Weizmannia coagulans BC99: A Novel Adjunct to Protein Supplementation for Enhancing Exercise Endurance and Reducing Fatigue
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Materials
2.2. Animals and Treatment
2.3. Exhaustion Swimming Experiment
2.4. Biochemical Analysis
2.5. Determination of the Expression Levels of Antioxidant Genes Nrf2 and HO-1 in Skeletal Muscle
2.6. Determination of Short-Chain Fatty Acids
2.7. Intestinal Microbiota Analysis
2.8. Data Analysis
3. Results
3.1. Effect of BC99 on Swimming Exhaustion Time in Exercise-Fatigued Mice
3.2. Effect of BC99 on Protein Digesting Enzyme Activity
3.3. Effects of BC99 on Biochemical Indices of Fatigue in Exercise-Fatigued Mice
3.4. Effects of BC99 on Oxidative Stress Indices in Exercise-Fatigued Mice
3.5. Effects of BC99 on Inflammatory Factors in Skeletal Muscle of Fatigued Mice
3.6. Effect of BC99 on mRNA Expression Levels of Genes Related to Nrf2 Signaling Pathway in Skeletal Muscle
3.7. Improvement of BC99 on SCFAs in Mice Intestine
3.8. Effects of BC99 on the Composition of the Gut Microbiota
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yan, K.; Gao, H.; Liu, X.; Zhao, Z.; Gao, B.; Zhang, L. Establishment and identification of an animal model of long-term exercise-induced fatigue. Front. Endocrinol. 2022, 13, 915937. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Ma, X.; Cao, L.; Zhao, S.; Zhao, C.; Yin, S.; Hu, H. A Multi-Ingredient Formula Ameliorates Exercise-Induced Fatigue by Changing Metabolic Pathways and Increasing Antioxidant Capacity in Mice. Foods 2021, 10, 3120. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Liang, D.; Huang, Z.; Jia, G.; Zhao, H.; Liu, G. Anti-fatigue effect of quercetin on enhancing muscle function and antioxidant capacity. J. Food Biochem. 2021, 45, e13968. [Google Scholar] [CrossRef] [PubMed]
- Green, H.J. Mechanisms of muscle fatigue in intense exercise. J. Sports Sci. 1997, 15, 247–256. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.-C.; Hsu, Y.-J.; Ho, H.-H.; Hsieh, S.-H.; Kuo, Y.-W.; Sung, H.-C.; Huang, C.-C. Lactobacillus salivarius Subspecies salicinius SA-03 is a New Probiotic Capable of Enhancing Exercise Performance and Decreasing Fatigue. Microorganisms 2020, 8, 545. [Google Scholar] [CrossRef] [PubMed]
- Jeon, H.; Kim, H.; Lee, M.; Moon, J.; Kim, J.; Yang, J.; Jung, Y. Oral Administration of Animal and Plant Protein Mixture with Lactiplantibacillus plantarum IDCC 3501 Improves Protein Digestibility. Fermentation 2023, 9, 560. [Google Scholar] [CrossRef]
- Kårlund, A.; Gómez-Gallego, C.; Turpeinen, A.M.; Palo-oja, O.-M.; El-Nezami, H.; Kolehmainen, M. Protein Supplements and Their Relation with Nutrition, Microbiota Composition and Health: Is More Protein Always Better for Sportspeople? Nutrients 2019, 11, 829. [Google Scholar] [CrossRef]
- Cermak, N.M.; Res, P.T.; de Groot, L.C.P.G.M.; Saris, W.H.M.; van Loon, L.J.C. Protein supplementation augments the adaptive response of skeletal muscle to resistance-type exercise training: A meta-analysis. Am. J. Clin. Nutr. 2012, 96, 1454–1464. [Google Scholar] [CrossRef] [PubMed]
- van der Wielen, N.; Moughan, P.J.; Mensink, M. Amino Acid Absorption in the Large Intestine of Humans and Porcine Models. J. Nutr. 2017, 147, 1493–1498. [Google Scholar] [CrossRef] [PubMed]
- Jäger, R.; Mohr, A.E.; Carpenter, K.C.; Kerksick, C.M.; Purpura, M.; Moussa, A.; Townsend, J.R.; Lamprecht, M.; West, N.P.; Black, K.; et al. International Society of Sports Nutrition Position Stand: Probiotics. J. Int. Soc. Sports Nutr. 2019, 16, 62. [Google Scholar] [CrossRef] [PubMed]
- Cao, J.; Yu, Z.; Liu, W.; Zhao, J.; Zhang, H.; Zhai, Q.; Chen, W. Probiotic characteristics of Bacillus coagulans and associated implications for human health and diseases. J. Funct. Foods 2019, 64, 103643. [Google Scholar] [CrossRef]
- Ruiz, L.; Ruas-Madiedo, P.; Gueimonde, M.; de Los Reyes-Gavilán, C.G.; Margolles, A.; Sánchez, B. How do bifidobacteria counteract environmental challenges? Mechanisms involved and physiological consequences. Genes Nutr. 2011, 6, 307–318. [Google Scholar] [CrossRef]
- Elshaghabee, F.M.F.; Rokana, N.; Gulhane, R.D.; Sharma, C.; Panwar, H. Bacillus As Potential Probiotics: Status, Concerns, and Future Perspectives. Front. Microbiol. 2017, 8, 1490. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Li, P.; Lee, S.; Wang, Y.; Tan, C.; Shang, N. Weizmannia coagulans: An ideal probiotic for gut health. Food Sci. Hum. Wellness 2023, 13, 16–26. [Google Scholar] [CrossRef]
- Liu, Y.; Qu, P. GW26-e5373 Research on the Effects of Mice’ cardio-pulmonary function by exhaustive Swimming. J. Am. Coll. Cardiol. 2015, 66, C233–C234. [Google Scholar] [CrossRef][Green Version]
- Liu, D.; Liu, D.C.; Fan, H.; Wang, Y. Lactobacillus fermentum CQPC08 Attenuates Exercise-Induced Fatigue in Mice Through Its Antioxidant Effects and Effective Intervention of Galactooligosaccharide. Drug Des. Dev. Ther. 2021, 15, 5151–5164. [Google Scholar] [CrossRef] [PubMed]
- Bi, Y.; Liu, X.; Liu, Y.; Wang, M.; Shan, Y.; Yin, Y.; Meng, X.; Sun, F.; Li, H.; Li, Z. Molecular and biochemical investigations of the anti-fatigue effects of tea polyphenols and fruit extracts of Lycium ruthenicum Murr. on mice with exercise-induced fatigue. Front. Mol. Biosci. 2023, 10, 1223411. [Google Scholar] [CrossRef] [PubMed]
- Luo, Y.; Fang, Q.; Lai, Y.; Lei, H.; Zhang, D.; Niu, H.; Wang, R.; Song, C. Polysaccharides from the leaves of Polygonatum sibiricum Red. regulate the gut microbiota and affect the production of short-chain fatty acids in mice. AMB Express 2022, 12, 35. [Google Scholar] [CrossRef]
- Zhai, S.; Gao, Y.; Jiang, Y.; Li, Y.; Fan, Q.; Tie, S.; Wu, Y.; Gu, S. Weizmannia coagulans BC99 affects valeric acid production via regulating gut microbiota to ameliorate inflammation and oxidative stress responses in Helicobacter pylori mice. J. Food Sci. 2024, 89, 9985–10002. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.-W.; Li, M.; Ma, L.-C.; Wei, F.-W. A widely applicable protocol for DNA isolation from fecal samples. Biochem. Genet. 2006, 44, 494–503. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Wang, C.; Lang, H.; Yu, H.; Zhou, M.; Rao, X.; Zhang, Q.; Yi, L.; Zhu, J.; Mi, M. The Contrasting Effects of Two Distinct Exercise Training Modalities on Exhaustive Exercise-Induced Muscle Damage in Mice May Be Associated with Alterations in the Gut Microbiota. Int. J. Mol. Sci. 2024, 25, 7837. [Google Scholar] [CrossRef]
- Schmitz, L.; Ferrari, N.; Schwiertz, A.; Rusch, K.; Woestmann, U.; Mahabir, E.; Graf, C. Impact of endurance exercise and probiotic supplementation on the intestinal microbiota: A cross-over pilot study. Pilot Feasibility Stud. 2019, 5, 76. [Google Scholar] [CrossRef]
- Zhang, L.; Wang, Q.; Gao, N.; Lin, G.; Hu, D.; Liu, J.; Wang, J.; Zhao, S.; Zhang, J.; Zheng, T.; et al. The study on in vitro antioxidant properties, cellular immune activities and mice anti-fatigue effects of Sanghuangporus vanninii mycelium polysaccharides. Food Biosci. 2024, 61, 104640. [Google Scholar] [CrossRef]
- Rawson, E.S.; Miles, M.P.; Larson-Meyer, D.E. Dietary Supplements for Health, Adaptation, and Recovery in Athletes. Int. J. Sport Nutr. Exerc. Metab. 2018, 28, 188–199. [Google Scholar] [CrossRef]
- Jäger, R.; Shields, K.A.; Lowery, R.P.; De Souza, E.O.; Partl, J.M.; Hollmer, C.; Purpura, M.; Wilson, J.M. Probiotic Bacillus coagulans GBI-30, 6086 reduces exercise-induced muscle damage and increases recovery. PeerJ 2016, 4, e2276. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Gu, Q. Effect of probiotic on growth performance and digestive enzyme activity of Arbor Acres broilers. Res. Vet. Sci. 2010, 89, 163–167. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Huang, M.; Feng, J.; Chen, Y.; Li, M.; Meng, X.; Chang, X. Effect of Beneficial Colonization of Bacillus coagulans NRS 609 on Growth Performance, Intestinal Health, Antioxidant Capacity, and Immune Response of Common Carp (Cyprinus carpio L.). Aquac. Nutr. 2023, 2023, 1451394. [Google Scholar] [CrossRef]
- Kimmel, M.; Keller, D.; Farmer, S.; Warrino, D.E. A controlled clinical trial to evaluate the effect of GanedenBC (30) on immunological markers. Methods Find. Exp. Clin. Pharmacol. 2010, 32, 129–132. [Google Scholar] [CrossRef]
- Mohanta, K.N.; Mohanty, S.N.; Jena, J.; Sahu, N.P.; Patro, B. Carbohydrate level in the diet of silver barb, Puntius gonionotus (Bleeker) fingerlings: Effect on growth, nutrient utilization and whole body composition. Aquac. Res. 2009, 40, 927–937. [Google Scholar] [CrossRef]
- Wu, P.; Pu, S.-X.; Jiang, M.-S.; Hu, Z.-J.; Li, C.-Y.; Dupont, D.; Chen, X.-D. Enhancing food digestion and nutrient absorption through pre-digestion: Tailored strategies for special populations. Food Med. Homol. 2025, 2, 9420069. [Google Scholar] [CrossRef]
- Bu, Y.; Liu, Y.; Zhang, T.; Liu, Y.; Zhang, Z.; Yi, H. Bacteriocin-Producing Lactiplantibacillus plantarum YRL45 Enhances Intestinal Immunity and Regulates Gut Microbiota in Mice. Nutrients 2023, 15, 3437. [Google Scholar] [CrossRef]
- Hu, S.; Wang, L.; Jiang, Z. Dietary Additive Probiotics Modulation of the Intestinal Microbiota. Protein Pept. Lett. 2017, 24, 382–387. [Google Scholar] [CrossRef] [PubMed]
- Jäger, R.; Purpura, M.; Farmer, S.; Cash, H.A.; Keller, D. Probiotic Bacillus coagulans GBI-30, 6086 Improves Protein Absorption and Utilization. Probiot. Antimicrob. Proteins 2017, 10, 611–615. [Google Scholar] [CrossRef] [PubMed]
- Nyangale, E.P.; Farmer, S.; Keller, D.; Chernoff, D.; Gibson, G.R. Effect of prebiotics on the fecal microbiota of elderly volunteers after dietary supplementation of Bacillus coagulans GBI-30, 6086. Anaerobe 2014, 30, 75–81. [Google Scholar] [CrossRef]
- Gonzalez, J.T.; Betts, J.A. Dietary sugars, exercise and hepatic carbohydrate metabolism. Proc. Nutr. Soc. 2018, 78, 246–256. [Google Scholar] [CrossRef]
- Lee, S.M.; Kim, Y.H.; Kim, Y.R.; Lee, B.-R.; Shin, S.; Kim, J.Y.; Jung, I.C.; Lee, M.Y. Anti-fatigue potential of Pinus koraiensis leaf extract in an acute exercise-treated mouse model. Biomed. Pharmacother. 2022, 153, 113501. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Shan, M.; Chu, C.; Bie, S.; Wang, H.; Cai, S. Polysaccharides from Polygonatum kingianum Collett & Hemsl ameliorated fatigue by regulating NRF2/HO-1/NQO1 and AMPK/PGC-1α/TFAM signaling pathways, and gut microbiota. Int. J. Biol. Macromol. 2024, 266, 131440. [Google Scholar] [CrossRef]
- Liu, L.; Zhang, Y.; Liu, T.; Ke, C.; Huang, J.; Fu, Y.; Lin, Z.; Chen, F.; Wu, X.; Chen, Q. Pyrroloquinoline quinone protects against exercise-induced fatigue and oxidative damage via improving mitochondrial function in mice. FASEB J. 2021, 35, e21394. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Jing, S.; Lin, H.; Sun, W.; Jiang, W.; Yu, C.; Sun, J.; Wang, C.; Chen, J.; Li, H. Anti-fatigue effect of anwulignan via the NRF2 and PGC-1α signaling pathway in mice. Food Funct. 2019, 10, 7755–7766. [Google Scholar] [CrossRef] [PubMed]
- Cheng, A.J.; Jude, B.; Lanner, J.T. Intramuscular mechanisms of overtraining. Redox Biol. 2020, 35, 101480. [Google Scholar] [CrossRef] [PubMed]
- Yuan, L.; Wang, Y.; Li, N.; Yang, X.; Sun, X.; Tian, H.; Zhang, Y. Mechanism of Action and Therapeutic Implications of Nrf2/HO-1 in Inflammatory Bowel Disease. Antioxidants 2024, 13, 1012. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Chen, K.; Zhu, L.; Liu, H.; Ma, T.; Xu, Q.; Xie, T. Soyasaponin Ab protects against oxidative stress in HepG2 cells via Nrf2/HO-1/NQO1 signaling pathways. J. Funct. Foods 2018, 45, 110–117. [Google Scholar] [CrossRef]
- Chen, Y.-M.; Wei, L.; Chiu, Y.-S.; Hsu, Y.-J.; Tsai, T.-Y.; Wang, M.-F.; Huang, C.-C. Lactobacillus plantarum TWK10 Supplementation Improves Exercise Performance and Increases Muscle Mass in Mice. Nutrients 2016, 8, 205. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.-C.; Chen, M.-J.; Huang, H.-W.; Wu, W.-K.; Lee, Y.-W.; Kuo, H.-C.; Huang, C.-C. Probiotic Lactiplantibacillus plantarum Tana Isolated from an International Weightlifter Enhances Exercise Performance and Promotes Antifatigue Effects in Mice. Nutrients 2022, 14, 3308. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.-C.; Hsu, Y.-J.; Ho, H.-H.; Kuo, Y.-W.; Lin, W.-Y.; Tsai, S.-Y.; Chen, W.-L.; Lin, C.-L.; Huang, C.-C. Effectiveness of human-origin Lactobacillus plantarum PL-02 in improving muscle mass, exercise performance and anti-fatigue. Sci. Rep. 2021, 11, 19469. [Google Scholar] [CrossRef]
- Cai, M.; Zhu, H.; Xu, L.; Wang, J.; Xu, J.; Li, Z.; Yang, K.; Wu, J.; Sun, P. Structure, anti-fatigue activity and regulation on gut microflora in vivo of ethanol-fractional polysaccharides from Dendrobium officinale. Int. J. Biol. Macromol. 2023, 234, 123572. [Google Scholar] [CrossRef]
- Herp, S.; Brugiroux, S.; Garzetti, D.; Ring, D.; Jochum, L.M.; Beutler, M.; Eberl, C.; Hussain, S.; Walter, S.; Gerlach, R.G.; et al. Mucispirillum schaedleri Antagonizes Salmonella Virulence to Protect Mice against Colitis. Cell Host Microbe 2019, 25, 681–694.e8. [Google Scholar] [CrossRef]
- Zhang, Y.-T.; He, Q.-J.; Zhang, F.; Wang, Y.-Q.; Chen, Z.; Yang, P.; Wang, X.-B.; Zhang, S.-Y. Regulation of Ligustrum robustum (Roxb.) Blume on intestinal flora in C57BL/6 mice fed with western high-sugar and high-fat diet. Food Med. Homol. 2025, 2, 9420065. [Google Scholar] [CrossRef]
- Haas, K.N.; Blanchard, J.L. Kineothrix alysoides, gen. nov., sp. nov., a saccharolytic butyrate-producer within the family Lachnospiraceae. Int. J. Syst. Evol. Microbiol. 2017, 67, 402–410. [Google Scholar] [CrossRef]
- Xie, X.-Q.; Geng, Y.; Guan, Q.; Ren, Y.; Guo, L.; Lv, Q.; Lu, Z.-M.; Shi, J.-S.; Xu, Z.-H. Influence of Short-Term Consumption of Hericium erinaceus on Serum Biochemical Markers and the Changes of the Gut Microbiota: A Pilot Study. Nutrients 2021, 13, 1008. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Tang, C.; Tang, Y.; Yin, H.; Liu, X. Capsaicin has an anti-obesity effect through alterations in gut microbiota populations and short-chain fatty acid concentrations. Food Nutr. Res. 2020, 64, 3525. [Google Scholar] [CrossRef] [PubMed]
- Zeng, H.; Huang, C.; Lin, S.; Zheng, M.; Chen, C.; Zheng, B.; Zhang, Y. Lotus Seed Resistant Starch Regulates Gut Microbiota and Increases Short-Chain Fatty Acids Production and Mineral Absorption in Mice. J. Agric. Food Chem. 2017, 65, 9217–9225. [Google Scholar] [CrossRef]
- Markowiak-Kopeć, P.; Śliżewska, K. The Effect of Probiotics on the Production of Short-Chain Fatty Acids by Human Intestinal Microbiome. Nutrients 2020, 12, 1107. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Burillo, S.; Mehta, T.; Pastoriza, S.; Kramer, D.L.; Paliy, O.; Rufián-Henares, J.Á. Potential probiotic salami with dietary fiber modulates antioxidant capacity, short chain fatty acid production and gut microbiota community structure. LWT—Food Sci. Technol. 2019, 105, 355–362. [Google Scholar] [CrossRef]
- Li, X.; Gao, J.; Chen, W.; Liang, J.; Gao, W.; Bodjrenou, D.M.; Zeng, H.; Zhang, Y.; Farag, M.A.; Cao, H.; et al. Properties and functions of acylated starch with short-chain fatty acids: A comprehensive review. Crit. Rev. Food Sci. Nutr. 2024, 18, 1–14. [Google Scholar] [CrossRef]
- Louis, P.; Flint, H.J. Formation of propionate and butyrate by the human colonic microbiota. Environ. Microbiol. 2016, 19, 29–41. [Google Scholar] [CrossRef] [PubMed]
- Parada Venegas, D.; De la Fuente, M.K.; Landskron, G.; González, M.J.; Quera, R.; Dijkstra, G.; Harmsen, H.J.M.; Faber, K.N.; Hermoso, M.A. Short Chain Fatty Acids (SCFAs)-Mediated Gut Epithelial and Immune Regulation and Its Relevance for Inflammatory Bowel Diseases. Front. Immunol. 2019, 10, 277. [Google Scholar] [CrossRef]
- Gasaly, N.; Hermoso, M.A.; Gotteland, M. Butyrate and the Fine-Tuning of Colonic Homeostasis: Implication for Inflammatory Bowel Diseases. Int. J. Mol. Sci. 2021, 22, 3061. [Google Scholar] [CrossRef]
- Faden, H. The Role of Faecalibacterium, Roseburia and Butyrate in Inflammatory Bowel Disease. Dig. Dis. 2022, 40, 793–795. [Google Scholar] [CrossRef]
- Cherta-Murillo, A.; Pugh, J.E.; Alaraj-Alshehhi, S.; Hajjar, D.; Chambers, E.S.; Frost, G.S. The effect of short-chain fatty acids on glycemic control in humans: A systematic review and Meta-analysis. Am. J. Clin. Nutr. 2022, 116, 335–361. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Lin, S.; Zheng, B.; Cheung, P.C.K. Short-chain fatty acids in control of energy metabolism. Crit. Rev. Food Sci. Nutr. 2016, 58, 1243–1249. [Google Scholar] [CrossRef]
- Zhang, W.-Q.; Zhao, T.-T.; Gui, D.-K.; Gao, C.-L.; Gu, J.-L.; Gan, W.-J.; Huang, W.; Xu, Y.; Zhou, H.; Chen, W.-N.; et al. Sodium Butyrate Improves Liver Glycogen Metabolism in Type 2 Diabetes Mellitus. J. Agric. Food Chem. 2019, 67, 7694–7705. [Google Scholar] [CrossRef]
- Samuel, B.S.; Shaito, A.; Motoike, T.; Rey, F.E.; Backhed, F.; Manchester, J.K.; Hammer, R.E.; Williams, S.C.; Crowley, J.; Yanagisawa, M.; et al. Effects of the gut microbiota on host adiposity are modulated by the short-chain fatty-acid binding G protein-coupled receptor, Gpr41. Proc. Natl. Acad. Sci. USA 2008, 105, 16767–16772. [Google Scholar] [CrossRef] [PubMed]
- Cheng, S.-H.; Yang, T.-Y.; Hsu, C.-C.; Wei, Y.-H.; Wu, C.-C.; Tsai, Y.-C. Lactobacillus paragasseri BBM171 Ameliorates Allergic Airway Inflammation Induced by Ovalbumin in Mice via Modulating the Th1/Th2 Balance. Microorganisms 2022, 10, 2041. [Google Scholar] [CrossRef]
- Liu, W.; La, A.L.T.Z.; Evans, A.; Gao, S.; Yu, Z.; Bu, D.; Ma, L. Supplementation with sodium butyrate improves growth and antioxidant function in dairy calves before weaning. J. Anim. Sci. Biotechnol. 2021, 12, 2. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Stražar, M.; Mohamed, A.M.T.; Pacheco, J.A.; Walker, R.L.; Lebar, T.; Zhao, S.; Lockart, J.; Dame, A.; Thurimella, K.; et al. Gut microbiome and metabolome profiling in Framingham heart study reveals cholesterol-metabolizing bacteria. Cell 2024, 187, 1834–1852.e19. [Google Scholar] [CrossRef] [PubMed]









| Gene | Primer Sequence |
|---|---|
| Nrf2 | F: CTTTAGTCAGCGACAGAAGGAC |
| R: AGGCATCTTGTTTGGGAATGTG | |
| F: AGGTACACATCCAAGCCGAGA | |
| HO-1 | R: CATCACCAGCTTAAAGCCTTCT |
| β-actin | F: CTGTGTTTTGGTCTTACGGTAC |
| R: AAAAAGCCTGTCTGTGATTCAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, M.; Zhao, L.; Cao, L.; Li, X.; Zhang, J.; Dong, Y.; Wu, Y.; Gu, S. Weizmannia coagulans BC99: A Novel Adjunct to Protein Supplementation for Enhancing Exercise Endurance and Reducing Fatigue. Foods 2025, 14, 801. https://doi.org/10.3390/foods14050801
Guo M, Zhao L, Cao L, Li X, Zhang J, Dong Y, Wu Y, Gu S. Weizmannia coagulans BC99: A Novel Adjunct to Protein Supplementation for Enhancing Exercise Endurance and Reducing Fatigue. Foods. 2025; 14(5):801. https://doi.org/10.3390/foods14050801
Chicago/Turabian StyleGuo, Minghan, Lina Zhao, Li Cao, Xuan Li, Jie Zhang, Yao Dong, Ying Wu, and Shaobin Gu. 2025. "Weizmannia coagulans BC99: A Novel Adjunct to Protein Supplementation for Enhancing Exercise Endurance and Reducing Fatigue" Foods 14, no. 5: 801. https://doi.org/10.3390/foods14050801
APA StyleGuo, M., Zhao, L., Cao, L., Li, X., Zhang, J., Dong, Y., Wu, Y., & Gu, S. (2025). Weizmannia coagulans BC99: A Novel Adjunct to Protein Supplementation for Enhancing Exercise Endurance and Reducing Fatigue. Foods, 14(5), 801. https://doi.org/10.3390/foods14050801
