The Hepatic Antisteatosis Effect of Xanthohumol in High-Fat Diet-Fed Rats Entails Activation of AMPK as a Possible Protective Mechanism
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Drugs and Diets
2.3. Experimental Designs and Groups
2.4. Oral Glucose and Intraperitoneal Insulin Tolerance Test (OGTT and IPITT)
2.5. Collection of Serum, Tissues, and WAT Fat Pads
2.6. Liver Tissue Processing
2.7. Analyses of Lipids in the Liver and Serum
2.8. Biochemical Analysis in the Serum Samples
2.9. Biochemical Analysis in the Liver Homogenates
2.10. Real-Time Polymerase Chain Reaction (q-PCR)
2.11. Western Blotting
2.12. Histological Studies
2.13. Statistical Analysis
3. Results
3.1. XH Reverses the Gain in Food Intake and Body Weight in HFD-Fed Rats
3.2. XH Improves Glucose Levels after Glucose and Insulin Tolerance Tests in HFD-Fed Rats
3.3. XH Attenuates Markers of Adiposity in HFD-Fed Rats
3.4. XH Ameliorates Dyslipidemia and the Increase in Hepatic Lipid Levels in HFD-Fed Rats
3.5. XH Reduced Liver Damage Marker Enzymes in All Groups of Rats
3.6. XH Attenuates Lipid Peroxidation and Stimulates Nrf2 Activities and Antioxidant Levels in the Livers of HFD-Fed Rats
3.7. XH Inhibits the Activation of NF-κB and the Production of Inflammatory Cytokines in the Liver of HFD-Fed Rats
3.8. XH Suppresses the Phosphorylation (Activation) of AMPK, ACC-1, and SREBP1 in the Livers of HFD-Fed Rats
3.9. XH Improves Liver Histology and Ultrastructures in HFD-Fed Rats
4. Discussion
5. Conclusions and Future Perspectives
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Drake, I.; Sonestedt, E.; Ericson, U.; Wallström, P.; Orho-Melander, M. A Western dietary pattern is prospectively associated with cardio-metabolic traits and incidence of the metabolic syndrome. Br. J. Nutr. 2018, 119, 1168–1176. [Google Scholar] [CrossRef]
- Zhang, C.; Deng, J.; Liu, D.; Tuo, X.; Xiao, L.; Lai, B.; Yao, Q.; Liu, J.; Yang, H.; Wang, N. Nuciferine ameliorates hepatic steatosis in high-fat diet/streptozocin-induced diabetic mice through a PPARα/PPARγ coactivator-1α pathway. Br. J. Pharmacol. 2018, 175, 4218–4228. [Google Scholar] [CrossRef]
- Buzzetti, E.; Pinzani, M.; Tsochatzis, E.A. The multiple-hit pathogenesis of non-alcoholic fatty liver disease (NAFLD). Metabolism 2016, 65, 1038–1048. [Google Scholar] [CrossRef]
- Fu, Y.; Zhou, Y.; Shen, L.; Li, X.; Zhang, H.; Cui, Y.; Zhang, K.; Li, W.; Chen, W.-D.; Zhao, S. Diagnostic and therapeutic strategies for non-alcoholic fatty liver disease. Front. Pharmacol. 2022, 13, 973366. [Google Scholar] [CrossRef]
- Xu, X.; Poulsen, K.L.; Wu, L.; Liu, S.; Miyata, T.; Song, Q.; Wei, Q.; Zhao, C.; Lin, C.; Yang, J. Targeted therapeutics and novel signaling pathways in non-alcohol-associated fatty liver/steatohepatitis (NAFL/NASH). Signal Transduct. Target. Ther. 2022, 7, 287. [Google Scholar] [CrossRef]
- Robinson, S.M.; Mann, D.A. Role of nuclear factor κB in liver health and disease. Clin. Sci. 2010, 118, 691–705. [Google Scholar] [CrossRef]
- Li, R.; Jia, Z.; Zhu, H. Regulation of Nrf2 signaling. React. Oxyg. Species 2019, 8, 312. [Google Scholar] [CrossRef]
- Moslehi, A.; Hamidi-Zad, Z. Role of SREBPs in liver diseases: A mini-review. J. Clin. Transl. Hepatol. 2018, 6, 332. [Google Scholar] [CrossRef]
- Chyau, C.-C.; Wang, H.-F.; Zhang, W.-J.; Chen, C.-C.; Huang, S.-H.; Chang, C.-C.; Peng, R.Y. Antrodan alleviates high-fat and high-fructose diet-induced fatty liver disease in C57BL/6 mice model via AMPK/Sirt1/SREBP-1c/PPARγ pathway. Int. J. Mol. Sci. 2020, 21, 360. [Google Scholar] [CrossRef] [PubMed]
- Juszczak, F.; Caron, N.; Mathew, A.V.; Declèves, A.-E. Critical role for AMPK in metabolic disease-induced chronic kidney disease. Int. J. Mol. Sci. 2020, 21, 7994. [Google Scholar] [CrossRef]
- Smith, B.K.; Marcinko, K.; Desjardins, E.M.; Lally, J.S.; Ford, R.J.; Steinberg, G.R. Treatment of nonalcoholic fatty liver disease: Role of AMPK. Am. J. Physiol.-Endocrinol. Metab. 2016, 311, E730–E740. [Google Scholar] [CrossRef]
- de Souza, C.O.; Teixeira, A.A.; Biondo, L.A.; Lima Junior, E.A.; Batatinha, H.A.; Rosa Neto, J.C. Palmitoleic acid improves metabolic functions in fatty liver by PPARα-dependent AMPK activation. J. Cell Physiol. 2017, 232, 2168–2177. [Google Scholar] [CrossRef] [PubMed]
- Khaleel, E.F.; Abdel-Aleem, G.A.; Mostafa, D.G. Resveratrol improves high-fat diet induced fatty liver and insulin resistance by concomitantly inhibiting proteolytic cleavage of sterol regulatory element-binding proteins, free fatty acid oxidation, and intestinal triglyceride absorption. Can. J. Physiol. Pharmacol. 2018, 96, 145–157. [Google Scholar] [CrossRef]
- Long, Y.C.; Zierath, J.R. AMP-activated protein kinase signaling in metabolic regulation. J. Clin. Investig. 2006, 116, 1776–1783. [Google Scholar] [CrossRef]
- Fang, C.; Pan, J.; Qu, N.; Lei, Y.; Han, J.; Zhang, J.; Han, D. The AMPK pathway in fatty liver disease. Front. Physiol. 2022, 13, 970292. [Google Scholar] [CrossRef] [PubMed]
- Zimmermann, K.; Baldinger, J.; Mayerhofer, B.; Atanasov, A.G.; Dirsch, V.M.; Heiss, E.H. Activated AMPK boosts the Nrf2/HO-1 signaling axis—A role for the unfolded protein response. Free. Radic. Biol. Med. 2015, 88, 417–426. [Google Scholar] [CrossRef] [PubMed]
- Rancán, L.; Paredes, S.D.; García, I.; Muñoz, P.; García, C.; de Hontanar, G.L.; de la Fuente, M.; Vara, E.; Tresguerres, J.A. Protective effect of xanthohumol against age-related brain damage. J. Nutr. Biochem. 2017, 49, 133–140. [Google Scholar] [CrossRef]
- Liu, M.; Hansen, P.E.; Wang, G.; Qiu, L.; Dong, J.; Yin, H.; Qian, Z.; Yang, M.; Miao, J. Pharmacological profile of xanthohumol, a prenylated flavonoid from hops (Humulus lupulus). Molecules 2015, 20, 754–779. [Google Scholar] [CrossRef]
- Legette, L.L.; Luna, A.Y.M.; Reed, R.L.; Miranda, C.L.; Bobe, G.; Proteau, R.R.; Stevens, J.F. Xanthohumol lowers body weight and fasting plasma glucose in obese male Zucker fa/fa rats. Phytochemistry 2013, 91, 236–241. [Google Scholar] [CrossRef]
- Dorn, C.; Kraus, B.; Motyl, M.; Weiss, T.S.; Gehrig, M.; Schölmerich, J.; Heilmann, J.; Hellerbrand, C. Xanthohumol, a chalcon derived from hops, inhibits hepatic inflammation and fibrosis. Mol. Nutr. Food Res. 2010, 54, S205–S213. [Google Scholar] [CrossRef]
- Doddapattar, P.; Radović, B.; Patankar, J.V.; Obrowsky, S.; Jandl, K.; Nusshold, C.; Kolb, D.; Vujić, N.; Doshi, L.; Chandak, P.G. Xanthohumol ameliorates atherosclerotic plaque formation, hypercholesterolemia, and hepatic steatosis in ApoE-deficient mice. Mol. Nutr. Food Res. 2013, 57, 1718–1728. [Google Scholar] [CrossRef] [PubMed]
- Dostálek, P.; Karabín, M.; Jelínek, L. Hop phytochemicals and their potential role in metabolic syndrome prevention and therapy. Molecules 2017, 22, 1761. [Google Scholar] [CrossRef]
- Lima-Fontes, M.; Costa, R.; Rodrigues, I.; Soares, R. Xanthohumol restores hepatic glucolipid metabolism balance in type 1 diabetic wistar rats. J. Agric. Food Chem. 2017, 65, 7433–7439. [Google Scholar] [CrossRef]
- Miranda, C.L.; Johnson, L.A.; De Montgolfier, O.; Elias, V.D.; Ullrich, L.S.; Hay, J.J.; Paraiso, I.L.; Choi, J.; Reed, R.L.; Revel, J.S. Non-estrogenic xanthohumol derivatives mitigate insulin resistance and cognitive impairment in high-fat diet-induced obese mice. Sci. Rep. 2018, 8, 613. [Google Scholar] [CrossRef] [PubMed]
- Rossi, R.; Whyand, T.; Caplin, M. Benefits of xanthohumol in hyperlipidaemia, obesity and type 2 diabetes mellitus: A review. J. Obes. Chronic. Dis. 2019, 3, 14–18. [Google Scholar] [CrossRef]
- Paraiso, I.L.; Tran, T.Q.; Magana, A.A.; Kundu, P.; Choi, J.; Maier, C.S.; Bobe, G.; Raber, J.; Kioussi, C.; Stevens, J.F. Xanthohumol ameliorates diet-induced liver dysfunction via farnesoid X receptor-dependent and independent signaling. Front. Pharmacol. 2021, 12, 643857. [Google Scholar] [CrossRef]
- Araújo, J.R.; Gonçalves, P.; Martel, F. Modulation of glucose uptake in a human choriocarcinoma cell line (BeWo) by dietary bioactive compounds and drugs of abuse. J. Biochem. 2008, 144, 177–186. [Google Scholar] [CrossRef]
- Mendes, V.; Monteiro, R.; Pestana, D.; Teixeira, D.; Calhau, C.; Azevedo, I. Xanthohumol influences preadipocyte differentiation: Implication of antiproliferative and apoptotic effects. J. Agric. Food Chem. 2008, 56, 11631–11637. [Google Scholar] [CrossRef]
- Yang, J.-Y.; Della-Fera, M.; Rayalam, S.; Baile, C. Effect of xanthohumol and isoxanthohumol on 3T3-L1 cell apoptosis and adipogenesis. Apoptosis 2007, 12, 1953–1963. [Google Scholar] [CrossRef]
- Rayalam, S.; Yang, J.Y.; Della-Fera, M.A.; Park, H.J.; Ambati, S.; Baile, C.A. Anti-obesity effects of xanthohumol plus guggulsterone in 3T3-L1 adipocytes. J. Med. Food 2009, 12, 846–853. [Google Scholar] [CrossRef]
- Kiyofuji, A.; Yui, K.; Takahashi, K.; Osada, K. Effects of xanthohumol-rich hop extract on the differentiation of preadipocytes. J. Oleo Sci. 2014, 63, 593–597. [Google Scholar] [CrossRef] [PubMed]
- Kirkwood, J.S.; Legette, L.L.; Miranda, C.L.; Jiang, Y.; Stevens, J.F. A metabolomics-driven elucidation of the anti-obesity mechanisms of xanthohumol. J. Biol. Chem. 2013, 288, 19000–19013. [Google Scholar] [CrossRef]
- Liu, M.; Yin, H.; Liu, G.; Dong, J.; Qian, Z.; Miao, J. Xanthohumol, a prenylated chalcone from beer hops, acts as an α-glucosidase inhibitor in vitro. J. Agric. Food Chem. 2014, 62, 5548–5554. [Google Scholar] [CrossRef]
- Tabata, N.; Ito, M.; Tomoda, H.; Omura, S. Xanthohumols, diacylglycerol acyltransferase inhibitors, from Humulus lupulus. Phytochemistry 1997, 46, 683–687. [Google Scholar] [CrossRef] [PubMed]
- Hirata, H.; Segawa, S.; Ozaki, M.; Kobayashi, N.; Shigyo, T.; Chiba, H. Xanthohumol prevents atherosclerosis by reducing arterial cholesterol content via CETP and apolipoprotein E in CETP-transgenic mice. PLoS ONE 2012, 7, e49415. [Google Scholar] [CrossRef] [PubMed]
- Dorn, C.; Heilmann, J.; Hellerbrand, C. Protective effect of xanthohumol on toxin-induced liver inflammation and fibrosis. Int. J. Clin. Exp. Pathol. 2012, 5, 29. [Google Scholar] [CrossRef]
- Dorn, C.; Massinger, S.; Wuzik, A.; Heilmann, J.; Hellerbrand, C. Xanthohumol suppresses inflammatory response to warm ischemia–reperfusion induced liver injury. Exp. Mol. Pathol. 2013, 94, 10–16. [Google Scholar] [CrossRef]
- Shati, A.A. Xanthohumol protects against renal ischaemia reperfusion (I/R) injury by scavenging ROS and inhibition of JAK-2/STAT-3 inflammatory pathway. J. Taibah Univ. Sci. 2017, 11, 458–470. [Google Scholar] [CrossRef][Green Version]
- Campillo, S.; Rancan, L.; Paredes, S.D.; Higuera, M.; Izquierdo, A.; García, C.; Forman, K.; Tresguerres, J.A.; Vara, E. Effect of treatment with xanthohumol on cardiological alterations secondary to ageing. J. Funct. Foods 2018, 49, 44–51. [Google Scholar] [CrossRef]
- Lee, I.-S.; Lim, J.; Gal, J.; Kang, J.C.; Kim, H.J.; Kang, B.Y.; Choi, H.J. Anti-inflammatory activity of xanthohumol involves heme oxygenase-1 induction via NRF2-ARE signaling in microglial BV2 cells. Neurochem. Int. 2011, 58, 153–160. [Google Scholar] [CrossRef]
- Paraiso, I.L.; Mattio, L.M.; Alcázar Magaña, A.; Choi, J.; Plagmann, L.S.; Redick, M.A.; Miranda, C.L.; Maier, C.S.; Dallavalle, S.; Kioussi, C. Xanthohumol Pyrazole Derivative Improves Diet-Induced Obesity and Induces Energy Expenditure in High-Fat Diet-Fed Mice. ACS Pharmacol. Transl. Sci. 2021, 4, 1782–1793. [Google Scholar] [CrossRef] [PubMed]
- Ma, S.; Zhang, R.; Li, L.; Qu, H.; Wang, J.; Yang, Q.; Guo, C.; Miao, S.; Shi, X. Xanthohumol protect cognitive performance in diabetic model rats by inhibiting protein kinase B/nuclear factor kappa-B pathway. Neuroreport 2021, 32, 651–658. [Google Scholar] [CrossRef]
- Li, F.; Zhang, J.; Luo, L.; Hu, J. Protective effects of Xanthohumol against diabetic nephropathy in a mouse model. Kidney Blood Press. Res. 2023, 48, 92–101. [Google Scholar] [CrossRef] [PubMed]
- Samuels, J.S.; Shashidharamurthy, R.; Rayalam, S. Novel anti-obesity effects of beer hops compound xanthohumol: Role of AMPK signaling pathway. Nutr. Metab. 2018, 15, 42. [Google Scholar] [CrossRef]
- Lu, X.; Liu, M.; Dong, H.; Miao, J.; Stagos, D.; Liu, M. Dietary prenylated flavonoid xanthohumol alleviates oxidative damage and accelerates diabetic wound healing via Nrf2 activation. Food Chem. Toxicol. 2022, 160, 112813. [Google Scholar] [CrossRef]
- Gallo, C.; Dallaglio, K.; Bassani, B.; Rossi, T.; Rossello, A.; Noonan, D.M.; D’Uva, G.; Bruno, A.; Albini, A. Hop derived flavonoid xanthohumol inhibits endothelial cell functions via AMPK activation. Oncotarget 2016, 7, 59917. [Google Scholar] [CrossRef] [PubMed]
- Lv, H.; Liu, Q.; Wen, Z.; Feng, H.; Deng, X.; Ci, X. Xanthohumol ameliorates lipopolysaccharide (LPS)-induced acute lung injury via induction of AMPK/GSK3β-Nrf2 signal axis. Redox Biol. 2017, 12, 311–324. [Google Scholar] [CrossRef]
- Miyata, S.; Inoue, J.; Shimizu, M.; Sato, R. Xanthohumol improves diet-induced obesity and fatty liver by suppressing sterol regulatory element-binding protein (SREBP) activation. J. Biol. Chem. 2015, 290, 20565–20579. [Google Scholar] [CrossRef]
- Newman, N.K.; Zhang, Y.; Padiadpu, J.; Miranda, C.L.; Magana, A.A.; Wong, C.P.; Hioki, K.A.; Pederson, J.W.; Li, Z.; Gurung, M.; et al. Reducing gut microbiome-driven adipose tissue inflammation alleviates metabolic syndrome. Microbiome 2023, 11, 208. [Google Scholar] [CrossRef]
- Zhang, Y.; Bobe, G.; Miranda, C.L.; Lowry, M.B.; Hsu, V.L.; Lohr, C.V.; Wong, C.P.; Jump, D.B.; Robinson, M.M.; Sharpton, T.J. Tetrahydroxanthohumol, a xanthohumol derivative, attenuates high-fat diet-induced hepatic steatosis by antagonizingPPARγ. Elife 2021, 10, e66398. [Google Scholar] [CrossRef]
- Wang, W.; Chen, Z.; Zheng, T.; Zhang, M. Xanthohumol alleviates T2DM-induced liver steatosis and fibrosis by mediating the NRF2/RAGE/NF-κB signaling pathway. Future Med. Chem. 2021, 13, 2069–2081. [Google Scholar] [CrossRef]
- Yahya, M.A.; Alshammari, G.M.; Osman, M.A.; Al-Harbi, L.N.; Yagoub, A.E.A.; AlSedairy, S.A. Liquorice root extract and isoliquiritigenin attenuate high-fat diet-induced hepatic steatosis and damage in rats by regulating AMPK. Arch. Physiol. Biochem. 2022, 1–16. [Google Scholar] [CrossRef] [PubMed]
- ALTamimi, J.Z.; Alshammari, G.M.; AlFaris, N.A.; Alagal, R.I.; Aljabryn, D.H.; Albekairi, N.A.; Alkhateeb, M.A.; Yahya, M.A. Ellagic acid protects against non-alcoholic fatty liver disease in streptozotocin-diabetic rats by activating AMPK. Pharm. Biol. 2022, 60, 25–37. [Google Scholar] [CrossRef] [PubMed]
- Zaitone, S.A.; Barakat, B.M.; Bilasy, S.E.; Fawzy, M.S.; Abdelaziz, E.Z.; Farag, N.E. Protective effect of boswellic acids versus pioglitazone in a rat model of diet-induced non-alcoholic fatty liver disease: Influence on insulin resistance and energy expenditure. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2015, 388, 587–600. [Google Scholar] [CrossRef] [PubMed]
- Zakaria, Z.; Othman, Z.A.; Bagi Suleiman, J.; Jalil, N.A.C.; Ghazali, W.S.W.; Mohamed, M. Protective and therapeutic effects of orlistat on metabolic syndrome and oxidative stress in high-fat diet-induced metabolic dysfunction-associated fatty liver disease (MAFLD) in rats: Role on Nrf2 activation. Vet. Sci. 2021, 8, 274. [Google Scholar] [CrossRef]
- Mohammed, H.M. Zingerone ameliorates non-alcoholic fatty liver disease in rats by activating AMPK. J. Food Biochem. 2022, 46, e14149. [Google Scholar] [CrossRef]
- Majid, H.; Masood, Q.; Khan, A.H. Homeostatic Model Assessment for Insulin Resistance (HOMA-IR): A Better Marker for Evaluating Insulin Resistance Than Fasting Insulin in Women with Polycystic Ovarian Syndrome. J. Coll. Physicians Surg. Pak. 2017, 27, 123–126. [Google Scholar]
- Folch, J.; Lees, M.; Sloane Stanley, G.H. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef]
- Godoy-Matos, A.F.; Silva Júnior, W.S.; Valerio, C.M. NAFLD as a continuum: From obesity to metabolic syndrome and diabetes. Diabetol. Metab. Syndr. 2020, 12, 60. [Google Scholar] [CrossRef]
- Nozawa, H. Xanthohumol, the chalcone from beer hops (Humulus lupulus L.), is the ligand for farnesoid X receptor and ameliorates lipid and glucose metabolism in KK-Ay mice. Biochem. Biophys. Res. Commun. 2005, 336, 754–761. [Google Scholar] [CrossRef]
- Tseng, P.-T.; Cheng, Y.-S.; Yen, C.-F.; Chen, Y.-W.; Stubbs, B.; Whiteley, P.; Carvalho, A.F.; Li, D.-J.; Chen, T.-Y.; Yang, W.-C. Peripheral iron levels in children with attention-deficit hyperactivity disorder: A systematic review and meta-analysis. Sci. Rep. 2018, 8, 788. [Google Scholar] [CrossRef]
- Miranda, C.L.; Elias, V.D.; Hay, J.J.; Choi, J.; Reed, R.L.; Stevens, J.F. Xanthohumol improves dysfunctional glucose and lipid metabolism in diet-induced obese C57BL/6J mice. Arch. Biochem. Biophys. 2016, 599, 22–30. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, K.; Osada, K. Effects of isoflavone supplementation on disturbances in lipid metabolism and antioxidant system due to exogenous cholesterol oxidation products in rats. J. Funct. Foods 2017, 66, 531–541. [Google Scholar]
- Wu, L.; Zhang, L.; Li, B.; Jiang, H.; Duan, Y.; Xie, Z.; Shuai, L.; Li, J.; Li, J. AMP-activated protein kinase (AMPK) regulates energy metabolism through modulating thermogenesis in adipose tissue. Front. Physiol. 2018, 9, 122. [Google Scholar] [CrossRef]
- Zhang, Z.; Zhang, H.; Li, B.; Meng, X.; Wang, J.; Zhang, Y.; Yao, S.; Ma, Q.; Jin, L.; Yang, J. Berberine activates thermogenesis in white and brown adipose tissue. Nat. Commun. 2014, 5, 5493. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Sun, J.; Liu, M.; Zhou, Y.; Zhang, L.; Li, Y. The new role of AMP-activated protein kinase in regulating fat metabolism and energy expenditure in adipose tissue. Biomolecules 2021, 11, 1757. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.-J.; Tang, T.; Abbott, M.; Viscarra, J.A.; Wang, Y.; Sul, H.S. AMPK phosphorylates desnutrin/ATGL and hormone-sensitive lipase to regulate lipolysis and fatty acid oxidation within adipose tissue. Mol. Cell. Biol. 2016, 36, 1961–1976. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.; Kang, R.; Bae, S.; Yoon, Y. AICAR, an activator of AMPK, inhibits adipogenesis via the WNT/β-catenin pathway in 3T3-L1 adipocytes. Int. J. Mol. Med. 2011, 28, 65–71. [Google Scholar]
- Bijland, S.; Mancini, S.J.; Salt, I.P. Role of AMP-activated protein kinase in adipose tissue metabolism and inflammation. Clin. Sci. 2013, 124, 491–507. [Google Scholar] [CrossRef]
- Daval, M.; Foufelle, F.; Ferré, P. Functions of AMP-activated protein kinase in adipose tissue. J. Physiol. 2006, 574, 55–62. [Google Scholar] [CrossRef]
- Kim, K.-Y.; Jang, H.-J.; Yang, Y.R.; Park, K.-I.; Seo, J.; Shin, I.-W.; Jeon, T.-I.; Ahn, S.-C.; Suh, P.-G.; Osborne, T.F. SREBP-2/PNPLA8 axis improves non-alcoholic fatty liver disease through activation of autophagy. Sci. Rep. 2016, 6, 37794. [Google Scholar] [PubMed]
- Wang, Q.; Liu, S.; Zhai, A.; Zhang, B.; Tian, G. AMPK-mediated regulation of lipid metabolism by phosphorylation. Biol. Pharm. Bull. 2018, 41, 985–993. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.; Liang, X.; Sun, X.; Zhang, L.; Fu, X.; Rogers, C.J.; Berim, A.; Zhang, S.; Wang, S.; Wang, B. AMPK/α-ketoglutarate axis dynamically mediates DNA demethylation in the Prdm16 promoter and brown adipogenesis. Cell Metab. 2016, 24, 542–554. [Google Scholar] [CrossRef] [PubMed]
- Katsiki, N.; Mikhailidis, D.P.; Mantzoros, C.S. Non-alcoholic fatty liver disease and dyslipidemia: An update. Metabolism 2016, 65, 1109–1123. [Google Scholar] [CrossRef] [PubMed]
- Arroyave-Ospina, J.C.; Wu, Z.; Geng, Y.; Moshage, H. Role of oxidative stress in the pathogenesis of non-alcoholic fatty liver disease: Implications for prevention and therapy. Antioxidants 2021, 10, 174. [Google Scholar] [CrossRef]
- Zhang, Q.-Q.; Lu, L.-G. Nonalcoholic fatty liver disease: Dyslipidemia, risk for cardiovascular complications, and treatment strategy. J. Clin. Transl. Hepatol. 2015, 3, 78. [Google Scholar]
- Salvoza, N.; Giraudi, P.J.; Tiribelli, C.; Rosso, N. Natural compounds for counteracting nonalcoholic fatty liver disease (NAFLD): Advantages and limitations of the suggested candidates. Int. J. Mol. Sci. 2022, 23, 2764. [Google Scholar] [CrossRef]
- Casaschi, A.; Maiyoh, G.K.; Rubio, B.K.; Li, R.W.; Adeli, K.; Theriault, A.G. The chalcone xanthohumol inhibits triglyceride and apolipoprotein B secretion in HepG2 cells. J. Nutr. 2004, 134, 1340–1346. [Google Scholar] [CrossRef]
- Li, Y.; Xu, S.; Mihaylova, M.M.; Zheng, B.; Hou, X.; Jiang, B.; Park, O.; Luo, Z.; Lefai, E.; Shyy, J.Y.-J. AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice. Cell Metab. 2011, 13, 376–388. [Google Scholar] [CrossRef]
- Ding, X.; Jian, T.; Li, J.; Lv, H.; Tong, B.; Li, J.; Meng, X.; Ren, B.; Chen, J. Chicoric acid ameliorates nonalcoholic fatty liver disease via the AMPK/Nrf2/NFκB signaling pathway and restores gut microbiota in high-fat-diet-fed mice. Oxid. Med. Cell. Longev. 2020, 2020, 9734560. [Google Scholar] [CrossRef]
- Lu, M.C.; Ji, J.A.; Jiang, Z.Y.; You, Q.D. The Keap1–Nrf2–ARE pathway as a potential preventive and therapeutic target: An update. Med. Res. Rev. 2016, 36, 924–963. [Google Scholar] [CrossRef]
- Solt, L.A.; May, M.J. The IκB kinase complex: Master regulator of NF-κB signaling. Immunol. Res. 2008, 42, 3–18. [Google Scholar] [CrossRef] [PubMed]
- Sun, W.; Liu, P.; Yang, B.; Wang, M.; Wang, T.; Sun, W.; Wang, X.; Zheng, W.; Song, X.; Li, J. A network pharmacology approach: Inhibition of the NF-κB signaling pathway contributes to the NASH preventative effect of an Oroxylum indicum seed extract in oleic acid-stimulated HepG2 cells and high-fat diet-fed rats. Phytomedicine 2021, 88, 153498. [Google Scholar] [CrossRef] [PubMed]
- Chambel, S.S.; Santos-Gonçalves, A.; Duarte, T.L. The dual role of Nrf2 in nonalcoholic fatty liver disease: Regulation of antioxidant defenses and hepatic lipid metabolism. Biomed. Res. Int. 2015, 2015, 597134. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.-D.; Yu, W.-L.; Sun, Y. Activation of AMPK restored impaired autophagy and inhibited inflammation reaction by up-regulating SIRT1 in acute pancreatitis. Life Sci. 2021, 277, 119435. [Google Scholar] [CrossRef]
- Saito, K.; Matsuo, Y.; Imafuji, H.; Okubo, T.; Maeda, Y.; Sato, T.; Shamoto, T.; Tsuboi, K.; Morimoto, M.; Takahashi, H. Xanthohumol inhibits angiogenesis by suppressing nuclear factor-κB activation in pancreatic cancer. Cancer Sci. 2018, 109, 132–140. [Google Scholar] [CrossRef]
- Cho, Y.-C.; Kim, H.J.; Kim, Y.-J.; Lee, K.Y.; Choi, H.J.; Lee, I.-S.; Kang, B.Y. Differential anti-inflammatory pathway by xanthohumol in IFN-γ and LPS-activated macrophages. Int. Immunopharmacol. 2008, 8, 567–573. [Google Scholar] [CrossRef]
- Peluso, M.R.; Miranda, C.L.; Hobbs, D.J.; Proteau, R.R.; Stevens, J.F. Xanthohumol and related prenylated flavonoids inhibit inflammatory cytokine production in LPS-activated THP-1 monocytes: Structure-activity relationships and in silico binding to myeloid differentiation protein-2 (MD-2). Planta Med. 2010, 76, 1536–1543. [Google Scholar] [CrossRef]
- Xia, T.; Liu, X.; Wang, N.; Jiang, Y.; Bai, H.; Xu, W.; Feng, K.; Han, T.; Xin, H. PI3K/AKT/Nrf2 signalling pathway is involved in the ameliorative effects of xanthohumol on amyloid β-induced oxidative damage and bone loss. J. Pharm. Pharmacol. 2022, 74, 1017–1026. [Google Scholar] [CrossRef]
- Bullón, P.; Alcocer-Gómez, E.; Carrión, A.M.; Marín-Aguilar, F.; Garrido-Maraver, J.; Román-Malo, L.; Ruiz-Cabello, J.; Culic, O.; Ryffel, B.; Apetoh, L. AMPK phosphorylation modulates pain by activation of NLRP3 inflammasome. Antioxid. Redox Signal. 2016, 24, 157–170. [Google Scholar] [CrossRef]
- Kosuru, R.; Kandula, V.; Rai, U.; Prakash, S.; Xia, Z.; Singh, S. Pterostilbene decreases cardiac oxidative stress and inflammation via activation of AMPK/Nrf2/HO-1 pathway in fructose-fed diabetic rats. Cardiovasc. Drugs Ther. 2018, 32, 147–163. [Google Scholar] [CrossRef]
- Yang, D.; Han, B.; Baiyun, R.; Lv, Z.; Wang, X.; Li, S.; Lv, Y.; Xue, J.; Liu, Y.; Zhang, Z. Sulforaphane attenuates hexavalent chromium-induced cardiotoxicity via the activation of the Sesn2/AMPK/Nrf2 signaling pathway. Metallomics 2020, 12, 2009–2020. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Xu, Y.; Cheng, S.; Zhou, X.; Zhou, F.; He, P.; Hu, F.; Zhang, L.; Chen, Y.; Jia, Y. Geniposide combined with notoginsenoside R1 attenuates inflammation and apoptosis in atherosclerosis via the AMPK/mTOR/Nrf2 signaling pathway. Front. Pharmacol. 2021, 12, 687394. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Sun, X.; Zhu, G.; Mao, J.; Baban, B.; Qin, X. Local delivery of simvastatin maintains tooth anchorage during mechanical tooth moving via anti-inflammation property and AMPK/MAPK/NF-kB inhibition. J. Cell. Mol. Med. 2021, 25, 333–344. [Google Scholar] [CrossRef]
- Entezari, M.; Hashemi, D.; Taheriazam, A.; Zabolian, A.; Mohammadi, S.; Fakhri, F.; Hashemi, M.; Hushmandi, K.; Ashrafizadeh, M.; Zarrabi, A. AMPK signaling in diabetes mellitus, insulin resistance and diabetic complications: A pre-clinical and clinical investigation. Biomed. Pharmacother. 2022, 146, 112563. [Google Scholar] [CrossRef]
- Wang, Z.; Chen, Z.; Jiang, Z.; Luo, P.; Liu, L.; Huang, Y.; Wang, H.; Wang, Y.; Long, L.; Tan, X. Cordycepin prevents radiation ulcer by inhibiting cell senescence via NRF2 and AMPK in rodents. Nat. Commun. 2019, 10, 2538. [Google Scholar] [CrossRef]
- Dusabimana, T.; Park, E.J.; Je, J.; Jeong, K.; Yun, S.P.; Kim, H.J.; Kim, H.; Park, S.W. Geniposide improves diabetic nephropathy by enhancing ULK1-mediated autophagy and reducing oxidative stress through AMPK activation. Int. J. Mol. Sci. 2021, 22, 1651. [Google Scholar] [CrossRef] [PubMed]
- Salminen, A.; Hyttinen, J.M.; Kaarniranta, K. AMP-activated protein kinase inhibits NF-κB signaling and inflammation: Impact on healthspan and lifespan. J. Mol. Med. 2011, 89, 667–676. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.-W.; Wang, W.; Sheng, H.; Bai, Y.-F.; Weng, Y.-Y.; Fan, X.-Y.; Zheng, F.; Zhu, X.-T.; Xu, Z.-C.; Zhang, F. Hesperetin, a SIRT1 activator, inhibits hepatic inflammation via AMPK/CREB pathway. Int. Immunopharmacol. 2020, 89, 107036. [Google Scholar] [CrossRef]
- Xu, C.; Song, Y.; Wang, Z.; Jiang, J.; Piao, Y.; Li, L.; Jin, S.; Li, L.; Zhu, L.; Yan, G. Pterostilbene suppresses oxidative stress and allergic airway inflammation through AMPK/Sirt1 and Nrf2/HO-1 pathways. Immun. Inflamm. Dis. 2021, 9, 1406–1417. [Google Scholar] [CrossRef]
- Li, X.-N.; Song, J.; Zhang, L.; LeMaire, S.A.; Hou, X.; Zhang, C.; Coselli, J.S.; Chen, L.; Wang, X.L.; Zhang, Y. Activation of the AMPK-FOXO3 pathway reduces fatty acid–induced increase in intracellular reactive oxygen species by upregulating thioredoxin. Diabetes 2009, 58, 2246–2257. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Zhang, M.; Liang, B.; Xu, J.; Xie, Z.; Liu, C.; Viollet, B.; Yan, D.; Zou, M.-H. AMPKα2 deletion causes aberrant expression and activation of NAD (P) H oxidase and consequent endothelial dysfunction in vivo: Role of 26S proteasomes. Circ. Res. 2010, 106, 1117–1128. [Google Scholar] [CrossRef] [PubMed]
- Eid, A.A.; Ford, B.M.; Block, K.; Kasinath, B.S.; Gorin, Y.; Ghosh-Choudhury, G.; Barnes, J.L.; Abboud, H.E. AMP-activated protein kinase (AMPK) negatively regulates Nox4-dependent activation of p53 and epithelial cell apoptosis in diabetes. J. Biol. Chem. 2010, 285, 37503–37512. [Google Scholar] [CrossRef] [PubMed]
Target | Primers Sequence 5′→3′ | Accession No. | Base Pair Length |
---|---|---|---|
AMPK | F: GAAGTCAAAGCCGACCCAAT R: AGGGTTCTTCCTTCGCACAC | NM_019142 | 116 |
SREBP1c | F: GCTCACAAAAGCAAATCACT R: GCGTTTCTACCACTTCAGG | NM_001276707.1 | 191 |
ACC-1 | F: TGAGGAGGACCGCATTTATC R: AAGCTTCCTTCGTGACCAGA | NM_022193.1 | 221 |
β-actin | F: CGAGTACAACCTTCTTGCAGC R: CCTTCTGACCCATACCCACC | NM_031144.3 | 209 |
Parameter | STD | XH | HFD | HFD + XH | HFD + XH + CC |
---|---|---|---|---|---|
Final body weight (g) | 429.3 ± 37.3 | 419.8 ± 33.5 | 537.4 ± 47.4 ***,### | 423.6 ± 31.9 $$$ | 524.4 ± 51.7 ***,###,&&& |
Subcutaneous fat (g) | 4.1 ± 0.3 | 4.4 ± 0.5 | 8.2 ± 0.7 ***,### | 4.8 ± 0.4 *,$$$ | 7.9 ± 0.8 ***,###,&&& |
Epididymal fat (g) | 6.8 ± 0.6 | 6.1 ± 0.7 | 13.5 ± 1.5 ***,### | 8.3 ± 0.8 *,#,$$$ | 14.1 ± 1.3 ***,###,&&& |
Peritoneal fat (g) | 3.2 ± 0.2 | 3.3 ± 0.4 | 7.6 ± 0.5 ***,### | 4.3 ± 0.3 *,#,$$$ | 7.1 ± 0.8 ***,###,&&& |
Fasting glucose (mg/dL) | 111.4 ± 9.7 | 94.2 ± 8.6 ** | 178.1 ± 16.4 ***,### | 116.3 ± 10.1 #,$$$ | 169.8 ± 11.4 ***,###,&&& |
Fasting insulin (µIU/mL) | 4.3 ± 0.6 | 4.1 ± 0.4 | 7.9 ± 0.7 ***,### | 5.1 ± 0.5 **,#,$$$ | 8.2 ± 0.7 ***,###,&&& |
HOMA-IR | 1.17 ± 0.1 | 0.91 ± 0.08 * | 3.2 ± 0.4 ***,### | 1.5 ± 0.2 **,###,$$$ | 3.4 ± 0.4 ***,###,&&& |
Serum leptin (ng/mL) | 34.2 ± 3.4 | 36.5 ± 3.1 | 94.5 ± 8.3 ***,### | 46.7 ± 5.1 **,##,$$$ | 89.5± 9.4 ***,###,&&& |
Serum FFAs (mmol/L) | 1.2 ± 0.1 | 0.84 ± 0.05 * | 2.7 ± 0.2 ***,### | 1.4 ± 0.1 *,###,$$$ | 2.5 ± 0.3 ***,###,&&& |
Serum TNF-α (pg/mL) | 265.2 ± 19.2 | 187.2 ± 15.7 * | 655.3 ± 57.4 ***,### | 349.1 ± 28.3 *,###,$$$ | 638.9 ± 68.3 ***,###,&&& |
Parameter | STD | XH | HFD | HFD + XH | HFD + XH + CC | |
---|---|---|---|---|---|---|
Serum | TGs (mg/dL) | 89.3 ± 9.1 | 77.3 ± 6.5 ** | 168.3 ± 15.2 ***,### | 95.3 ± 8.6 ###,$$$ | 175 ± 17.8 ***,###,&&& |
CHOL (mg/dL) | 75.6 ± 6.9 | 61.3 ± 5.7 ** | 187.4 ± 16.4 ***,### | 96.4 ± 7.4 **,###,$$$ | 194.3 ± 17.3 ***,###,&&& | |
HDL-c (mg/dL) | 23.2 ± 2.1 | 26.7 ± 2.4 | 11.5 ± 1.9 ***,### | 24.5 ± 2.7 $$$ | 10.8 ± 9.7 ***,###,&&& | |
LDL-c (mg/dL) | 32.3 ± 3.6 | 21.5 ± 2.6 * | 99.6 ± 8.5 ***,### | 41.4 ± 3.9 *,###,$$$ | 103.1 ± 9.1 ***,###,&&& | |
Ox-LDL-c (ng/mL) | 11.3 ± 1.1 | 6.8 ± 0.71 *** | 44.8 ± 3.6 ***,### | 17.8 ± 2.5 **,###,$$$ | 48.9 ± 5.1 ***,###,&&& | |
Liver | TGs (ng/g tissue) | 225.4 ± 19.5 | 148.2 ± 11.4 ** | 564.2 ± 42.2 ***,### | 258.2 ± 21.4 *,###,$$$ | 610.3± 54.6 ***,###,&&& |
CHOL (ng/g tissue) | 78.4 ± 5.7 | 58.7 ± 4.7 ** | 198.4 ± 15.4 ***,### | 85.7 ± 8.9 **,###,$$$ | 184.4 ± 16.7 ***,###,&&& | |
FFAs (μmol/g tissue) | 125.4 ± 11.4 | 89.5 ± 6.9 *** | 349.5 ± 46.7 ***,### | 167.3 ± 17.8 *,###,$$$ | 324 ± 33.1 ***,###,&&& | |
Stool | TGs (ng/g) | 2.1 ± 0.3 | 2.4 ± 0.4 | 4.9 ± 0.4 ***,### | 4.4 ± 0.6 ***,### | 5.3 ± 0.5 ***,### |
CHOL (ng/g) | 2.6 ± 0.2 | 2.5 ± 0.3 ** | 6.3 ± 0.5 ***,### | 6.1 ± 0.6 ***,### | 5.9 ± 0.6 ***,### |
Parameter | STD | XH | HFD | HFD + XH | HFD + XH + CC |
---|---|---|---|---|---|
ALT (U/L) | 27.8 ± 2.6 | 25.8 ± 3.5 | 76.4 ± 5.3 ***,### | 35.2 ± 3.1 ***,###,$$$ | 81.4 ± 8.3 ***,###,&&& |
AST (U/L) | 16.6 ± 1.2 | 19.3 ± 3.2 | 88.7 ± 6.5 ***,### | 27.8 ± 2.8 **,###,$$$ | 86.1 ± 6.9 ***,###,&&& |
GGT (U/L) | 21.5 ± 2.9 | 24.3 ± 2.6 | 105.3 ± 8.9 ***,### | 38.2 ± 3 ***,###,$$$ | 99.2 ± 10.6 ***,###,&&& |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Atteia, H.H.; AlFaris, N.A.; Alshammari, G.M.; Alamri, E.; Ahmed, S.F.; Albalwi, R.; Abdel-Sattar, S.A.-L. The Hepatic Antisteatosis Effect of Xanthohumol in High-Fat Diet-Fed Rats Entails Activation of AMPK as a Possible Protective Mechanism. Foods 2023, 12, 4214. https://doi.org/10.3390/foods12234214
Atteia HH, AlFaris NA, Alshammari GM, Alamri E, Ahmed SF, Albalwi R, Abdel-Sattar SA-L. The Hepatic Antisteatosis Effect of Xanthohumol in High-Fat Diet-Fed Rats Entails Activation of AMPK as a Possible Protective Mechanism. Foods. 2023; 12(23):4214. https://doi.org/10.3390/foods12234214
Chicago/Turabian StyleAtteia, Hebatallah Husseini, Nora A. AlFaris, Ghedeir M. Alshammari, Eman Alamri, Salwa Fares Ahmed, Renad Albalwi, and Sahar Abdel-Latif Abdel-Sattar. 2023. "The Hepatic Antisteatosis Effect of Xanthohumol in High-Fat Diet-Fed Rats Entails Activation of AMPK as a Possible Protective Mechanism" Foods 12, no. 23: 4214. https://doi.org/10.3390/foods12234214
APA StyleAtteia, H. H., AlFaris, N. A., Alshammari, G. M., Alamri, E., Ahmed, S. F., Albalwi, R., & Abdel-Sattar, S. A.-L. (2023). The Hepatic Antisteatosis Effect of Xanthohumol in High-Fat Diet-Fed Rats Entails Activation of AMPK as a Possible Protective Mechanism. Foods, 12(23), 4214. https://doi.org/10.3390/foods12234214