomics, evolution, ecology, and phenotypic characteristics. Int. J. Med. Microbiol. 2011, 301, 79–96. [Google Scholar] [CrossRef]
  96. European Parliament; Council of the European Union. Regulation (EC) No 178/2002 on Laying Down the General Principles and Requirements of Food Law, Establishing the European Food Safety Authority and Laying Down Procedures in Matters of Food Safety. Off. J. Eur. Union 2002, L31, 1–24. Available online: https://eur-lex.europa.eu/eli/reg/2002/178/oj/eng (accessed on 12 August 2025).
Vetsci 12 00844 g001
Figure 1. The conceptual diagram for One Health (https://www.usgs.gov/media/images/one-health-conceptual-diagram; accessed on 28 June 2025 under the creative commons license CC BY-SA 4.0).
Figure 1. The conceptual diagram for One Health (https://www.usgs.gov/media/images/one-health-conceptual-diagram; accessed on 28 June 2025 under the creative commons license CC BY-SA 4.0).
Vetsci 12 00844 g001
Vetsci 12 00844 g002
Figure 2. Antibiotic resistance profiles (antibiograms) of foodborne bacterial pathogens isolated from pet food and feed samples. (a) Antibiograms for Salmonella spp. isolates (n = 15). (b) Antibiograms for L. monocytogenes isolates (n = 9). The color in the antibiogram for each isolate marks its resistance pattern to the selected antibiotic; Green: Susceptible strain, Yellow: Intermediate resistant strain, Red: Resistant strain. AMC: amoxicillin-clavulanic acid, AMP: ampicillin, CAZ: ceftazidime, CIP: ciprofloxacin, CN: gentamicin, CTX: cefotaxime, E: erythromycin, FOX: cefoxitin, MEM: meropenem, P: penicillin, SXT: trimethoprim-sulfamethoxazole, TE: tetracycline.
Figure 2. Antibiotic resistance profiles (antibiograms) of foodborne bacterial pathogens isolated from pet food and feed samples. (a) Antibiograms for Salmonella spp. isolates (n = 15). (b) Antibiograms for L. monocytogenes isolates (n = 9). The color in the antibiogram for each isolate marks its resistance pattern to the selected antibiotic; Green: Susceptible strain, Yellow: Intermediate resistant strain, Red: Resistant strain. AMC: amoxicillin-clavulanic acid, AMP: ampicillin, CAZ: ceftazidime, CIP: ciprofloxacin, CN: gentamicin, CTX: cefotaxime, E: erythromycin, FOX: cefoxitin, MEM: meropenem, P: penicillin, SXT: trimethoprim-sulfamethoxazole, TE: tetracycline.
Vetsci 12 00844 g002
Vetsci 12 00844 g003
Figure 3. E-test for minimum inhibitory concentration (MIC) determination of the multidrug resistant L. monocytogenes strain BF11 isolated from raw dog food against five antimicrobial agents (antimicrobial class being designated in parenthesis). Antibiotic in green, yellow, and red ultimately marks the susceptibility, intermediate resistance, and resistance of the BF11 strain against the specific antimicrobial agent, the conferred resistance due to estimated MIC values > MIC breakpoints provided by EUCAST [33]: (a) MIC = 1.5 μg/mL for CIP (fluoroquinolones); (b) MIC = 4 μg/mL for MEM (carbapenems); (c) MIC = 4 μg/mL for P (penicillins), (d) MIC < 0.064 μg/mL for SXT (miscellaneous agents), (e) MIC = 48 μg/mL for TE (tetracyclines). CIP: ciprofloxacin, MEM: meropenem, P: penicillin, SXT: trimethoprim-sulfamethoxazole, TE: tetracycline, EUCAST: European Committee on Antimicrobial Susceptibility Testing.
Figure 3. E-test for minimum inhibitory concentration (MIC) determination of the multidrug resistant L. monocytogenes strain BF11 isolated from raw dog food against five antimicrobial agents (antimicrobial class being designated in parenthesis). Antibiotic in green, yellow, and red ultimately marks the susceptibility, intermediate resistance, and resistance of the BF11 strain against the specific antimicrobial agent, the conferred resistance due to estimated MIC values > MIC breakpoints provided by EUCAST [33]: (a) MIC = 1.5 μg/mL for CIP (fluoroquinolones); (b) MIC = 4 μg/mL for MEM (carbapenems); (c) MIC = 4 μg/mL for P (penicillins), (d) MIC < 0.064 μg/mL for SXT (miscellaneous agents), (e) MIC = 48 μg/mL for TE (tetracyclines). CIP: ciprofloxacin, MEM: meropenem, P: penicillin, SXT: trimethoprim-sulfamethoxazole, TE: tetracycline, EUCAST: European Committee on Antimicrobial Susceptibility Testing.
Vetsci 12 00844 g003
Vetsci 12 00844 g004
Figure 4. Distribution of foodborne bacterial pathogens isolated from pet food and feed samples. (a) Distribution of serovars for the Salmonella isolates. (b) Distribution of PCR-serogroups and serotypes for the L. monocytogenes isolates.
Figure 4. Distribution of foodborne bacterial pathogens isolated from pet food and feed samples. (a) Distribution of serovars for the Salmonella isolates. (b) Distribution of PCR-serogroups and serotypes for the L. monocytogenes isolates.
Vetsci 12 00844 g004
Table 1. Target genomic regions and primer sequences of the mPCR used for serotyping foodborne bacterial pathogens isolated from pet food and feed samples. (A) Gene amplification dataset by mPCR for serotyping of Salmonella isolates. (B) Gene amplification dataset by mPCR for serotyping of L. monocytogenes isolates.
Table 1. Target genomic regions and primer sequences of the mPCR used for serotyping foodborne bacterial pathogens isolated from pet food and feed samples. (A) Gene amplification dataset by mPCR for serotyping of Salmonella isolates. (B) Gene amplification dataset by mPCR for serotyping of L. monocytogenes isolates.
(A)
Target GeneSequence (5′-3′)Product SizeSerovar Designation
invAF: GCCATGGTATGGATTTGTCC118 bpSalmonella spp.
R: GTCACGATAAAACCGGCACT
sdfF: TGTGTTTTATCTGATGCAAGAGG333 bpS. Enteritidis
R: CGTTCTTCTGGTACTTACGATGAC
fliC-rF: AACAACGACAGCTTATGCCG413 bpS. Infantis
R: CCACCTGCGCCAACGCT
fliC-iF: ACTCAGGCTTCCCGTAACGC551 bpS. Typhimurium
R: ATAGCCATTTACCAGTTCC
fliC-kF: AACGACGGTATCTCCATTGC658 bpS. Thompson
R: CAGCCGAACTCGGTGTATTT
(B)
Target GeneSequence (5′-3′)Product SizeSerotype Designation
prsF: GCTGAAGAGATTGCGAAAGAAG370 bpListeria spp.
R: CAAAGAAACCTTGGATTTGCGG
ORF2819F: AGCAAAATGCCAAAACTCGT471 bp1/2b, 3b, 4b, 4d, and 4e
R: CATCACTAAAGCCTCCCATTG
ORF2110F: AGTGGACAATTGATTGGTGAA597 bp4b, 4d, and 4e
R: CATCCATCCCTTACTTTGGAC
lmo0737F: AGGGCTTCAAGGACTTACCC691 bp1/2a, 1/2c, 3a, and 3c
R: ACGATTTCTGCTTGCCATTC
lmo1118F: AGGGGTCTTAAATCCTGGAA906 bp1/2c and 3c
R: CGGCTTGTTCGGCATACTTA
F: Forward primer; R: Reverse primer.
Table 2. Antimicrobial susceptibility testing (AST) of foodborne bacterial pathogens isolated from pet food and feed samples. (A) AST of Salmonella isolates (n = 15) per antibiotic tested (% of total). (B) AST of L. monocytogenes isolates (n = 9) per antibiotic tested (% of total).
Table 2. Antimicrobial susceptibility testing (AST) of foodborne bacterial pathogens isolated from pet food and feed samples. (A) AST of Salmonella isolates (n = 15) per antibiotic tested (% of total). (B) AST of L. monocytogenes isolates (n = 9) per antibiotic tested (% of total).
(A)
StrainAMC (%)AMP (%)CAZ (%)CIP (%)CN (%)CTX (%)FOX (%)SXT (%)TE (%)
Resistant0 (0.0)2 (13.3)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)3 (20.0)8 (53.3)
Intermediate0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
Susceptible15 (100)13 (86.7)15 (100)15 (100)15 (100)15 (100)15 (100)12 (80.0)7 (46.7)
Total151515151515151515
(B)
StrainAMP (%)CIP (%)E (%)MEM (%)P (%)SXT (%)TE (%)
Resistant0 (0.0)2 (22.2)0 (0.0)1 (11.1)1 (11.1)5 (55.6)1 (11.1)
Intermediate0 (0.0)7 (77.8)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
Susceptible9 (100)0 (0.0)9 (100)8 (88.9)8 (88.9)4 (44.4)8 (88.9)
Total9999999
AMC: amoxicillin-clavulanate, AMP: ampicillin, CAZ: ceftazidime, CIP: ciprofloxacin, CN: gentamicin, CTX: cefotaxime, E: erythromycin, FOX: cefoxitin, MEM: meropenem, P: penicillin, SXT: trimethoprim-sulfamethoxazole, TE: tetracycline.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Andritsos, N.D.; Mataragka, A.; Tzimotoudis, N.; Chatzopoulou, A.-S.; Kotsikori, M.; Ikonomopoulos, J. Serotyping and Antibiotic Resistance Profiles of Salmonella spp. and Listeria monocytogenes Strains Isolated from Pet Food and Feed Samples: A One Health Perspective. Vet. Sci. 2025, 12, 844. https://doi.org/10.3390/vetsci12090844

AMA Style

Andritsos ND, Mataragka A, Tzimotoudis N, Chatzopoulou A-S, Kotsikori M, Ikonomopoulos J. Serotyping and Antibiotic Resistance Profiles of Salmonella spp. and Listeria monocytogenes Strains Isolated from Pet Food and Feed Samples: A One Health Perspective. Veterinary Sciences. 2025; 12(9):844. https://doi.org/10.3390/vetsci12090844

Chicago/Turabian Style

Andritsos, Nikolaos D., Antonia Mataragka, Nikolaos Tzimotoudis, Anastasia-Spyridoula Chatzopoulou, Maria Kotsikori, and John Ikonomopoulos. 2025. "Serotyping and Antibiotic Resistance Profiles of Salmonella spp. and Listeria monocytogenes Strains Isolated from Pet Food and Feed Samples: A One Health Perspective" Veterinary Sciences 12, no. 9: 844. https://doi.org/10.3390/vetsci12090844

APA Style

Andritsos, N. D., Mataragka, A., Tzimotoudis, N., Chatzopoulou, A.-S., Kotsikori, M., & Ikonomopoulos, J. (2025). Serotyping and Antibiotic Resistance Profiles of Salmonella spp. and Listeria monocytogenes Strains Isolated from Pet Food and Feed Samples: A One Health Perspective. Veterinary Sciences, 12(9), 844. https://doi.org/10.3390/vetsci12090844

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop