Engineered Saccharomyces cerevisiae for the Enhancement of Glucosamine Accumulation by the Consumption of Glucose and Ammonium Based on Synthetic Biological Pathways
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains, Plasmids, Antibiotics, and Instruments
2.2. Determination of gRNA Sequences of Target Gene
2.3. S. cerevisiae Genetic Transformation and Engineered Strain Construction
2.4. Comparison of GlcN Yields from Different Engineered S. cerevisiae Strains
2.5. GlcN Yields from S. cerevisiae HPG2 and HPG5 During Fermentation
2.6. Cell Proliferation, GlcN Yield, and Glucose Consumption of S. cerevisiae HPG5
2.7. Effect of (NH4)2SO4 on the Growth of HPG2 and HPG5 on Solid YPD Media
2.8. GlcN Yield and Glucose Consumption in the Presence of 10 g/L of (NH4)2SO4
2.9. Measurement of GlcN, Glucose, and Ethanol Contents
2.10. Cell Viability Determination and Genetic Stability Analysis
2.11. Transcriptomics Analysis
2.12. Data Analysis
3. Results
3.1. Engineered S. cerevisiae Construction Using the CRISPR-Cas9 Method
3.2. Comparison of GlcN Yields from Five Engineered S. cerevisiae Strains
3.3. Effect of Gene Deletion on GlcN Production
3.4. GlcN Production, Glucose Consumption, and Cell Growth of S. cerevisiae HPG5
3.5. Effect of (NH4)2SO4 on the Proliferation of S. cerevisiae HPG5
3.6. Effect of (NH4)2SO4 on GlcN Production and Cell Viability of S. cerevisiae HPG5 in Submerged Fermentation
3.7. Comparison of GlcN Yields from Different Engineered Strains
3.8. Genetic Stability of S. cerevisiae HPG5 for the Production of GlcN
3.9. The Distribution of DEGs
3.10. GO Annotation of DEGs
3.11. KEGG Enrichment Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chen, L.L.; Walker, A.R.; Burne, R.A.; Zeng, L. Amino Sugars Reshape Interactions Between Streptococcus mutans and Streptococcus gordonii. Appl. Environ. Microbiol. 2020, 87, e01459-20. [Google Scholar] [CrossRef]
- Ma, Q.Y.; Gao, X.Z. Categories and Biomanufacturing Methods of Glucosamine. Appl. Microbiol. Biotechnol. 2019, 103, 7883–7889. [Google Scholar] [CrossRef]
- Tang, M.C.; Nisole, A.; Dupont, C.; Pelletier, J.N.; Waldron, K.C. Chemical Profiling of the Deacetylase Activity of Acetyl Xylan Esterase A (AxeA) Variants on Chitooligosaccharides Using Hydrophilic Interaction Chromatography-Mass Spectrometry. J. Biotechnol. 2011, 155, 257–265. [Google Scholar] [CrossRef] [PubMed]
- Protity, A.T.; Zhou, S.D. Recent Advancement of Glucosamine and N-Acetyl Glucosamine Production Using Microorganisms: A Review. J. Ind. Microbiol. Biotechnol. 2025, 52, kuaf014. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.X.; Wang, J.H.; Yao, M.D.; Li, X.Q.; Lu, X.Q.; He, J.Y.; Zhang, H.W.; Tian, B.X.; Zhou, J. An Update on the Review of Microbial Synthesis of Glucosamine and N-Acetylglucosamine. World J. Microbiol. Biotechnol. 2023, 39, 93. [Google Scholar] [CrossRef] [PubMed]
- Sun, D.M.; Wu, L.H.; Lu, X.C.; Li, C.H.; Xu, L.L.; Li, H.X.; He, D.Y.; Yu, A.Q.; Yu, T.; Zhao, J.Z.; et al. Engineering Transcriptional Regulatory Networks for Improving Second-Generation Fuel Ethanol Production in Saccharomyces cerevisiae. Synth. Syst. Biotechnol. 2025, 10, 207–217. [Google Scholar] [CrossRef]
- Umemura, M.; Okamoto, M.; Nakayama, K.; Sagane, K.; Tsukahara, K.; Hata, K.; Jigami, Y. GWT1 Gene is Required for Inositol Acylation of GlycosylphosphatidylinoSitol Anchors in Yeast. J. Biol. Chem. 2003, 278, 23639–23647. [Google Scholar] [CrossRef]
- Zhang, Z.H.; Liao, Y.X.; Deng, X.T.; Guan, Z.B. Semi-rational Engineering of Glucosamine-6-Phosphate Deaminase for Catalytic Synthesis of Glucosamine from D-Fructose. Enzyme Microb. Technol. 2025, 183, 110552. [Google Scholar] [CrossRef]
- Lee, S.W.; Oh, M.K. A Synthetic Suicide Riboswitch for the High-Throughput Screening of Metabolite Production in Saccharomyces cerevisiae. Metab. Eng. 2015, 28, 143–150. [Google Scholar] [CrossRef]
- Dai, J.; Han, P.P.; Walk, T.C.; Yang, L.; Chen, L.Y.; Li, Y.S.; Gu, C.M.; Liao, X.; Qin, L. Genome-Wide Identification and Characterization of Ammonium Transporter (AMT) Genes in Rapeseed (Brassica napus L.). Genes 2023, 14, 658. [Google Scholar] [CrossRef]
- Li, H.; Yang, Q.S.; Liu, W.; Lin, J.; Chang, Y.H. The AMT1 Family Genes from Malus robusta Display Differential Transcription Features and Ammonium Transport Abilities. Mol. Biol. Rep. 2017, 44, 379–390. [Google Scholar] [CrossRef]
- Zheng, C.J.; Hou, S.X.; Zhou, Y.; Yu, C.Y.; Li, H. Regulation of the PFK1 Gene on the Interspecies Microbial Competition Behavior of Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 2024, 108, 272. [Google Scholar] [CrossRef]
- Lieu, H.Y.; Song, H.S.; Yang, S.N.; Kim, J.H.; Kim, H.J.; Park, Y.D.; Park, C.S.; Kim, H.Y. Identification of Proteins Affected by Iron in Saccharomyces cerevisiae Using Proteome Analysis. J. Microbiol. Biotechnol. 2006, 16, 946–951. [Google Scholar]
- Breidenbach, M.A.; Gallagher, J.E.G.; King, D.S.; Smart, B.P.; Wu, P.; Bertozzi, C.R. Targeted Metabolic Labeling of Yeast N-Glycans with Unnatural Sugars. Proc. Natl. Acad. Sci. USA 2010, 107, 3988–3993. [Google Scholar] [CrossRef]
- Zhang, B.Y.; Wu, Z.H.; Chang, S.L.; Chu, Z.Y.; Cheng, Y.R.; Wang, J.F.; Shi, Q.C.; Shi, J.F.; Jiang, Z.Y. Cationic Polymer-Reinforced Immobilization of Enzymes on Mesoporous Silica for Glucosamine Synthesis. Chem. Eng. Sci. 2025, 317, 122102. [Google Scholar] [CrossRef]
- Howard, S.C.; Deminoff, S.J.; Herman, P.K. Increased Phosphoglucomutase Activity Suppresses the Galactose Growth Defect Associated with Elevated Levels of Ras Signaling in S. cerevisiae. Curr. Genet. 2006, 49, 1–6. [Google Scholar] [CrossRef]
- Mehlgarten, C.; Zink, S.; Rutter, J.; Schaffrath, R. Dosage suppression of the Kluyveromyces lactis zymocin by Saccharomyces cerevisiae ISR1 and UGP1. FEMS Yeast Res. 2007, 7, 722–730. [Google Scholar] [CrossRef][Green Version]
- Gietz, R.D.; Schiestl, R.H. High-Efficiency Yeast Transformation Using the LiAc/SS Carrier DNA/PEG Method. Nat. Protoc. 2007, 2, 31–34. [Google Scholar] [CrossRef] [PubMed]
- Yang, P.Z.; Feng, J.Q.; Chen, J.C. Engineered S. cerevisiae Construction for High-Gravity Ethanol Production and Targeted Metabolomics. Appl. Microbiol. Biotechnol. 2025, 109, 67. [Google Scholar] [CrossRef] [PubMed]
- Jeong, G.T. Production of Levulinic Acid from Glucosamine by Dilute-Acid Catalyzed Hydrothermal Process. Ind. Crop. Prod. 2014, 62, 77–83. [Google Scholar] [CrossRef]
- Yang, P.Z.; Wu, W.J.; Chen, J.C.; Jiang, S.W.; Zheng, Z.; Deng, Y.H.; Lu, J.L.; Wang, H.; Zhou, Y.; Geng, Y.Y.; et al. Thermotolerance Improvement of Engineered Saccharomyces cerevisiae ERG5 Delta ERG4 Delta ERG3 Delta, Molecular Mechanism, and its Application in Corn Ethanol Production. Biotechnol. Biofuels Bioprod. 2023, 16, 66. [Google Scholar] [CrossRef]
- Matsumoto, A.; Terashima, I.; Uesono, Y. A Rapid and Simple Spectroscopic Method for the Determination of Yeast Cell Viability Using Methylene Blue. Yeast 2022, 39, 607–616. [Google Scholar] [CrossRef] [PubMed]
- Guo, X.W.; Zhao, B.; Zhou, X.R.; Lu, D.X.; Wang, Y.P.; Chen, Y.F.; Xiao, D.G. Analysis of the Molecular Basis of Saccharomyces cerevisiae Mutant with High Nucleic Acid Content by Comparative Transcriptomics. Food Res. Int. 2021, 142, 110188. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, T.; Takahashi, F.; Fukui, T.; Fujiwara, S.; Atomi, H.; Imanaka, T. Characterization of a Novel Glucosamine-6-Phosphate Deaminase from a Hyperthermophilic Archaeon. J. Bacteriol. 2005, 187, 7038–7044. [Google Scholar] [CrossRef]
- Deng, M.D.; Wassink, S.L.; Grund, A.D. Engineering a New Pathway for N-Acetylglucosamine Production: Coupling a Catabolic Enzyme, Glucosamine-6-Phosphate Deaminase, with a Biosynthetic Enzyme, Glucosamine-6-Phosphate N-Acetyltransferase. Enzym. Microb. Technol. 2006, 39, 828–834. [Google Scholar] [CrossRef]
- Guan, Z.B.; Deng, X.T.; Zhang, Z.H.; Xu, G.C.; Cheng, W.L.; Liao, X.R.; Cai, Y.J. Engineering Glucosamine-6-Phosphate Synthase to Achieve Efficient One-Step Biosynthesis of Glucosamine. ACS Chem. Biol. 2024, 19, 1237–1242. [Google Scholar] [CrossRef]
- Zhang, J.; Quan, C.; Wang, C.; Wu, H.; Li, Z.M.; Ye, Q. Systematic Manipulation of Glutathione Metabolism in Escherichia coli for Improved Glutathione Production. Microb. Cell. Fact. 2016, 15, 38. [Google Scholar] [CrossRef]






| Primers | Sequences (5′→3′) | Genes |
|---|---|---|
| PFK1-gRNA-F | TGTAACCAGAGTGACCACCTTGGGTTTTAGAGCTAGAAATAGCAAG | PFK1-gRNA |
| PFK1-gRNA-R | CCAAGGTGGTCACTCTGGTTACAGATCATTTATCTTTCACTGCGGA | |
| PDB1-gRNA-F | TTCCATTAGAGCATTCAAAGCGGGTTTTAGAGCTAGAAATAGCAAG | PDB1-gRNA |
| PDB1-gRNA-R | CCGCTTTGAATGCTCTAATGGAAGATCATTTATCTTTCACTGCGGA | |
| GNA1-gRNA-F | GCTTGTCCACAATCACCATGGGGGTTTTAGAGCTAGAAATAGCAAG | GNA1-gRNA |
| GNA1-gRNA-R | CCCCATGGTGATTGTGGACAAGCGATCATTTATCTTTCACTGCGGA | |
| PCM1-gRNA-F | ACTAACCAGAGATTACCCAAGGGGTTTTAGAGCTAGAAATAGCAAG | PCM1-gRNA |
| PCM1-gRNA-R | CCCTTGGGTAATCTCTGGTTAGTGATCATTTATCTTTCACTGCGGA | |
| ISR1-gRNA-F | GCCGACAGCTAAATTCAGTGAGGGTTTTAGAGCTAGAAATAGCAAG | ISR1-gRNA |
| ISR1-gRNA-R | CCTCACTGAATTTAGCTGTCGGCGATCATTTATCTTTCACTGCGGA | |
| TAE-F/R | GAGACTTTTCAAAGGGT/GATCTGGATTTTAGTACTGG | 2848 bp |
| AMT1-ADH1-F/R | GTTGATTGTATGCTTGGTATAGC/CCGGTAGAGGTGTGGTCAATAAG | 2401 bp |
| pEGFP-GlmD-F/R | CGGGGTCATTAGTTCATAGCCC/GCCCGCTCCTTTCGCTTTCTTC | 2977 bp |
| pEGFP-FE838-F/R | ACGGGGTCATTAGTTCATAGCC/CCGCTCCTTTCGCTTTCTTCCC | 2622 bp |
| TV-AFB1D-F/R | ATGGCTCGCGCGAAGTACTC/TTAAAGCTTCCGCTCTATGAA | 2091 bp |
| Strain | Fermentation Media, Time, and Genetic Characteristics | GlcN Yield (g/L) |
|---|---|---|
| HPG2 | YPD, 72 h, PFK1ΔPDB1Δ with GlmD/GlmP integration | 0.45 ± 0.03 |
| HPG5 | YPD, 72 h, PFK1ΔPDB1ΔGNA1ΔISR1ΔPCM1Δ with GlmD/GlmP/AMT1 integration | 1.3 ± 0.02 |
| HPG2 | YPD, 48 h, PFK1ΔPDB1Δ with GlmD/GlmP integration | 0.62 ± 0.01 |
| HPG5 | YPD, 48 h, PFK1ΔPDB1ΔGNA1ΔISR1ΔPCM1Δ with GlmD/GlmP/AMT1 integration | 1.41 ± 0.02 |
| HPG2 | YPD + 10 g/L (NH4)2SO4, 48 h, PFK1ΔPDB1Δ with Glm/GlmP integration | 0.79 ± 0.01 |
| HPG5 | YPD + 10 g/L (NH4)2SO4, 48 h, PFK1ΔPDB1ΔGNA1ΔISR1ΔPCM1Δ with GlmD/GlmP/AMT1 integration | 1.95 ± 0.02 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, P.; Ke, M.; Feng, J.; Zheng, Z.; Jiang, S. Engineered Saccharomyces cerevisiae for the Enhancement of Glucosamine Accumulation by the Consumption of Glucose and Ammonium Based on Synthetic Biological Pathways. Foods 2025, 14, 2783. https://doi.org/10.3390/foods14162783
Yang P, Ke M, Feng J, Zheng Z, Jiang S. Engineered Saccharomyces cerevisiae for the Enhancement of Glucosamine Accumulation by the Consumption of Glucose and Ammonium Based on Synthetic Biological Pathways. Foods. 2025; 14(16):2783. https://doi.org/10.3390/foods14162783
Chicago/Turabian StyleYang, Peizhou, Mingsi Ke, Jiaqi Feng, Zhi Zheng, and Shaotong Jiang. 2025. "Engineered Saccharomyces cerevisiae for the Enhancement of Glucosamine Accumulation by the Consumption of Glucose and Ammonium Based on Synthetic Biological Pathways" Foods 14, no. 16: 2783. https://doi.org/10.3390/foods14162783
APA StyleYang, P., Ke, M., Feng, J., Zheng, Z., & Jiang, S. (2025). Engineered Saccharomyces cerevisiae for the Enhancement of Glucosamine Accumulation by the Consumption of Glucose and Ammonium Based on Synthetic Biological Pathways. Foods, 14(16), 2783. https://doi.org/10.3390/foods14162783

