Next Article in Journal
Integrated In Silico and In Vitro Assessment of the Anticancer Potential of Origanum vulgare L. Essential Oil
Next Article in Special Issue
Bioprocessed Guishe Juice (Agave lechuguilla Residue) as a Dual-Action Bioagent for Weed and Fungal Control in Sustainable Agriculture
Previous Article in Journal
Experimental and Numerical Study of Multi-Cluster Fracturing in Horizontal Wells for Low-Permeability Reservoirs
Previous Article in Special Issue
Proteins from Kappaphycus alvarezii: Identification by Mass Spectrometry and Antifungal Potential
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Re-Identification of Dollar Spot Pathogen on Creeping Bentgrass and Kentucky Bluegrass in South Korea

1
Department of Environmental Health Science, Konkuk University, Seoul 05029, Republic of Korea
2
E&L Turfgrass Institute, E&L Co., Ltd., Hwaseong 18471, Republic of Korea
3
Department of Golf Course Management, Korea Golf University of Science & Technology, Hoengseong 25247, Republic of Korea
*
Authors to whom correspondence should be addressed.
Processes 2025, 13(6), 1694; https://doi.org/10.3390/pr13061694
Submission received: 7 March 2025 / Revised: 9 May 2025 / Accepted: 23 May 2025 / Published: 28 May 2025

Abstract

Dollar spot is one of the world’s most widely distributed turfgrass diseases. The pathogen of the disease has been re-identified as a fungus belonging to the genus Clarireedia in the United States, Japan, and China. Since Clarireedia species vary depending on the response to fungicides, hosts, and distribution ranges, it is necessary to re-identify dollar spot in South Korea for effective turfgrass management. In this study, the amplified nucleotide sequences with primer sets of the internal transcribed spacer (ITS) region, Calmodulin (CaM), and Mini-chromosome maintenance complex component 7 (Mcm7) were analyzed to re-identify Clarireedia spp. isolated from creeping bentgrass and Kentucky bluegrass on golf courses in South Korea. The ITS and CaM regions were analyzed through multiple sequence alignments. The isolates were identified as C. paspali, and Clarireedia sp. When cultured on PDA, three groups formed fast growing, cottony colonies with white aerial hyphae that later collapsed and turned tan to brown. Most isolates formed apothecia, but ascospores were not observed. The apothecia formation of C. paspali has never been reported. All isolates exhibited pathogenicity on creeping bentgrass and Kentucky bluegrass. These results indicated that the pathogens causing dollar spot on creeping bentgrass and Kentucky bluegrass in South Korea might be C. paspali and Clarireedia sp. The present study reports the first re-identification of the turfgrass dollar spot pathogen Sclerotinia homoeocarpa into the genus Clarireedia in South Korea.

1. Introduction

Dollar spot is one of the major diseases affecting both cool season and warm season turfgrasses worldwide [1]. The pathogen of dollar spot has been detected irrespective of disease symptoms and has shown a high detection rate of 83.3% in thatch layers [2]. Dollar spot, characterized by coin-sized bleached spots on turfgrass [3], is one of the most economically significant diseases affecting turfgrass worldwide [4]. It causes severe blighting of the foliage in roughly circular foci 2 to 5 cm in diameter and could cause golf course surfaces to be unplayable for days or weeks at a time [5], requiring considerable effort and expense for management on golf courses, sports fields, and recreational areas [6].
The dollar spot pathogen was first named Sclerotinia homoeocarpa by Bennett [7]. Subsequently, based on the observation of apothecia and ascospores, it was proposed that the pathogen be classified under the family Rutstroemiaceae [8], but it was not adopted, and over 70 years of taxonomic debate followed. In 2018, a multi-locus phylogenetic analysis using three DNA markers of the rDNA internal transcribed spacer (ITS) region, Calmodulin (CaM), and DNA replication licensing factor Mcm7 in a total of 1810 bp revealed that S. homoeocarpa does not belong to the genus Sclerotinia but to a new genus, Clarireedia, within the family Rutstroemiaceae [9]. Since then, phylogenetic studies of dollar spot pathogens distributed across regions such as Europe, Japan, and China have been actively conducted [10,11]. Six species within the genus Clarireedia have been reported, including C. bennettii, C. hainanense, C. homoeocarpa, C. jacksonii, C. monteithiana, and C. paspali. Each species responds differently to fungicides, hosts, and distribution ranges [9,10,11,12,13,14,15]. Cultural practices offer only modest suppression of dollar spot, while intensive fungicide usage and misuse have resulted in widespread fungicide resistance among Clarireedia spp., increasing financial strain on many golf facilities and heightened concerns about chemical exposure to humans and the environment [16,17]. Four primary fungicide classes are commonly used worldwide for managing dollar spot: dicarboximides (DCFs), demethylase inhibitors (DMIs), succinate dehydrogenase inhibitors (SDHIs), and methyl benzimidazole carbamates (MBCs) [18,19,20,21]. However, the repeated use of fungicides has led to selecting Clarireedia isolates with reduced sensitivity to fungicides from different modes of action [16,19,21,22]. To prevent such a problem, it is important to re-identify the pathogens causing dollar spot and determine the species of dollar spot pathogens distributed in South Korea. However, despite the global efforts to re-identify the species causing dollar spot on turfgrass, re-identification studies on the pathogen have not been conducted in South Korea.
In this study, the pathogens causing dollar spot on cool season turfgrass in South Korea were isolated from creeping bentgrass (Agrostis stolonifera) and Kentucky bluegrass (Poa pratensis). The pathogens were re-identified through cultural characteristics and molecular biological methods to guide effective chemical turfgrass management. The present study reports, firstly, the re-identification of the turfgrass dollar spot pathogen Sclerotinia homoeocarpa into the genus Clarireedia in South Korea.

2. Materials and Methods

2.1. Isolation of the Pathogen from Hosts

The dollar spot pathogens used in the experiment were collected from creeping bentgrass and Kentucky bluegrass samples showing dollar spot symptoms at Blackstone Golf Club in Icheon, Club 72 Golf and Resort in Incheon, and the putting green of the short game course at Korea Golf University of Science and Technology located at Wonju City. Leaves with dollar spot symptoms were surface sterilized in 1% sodium hypochlorite for 1 min and plated on Potato Dextrose Agar (PDA. KisanBio, Seoul, Republic of Korea). The growing hyphae was transferred to a new PDA to isolate the fungi (Table 1).

2.2. Pathogenicity Tests in Pots

The pot experiment for pathogenicity tests was conducted from March 2023 to December 2023 in a plant growth chamber (SUN0022, Neulpureunchae, Gunpo, Republic of Korea) and a greenhouse at Konkuk University in Seoul. Creeping bentgrass and Kentucky bluegrass were sown (seeding rate: 0.1 g per pot) in pots (70 mm in diameter, 100 mm in height) filled with potting soil (Tobaeki, Sung-Hwa Co., Boseong, Republic of Korea). The isolated pathogens were inoculated onto 12-week-old mature plants [23]. The pathogen inoculation was performed following the method of Rengwalska and Simon [24], where circular mycelial plugs, 10 mm in diameter, were taken from the edge of colonies grown on PDA and inoculated onto the aboveground parts of the turfgrass. The inoculated turfgrass plants were maintained in a greenhouse at a temperature range of 15–30 °C for approximately one month, during which disease development was observed and evaluated. The plots were arranged in a completely randomized design. Mowing was performed using scissors, maintaining a height of approximately 10 mm for creeping bentgrass and 20 mm for Kentucky bluegrass, 2–3 times per week. The plants were irrigated once a week through bottom watering.

2.3. Pathogenicity Tests in Field

The pathogenicity field experiment was conducted from April 2023 to May 2023 on the putting green of the short game course at Korea Golf University of Science & Technology. The isolate used in the experiment was KKBD-36, isolated from the same location. Preparation of the inoculum and the inoculation method followed the protocol described by Chang et al. [25]. Kentucky bluegrass seeds (cultivar: Midnight) were sterilized twice in an autoclave at 121 °C for 40 min. The sterilized seeds were inoculated with the fungal isolate cultured on PDA and incubated at room temperature for one month, shaking once a week. After sufficient drying, the inoculum was evenly spread at 20 g/m2 on the putting green of the short game course. Mowing was performed daily in the morning using a riding greens mower (Greensmaster 3250-D, Toro, Bloomington, MN, USA) at a height of approximately 5 mm. Each replicate covered an area of 1 m2, with four replicates. After inoculation, the occurrence of small spots on leaf blades was observed weekly, and the progression of the disease was characterized by brown or reddish-brown margins and light brown, coin-shaped lesions. Disease infection and lesion size were evaluated weekly.

2.4. Koch’s Postulates Test

To confirm that all strains used in the pot and field experiments were the causal agents of dollar spot, experiments were conducted according to Koch’s postulates. After inoculation, leaves of creeping bentgrass and Kentucky bluegrass showing dollar spot symptoms were collected, surface-sterilized in 1% sodium hypochlorite for 1 min, and cultured on PDA to isolate hyphae. The re-isolated strains were compared to the inoculated strains through phylogenetic classification and identification, using DNA markers to analyze the nucleotide sequences of three regions: internal transcribed spacer (ITS), Calmodulin gene (CaM), and Mini-chromosome Maintenance Complex Component 7 (Mcm7).

2.5. Apothecia Production and Morphological Examinations

The experiment on apothecia formation and morphological characteristics on artificial media was conducted following the method of Salgado-Salazar [9]. The hyphae of the isolated dollar spot pathogen were suspended in 300 μL of sterile water and spread-plated onto PDA containing 2.5 mM ascorbic acid. The plates were incubated at 25 °C under 24 h LED lighting, and observations were made for more than four weeks to observe the formation of apothecia and ascospores. The morphological characteristics of the fungi cultured were examined by inoculating a 10 mm diameter mycelial plug, taken from the edge of the dollar spot pathogen colonies grown on PDA using a cork borer, onto PDA containing 2.5 mM ascorbic acid. The changes in colony color and growth rate were observed for three weeks. All experiments were conducted in four replicates.

2.6. DNA Extractions, PCR Amplification, and Sequencing

Phylogenetic classification and re-identification using three primer pairs were performed: mycelial fragments of dollar spot pathogens cultured on PDA were transferred to PDB (Potato Dextrose Broth) and incubated with shaking at 28 °C for three days. The mycelium was then collected using a benchtop centrifuge, and gDNA was extracted using a gDNA extraction kit (Biofact Co., Daejeon, Republic of Korea) following the manufacturer’s instructions. gDNA was extracted from dollar spot hyphae using a silica-based spin column method. Dollar spot hyphae were resuspended in 200 μL of GD1 buffer and mixed with 5 μL of Proteinase K (20 mg/mL). The mixture was vortexed for 1 min and incubated at 65 °C for 10 min. Then, 200 μL of GD2 buffer was added, vortexed for 10 s, and centrifuged at 13,000 rpm for 5 min. The supernatant was transferred to a new 1.5 mL microcentrifuge tube, and 200 μL of GB buffer was added, followed by inverting 10–20 times for complete mixing. For DNA binding, the mixture was transferred to a spin column pre-equilibrated with 200 μL of Help B buffer and centrifuged at 10,000 rpm for 30 s. The passing solution was thrown away with the collection tube. All supernatant was loaded into the spin column and centrifuged at 7000 rpm for 1 min. The flow-through solution was discarded together with the collection tube, and the spin column was placed into a new 2 mL collection tube. The column was washed twice with 500 μL of WB buffer (80% ethanol) by centrifugation at 13,000 rpm for 30 s. A final dry spin was performed at 13,000 rpm for 3 min to remove residual ethanol. DNA was eluted with 50–100 μL of DNA Hydration Solution by incubating at room temperature for 1 min and centrifuging at 13,000 rpm for 2 min. The concentration and purity of the extracted gDNA were measured using a NanoDrop spectrophotometer (Nano-100 Micro-Spectrophotometer, Luscience, Seoul, Republic of Korea). The analysis was performed by Macrogen (Seoul, Republic of Korea). The nucleotide sequence analysis of the strains was conducted for three regions: internal transcribed spacer (ITS), Calmodulin gene (CaM), and Mini-chromosome Maintenance Complex Component 7 (Mcm7). PCR amplification was performed using the primer sets ITS4/ITS5, CAL-228F/CAL-737R, and Mcm7-709for/Mcm7-1348rev, respectively (Table 2). Sequence analysis and alignment were performed using CLC Workbench software v.8.0. A phylogenetic tree was constructed to identify the datasets using the neighbor-joining method with CLC workbench software v.8.0. A complete list of isolates used in the present study is found in Table 3.

2.7. Alignment and Phylogenetic Analysis

The phylogenetic tree was constructed using the CLC genomics workbench (Insilicogen Inc., Yongin, Republic of Korea). The Multiple Sequence Alignment feature was utilized for nucleotide sequence alignment based on the Clustal W algorithm. The gap penalty was set to 10, and the gap extension penalty was set to 0.1. A phylogenetic tree was constructed using the Neighbor-Joining (NJ) method based on the aligned nucleotide sequences. The reliability of the tree was evaluated through bootstrap analysis with 1000 replicates. The phylogenetic tree was visualized using the tree editing tool in the CLC genomics workbench, and the phylogenetic relationships were analyzed based on the visualized tree. Sequencing services, including the generation of the phylogenetic tree, were outsourced to Macrogen Inc. (Seoul, Republic of Korea).

2.8. Statistical Analyses

Statistical analyses were performed using the statistical software SigmaStat (Version 2.03, Systat Software Inc., San Jose, CA, USA). The significance of differences between means was evaluated using Fisher’s LSD test (p = 0.05).

3. Results

3.1. Isolation of the Pathogen and Pathogenicity Tests and Koch’s Postulates Test

In this study, four strains were isolated from creeping bentgrass and three strains from Kentucky bluegrass. All strains were collected from turfgrass showing dollar spot symptoms and were used in the experiments (Table 1). In both pot and field experiments for pathogenicity testing, all isolates caused the characteristic symptoms of dollar spot infection, including reddish-brown margins and light tan discoloration on the leaves of creeping bentgrass and Kentucky bluegrass 7 days after inoculation (Figure 1). Among the strains used in the experiment, KCBD-01 and KCBD-03 exhibited the strongest pathogenicity. In contrast, the pathogenicity of KKBD-01, KKBD-02, KKBD-36, KCBD-02, and KCBD-04 showed no significant differences (Table 4).
The creeping bentgrass and Kentucky bluegrass inoculated with the pathogens of dollar spots showed the typical symptoms of dollar spot (Figure 1). The pathogens were re-isolated from the symptomatic leaves of creeping bentgrass and Kentucky bluegrass and confirmed to be the same pathogens through the morphological characteristics and PCR.

3.2. Morphological Examinations and Apothecia Production

The morphological characteristics of the dollar spot pathogens confirmed as causal agents through pathogenicity tests in pots and fields are shown in Figure 2 and Table 5 and Table 6. The isolates KKBD-01, KKBD-36, KCBD-01, KCBD-02, and KCBD-04, cultured on PDA containing 2.5 mM ascorbic acid, exhibited rapid growth and formed white aerial hyphae. Over time, the initially white stroma turned dark brown or yellowish-brown. In contrast, the strain KKBD-02 grew at approximately half the rate of the other isolates and formed white aerial hyphae (Table 5 and Table 6). The aerial hyphae later collapsed and turned yellowish-brown or gray, with wavy colony margins, and did not form stroma. The strain KCBD-03 exhibited unique growth and morphological characteristics that differed from other isolates (Table 6 and Figure 2). The strain KCBD-03 exhibited rapid growth and formed white aerial hyphae, which later collapsed and turned brown. Unlike other strains, it did not form a dark stroma even after 15 days of incubation. The mycelial growth rates of KKBD-01, KKBD-36, KCBD-01, KCBD-02, KCBD-03, and KCBD-04 on PDA containing 2.5 mM ascorbic acid were approximately twice as fast as those reported for C. jacksonii, C. monteithiana, and C. bennettii by Salgado-Salazar [9]. Similarly, the growth rate of KKBD-02 was about twice as fast as that of C. homoeocarpa reported by Salgado-Salazar [9] (Table 5).
KCBD-01, KCBD-02, KCBD-03, KCBD-04, KKBD-01, and KKBD-36 strains formed apothecia; however, this did not lead to the formation of ascospores (Figure 2). The KKBD-02 strain did not form apothecia and ascospores.

3.3. Molecular Re-Identification of Dollar Spot Pathogen and Phylogenetic Analysis

Molecular classification and re-identification using three primer pairs (ITS, CaM, and Mcm7) revealed that among the seven strains used in this study, KCBD-01, KCBD-02, KCBD-03, KCBD-04, KKBD-01, and KKBD-02 were identified as C. paspali. KKBD-36 did not match any known species within the genus Clarireedia. Due to the limitations of the primer results, it could not be specifically assigned to any species but was re-identified as belonging to the genus Clarireedia (Figure 3).

4. Discussion

The present study reports for the first time in South Korea that dollar spot occurring on creeping bentgrass and Kentucky bluegrass is caused by C. paspali and Clarireedia sp. The fungi belonging to these three species exhibited pathogenicity on creeping bentgrass and Kentucky bluegrass, forming coin-sized bleached spots (Figure 1). These results were similar to those reported by Smiley [1]. Among them, C. paspali KCBD-01 and C. paspali KCBD-03 exhibited the strongest pathogenicity on creeping bentgrass, while the other strains showed less pathogenicity. However, all isolates used in the experiment exhibited the same level of pathogenicity on Kentucky bluegrass. Previous studies have reported that C. jacksonii exhibits stronger pathogenicity compared to C. monteithiana [29]. Metarhizium anisopliae exhibited higher conidial hydrophobicity, increased host penetration ability, accelerated growth under hypoxic conditions, and enhanced utilization of diverse carbon sources compared to Metarhizium acridum, resulting in higher overall virulence [30]. This is similar to findings from comparative genomics, which reveal that Fusarium species, such as F. oxysporum and F. solani, possess pathogenicity-related chromosomes containing host-specific virulence genes, enabling them to exhibit different pathogenicity depending on the host plant they infect [31]. These results suggest genetic variation may lead to differences in pathogenicity and physiological functions among Clarireedia species [12].
KCBD-01, KCBD-02, KCBD-03, KCBD-04, KKBD-01, and KKBD-02 strains exhibited morphological characteristics similar to those of C. jacksonii and C. homoeocarpa as reported by Salgado-Salazar [9]. However, based on molecular biological analysis, the strains were re-identified as C. paspali (Table 6). These strains displayed three distinct cultural characteristics (Figure 2). The KKBD-36 strain was similar to the morphological characteristics of the KCBD-01, KCBD-02, KCBD-04, and KKBD-01 strains, which were re-identified as C. paspali, as well as with C. jacksonii reported by Salgado-Salazar [9], but it was found to be a different species. These findings did not fully agree with the report by Salgado-Salazar [9], which stated that species within the genus Clarireedia exhibit morphological differences depending on the species. Micro-morphological features such as the size and shape of conidia, appressoria, and setae or teleomorph characters overlapped in many species, and these features could change under different growing conditions [32].
This result is similar to the cases where strains morphologically re-identified as Fusarium graminearum were re-identified as F. boothii based on phylogenetic analyses using primers [33]. Similar to cases where Botrytis cinerea and Botrytis pseudocinerea are morphologically indistinguishable but identified as different species through molecular methods [34], the classification of species within this species complex based solely on host reference and morphological characteristics appears to have limitations [35]. Consequently, it is difficult to reliably classify species within the genus Clarireedia based on morphological characteristics alone, as this may lead to misinterpretations [36]. Molecular re-identification and phylogenetic analysis of the dollar spot pathogen were conducted using three primer pairs (ITS, CaM, and Mcm7). However, due to the insufficient dollar spot sequencing data amplified with all three primer pairs in the National Center for Biotechnology Information (NCBI) database, a phylogenetic tree was constructed using two sequences amplified with ITS and CaM. Therefore, further studies will be necessary if new primers are developed in the future to enhance classification accuracy.
Since the re-identification of C. paspali in 2019 [11], there has been no report of successful induction of apothecia and ascospores in the dollar spot pathogen. Similarly, few experiments on the induction of apothecia and ascospores in Clarireedia spp. have been reported, apart from Salgado-Salazar [9]. In contrast, successful formation of apothecia and ascospores has been reported for C. homoeocarpa strains in the United States and the United Kingdom [7,9], whereas C. jacksonii has been observed to form apothecia but not ascospores [9]. In this study, most strains formed apothecia but did not produce ascospores. Notably, this study is the first to successfully observe apothecia formation in C. paspali in artificial media. The differing results observed in this study may be attributed to differences in culture conditions or strain characteristics. In the future, additional experiments under various conditions, such as changes in the concentration of ascorbic acid or light intensity, are considered necessary to induce the formation of ascospores.
Meanwhile, it has been reported that C. monteithiana, C. paspali, and C. jacksonii exhibit different fungicide responses [15]. Specifically, C. paspali showed the lowest growth rate on media containing boscalid, while C. jacksonii exhibited higher resistance to demethylation inhibitor (DMI) fungicides such as propiconazole and tebuconazole than other species [15]. High fungicide efficiency can lower the optimal application rate, reducing overall costs while maintaining effective disease control [37]. The application of propiconazole plus tebuconazole and azoxystrobin plus epoxiconazole significantly increased the economic yield of spring rapeseed by 0.90 t/ha and 0.77 t/ha, respectively, demonstrating the economic benefits of selecting effective fungicides for disease management [38]. The correct selection of fungicides impacts direct costs and indirect costs, such as the development of fungicide resistance, which may lead to increased future expenses [39]. These findings suggested that accurate species identification within the genus Clarireedia might be essential for proper fungicide application.
In the United States, C. bennettii, C. homoeocarpa, C. jacksonii, C. monteithiana, and C. paspali have been reported [9,12], while in Japan and China, C. hainanense, C. jacksonii, C. monteithiana, and C. paspali have been identified [10,11,14]. In South Korea, C. paspali and Clarireedia sp. were discovered, showing differences in the distribution of Clarireedia species compared to neighboring countries. This indicates that the distribution of Clarireedia species varies depending on geographical location. For effective dollar spot management, further studies on the distribution of Clarireedia species in other regions of South Korea, their host range, degree of pathogenicity, and responses to fungicides are needed.

5. Conclusions

This study is the first re-identification of dollar spot pathogens in South Korea and identifies Clarireedia paspali and Clarireedia sp. as the causal agents of infections in creeping bentgrass and Kentucky bluegrass. Among the methods used to distinguish species, morphological classification was found insufficient for accurate identification, and molecular approaches using ITS and CaM gene sequences were confirmed to be essential for precise classification. The Clarireedia species exhibited differences in pathogenicity as well as fungicide responses, suggesting that species-level identification is essential for effective management of dollar spot. These results in the importance of precise species identification for sustainable and effective turfgrass disease management. Further research is needed to investigate the regional distribution, host range, pathogenicity, and fungicide sensitivity of Clarireedia species in South Korea.

Author Contributions

Methodology, J.U.J. and S.W.C.; investigation, J.U.J.; data curation, J.U.J. and S.W.C.; writing—original draft, J.U.J.; writing—review and editing, J.U.J., J.H.R., J.H.L., S.W.C. and S.C.C.; project administration, S.C.C.; funding acquisition, S.C.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

Authors Jae Uk Jee and Ju hyun Ryu were employed by the company E&L Turfgrass Institute, E&L Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The company had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Smiley, R.W.; Dernoden, P.H.; Clarke, B.B. Compendium of Turfgrass Diseases, 2nd ed.; American Phytopathological Society: St. Paul, MN, USA, 1992. [Google Scholar]
  2. Lee, J.H.; Min, G.Y.; Shim, G.Y.; Kim, D.S.; Sang, H.; Jung, G.; Kwak, Y.S. Toothpick-aided detection of Sclerotinia homoeocarpa in the turfgrass leaf canopy, thatch, and soil in relation to dollar spot infection centers. Weed Turfgrass Sci. 2015, 4, 376–382. [Google Scholar] [CrossRef] [Scilit]
  3. Smiley, R.W.; Dernoeden, P.P.; Clarke, B.B. Compendium of Turfgrass Diseases, 3rd ed.; American Phytopathological Society: St. Paul, MN, USA, 2005. [Google Scholar]
  4. Goodman, D.M.; Burpee, L.L. Biological control of dollar spot disease of creeping bentgrass. Phytopathology 1991, 81, 1438–1446. [Google Scholar] [CrossRef] [Scilit]
  5. Tredway, L.P.; Tomaso-Peterson, M.; Kerns, J.P.; Clarke, B.B. Compendium of Turfgrass Diseases, 4th ed.; American Phytopathological Society: St. Paul, MN, USA, 2023. [Google Scholar]
  6. Held, D.W.; Potter, D.A. Prospects for managing turfgrass pests with reduced chemical inputs. Annu. Rev. Entomol. 2012, 57, 329–354. [Google Scholar] [CrossRef] [Scilit]
  7. Bennett, F.T. Dollar spot disease of turf and its causal organism, Sclerotinia homoeocarpa n. sp. Ann. Appl. Biol. 1937, 24, 236–257. [Google Scholar] [CrossRef] [Scilit]
  8. Whetzel, H.H. The cypericolous and juncicolous species of Sclerotinia. Farlowia 1946, 2, 385–437. [Google Scholar] [CrossRef] [Scilit]
  9. Salgado-Salazar, C.; Beirn, L.A.; Ismaiel, A.; Boehm, M.J.; Carbone, I.; Putman, A.I.; Tredway, L.P.; Clarke, B.B.; Crouch, J.A. Clarireedia: A new fungal genus comprising four pathogenic species responsible for dollar spot disease of turfgrass. Fungal Biol. 2018, 122, 761–773. [Google Scholar] [CrossRef] [Scilit]
  10. Takao, T.; Toshihiro, H.; Koya, S. Re-identification of Clarireedia spp. causing dollar spot disease of turfgrasses in Japan. J. Jpn. Soc. Turfgrass Sci. 2022, 49, 71–77. [Google Scholar]
  11. Hu, J.; Zhou, Y.; Geng, J.; Dai, Y.; Ren, H.; Lamour, K. A new dollar spot disease of turfgrass caused by Clarireedia paspali. Mycol. Prog. 2019, 18, 1423–1435. [Google Scholar] [CrossRef] [Scilit]
  12. Bahri, B.A.; Parvathaneni, R.K.; Spratling, W.T.; Saxena, H.; Sapkota, S.; Raymer, P.L.; Martinez-Espinoza, A.D. Whole genome sequencing of Clarireedia aff. paspali reveals potential pathogenesis factors in Clarireedia species, causal agents of dollar spot in turfgrass. Front. Genet. 2023, 13, 1033437. [Google Scholar] [CrossRef] [Scilit]
  13. Stackhouse, T.; Bass, A.; Waliullah, S.; Ali, E.; Bahri, B.A.; Martinez-Espinoza, A. Probe-based loop-mediated isothermal amplification assay for rapid detection of two Clarireedia spp., the causal agent of dollar spot of turfgrass. Phytopathology 2024, 108, 3115–3122. [Google Scholar] [CrossRef] [Scilit]
  14. Huangwei, Z.; Yinglu, D.; Yuxin, Z.; Jian, H.; Kurt, L.; Zhimin, Y. Clarireedia hainanense: A new species is associated with dollar spot of turfgrass in Hainan, China. Plant Dis. 2022, 106, 996–1002. [Google Scholar]
  15. Hu, J.; Zhang, H.; Dong, Y.; Jiang, S.; Lamour, K.; Liu, J.; Chen, Y.; Yang, Z. Global distributions of Clarireedia species and their in vitro sensitivity profiles to fungicides. Agronomy 2021, 11, 2036. [Google Scholar] [CrossRef] [Scilit]
  16. Sang, H.; Hulvey, J.; Popko, J.T., Jr.; Lopes, J.; Swaminathan, A.; Chang, T.; Jung, G. A pleiotropic drug resistance transporter is involved in reduced sensitivity to multiple fungicide classes in Sclerotinia homoeocarpa (F.T. Bennett). Mol. Plant Pathol. 2015, 16, 251–261. [Google Scholar] [CrossRef] [Scilit]
  17. Sapkota, S.; Catching, K.E.; Raymer, P.L.; Martinez-Espinoza, A.D.; Bahri, B.A. New approaches to an old problem: Dollar spot of turfgrass. Phytopathology 2022, 112, 469–480. [Google Scholar] [CrossRef] [Scilit]
  18. Ok, C.H.; Popko, J.T., Jr.; Campbell-Nelson, K.; Jung, G. In vitro assessment of Sclerotinia homoeocarpa resistance to fungicides and plant growth regulators. Plant Dis. 2011, 95, 51–56. [Google Scholar] [CrossRef] [Scilit]
  19. Popko, J.T., Jr.; Ok, C.H.; Campbell-Nelson, K.; Jung, G. The association between in vitro propiconazole sensitivity and field efficacy of five New England Sclerotinia homoeocarpa populations. Plant Dis. 2012, 96, 552–561. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Zhang, H.; Jiang, S.; Zhao, Z.; Guan, J.; Dong, Y.; Hu, J.; Lamour, K.; Yin, S.; Yang, Z. Fungicide sensitivity of Clarireedia spp. isolates from golf courses in China. Crop Prot. 2021, 149, 105785. [Google Scholar] [CrossRef] [Scilit]
  21. Ghimire, B.; Aktaruzzaman, M.; Chowdhury, S.R.; Spratling, W.T.; Vermeer, C.B.; Buck, J.W.; Martinez-Espinoza, A.D.; Bahri, B.A. Sensitivity of Clarireedia spp. to benzimidazoles and dimethyl inhibitors fungicides and efficacy of biofungicides on dollar spot of warm season turfgrass. Front. Plant Sci. 2023, 14, 1155670. [Google Scholar] [CrossRef] [Scilit]
  22. Hu, J.; Yang, J.; Li, J.; Ma, Z.; Yao, W.; Ren, H.; Zhang, F.; Yang, G.; Sun, X.; Xiao, Y. Sensitivity of Sclerotinia homoeocarpa from turfgrass to thiophanate-methyl, iprodione and propiconazole. Chin. J. Pestic. Sci. 2017, 19, 694–700. [Google Scholar]
  23. Chang, S.W.; Chang, T.H.; Tredway, L.; Jung, G. Aggressiveness of Typhula ishikariensis isolates to cultivars of bentgrass species (Agrostis spp.) under controlled environment conditions. Plant Dis. 2006, 90, 951–956. [Google Scholar] [CrossRef] [Scilit]
  24. Rengwalska, M.; Simon, P.W. Laboratory evaluation of pink root and Fusarium basal rot resistance in garlic. Plant Dis. 1986, 70, 670–672. [Google Scholar] [CrossRef] [Scilit]
  25. Chang, S.W.; Chang, T.H.; Hong, J.K.; Park, J.H.; Jung, S.W. Vegetative compatibility grouping of Sclerotinia homoeocarpa isolates infecting turfgrass in South Korea. Asian J. Turfgrass Sci. 2012, 25, 171–176. [Google Scholar]
  26. Schmitt, I.; Crespo, A.; Divakar, P.K.; Fankhauser, J.D.; Herman-Sackett, E.; Kalb, K.; Nelsen, M.P.; Nelson, N.A.; Rivas Plata, E.; Shimp, A.D.; et al. New primers for promising single-copy genes in fungal phylogenetics and systematics. Persoonia 2009, 23, 35–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef] [Scilit]
  28. White, T.J.; Bruns, T.; Lee, S.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar]
  29. Aynardi, B.A.; Jiménez-Gasco, M.M.; Uddin, W. Effects of isolates of Clarireedia jacksonii and Clarireedia monteithiana on severity of dollar spot in turfgrasses by host type. Eur. J. Plant Pathology. 2019, 155, 817–829. [Google Scholar] [CrossRef] [Scilit]
  30. Du, Y.; Li, J.; Chen, S.; Xia, Y.; Jin, K. Pathogenicity analysis and comparative genomics reveal the different infection strategies between the generalist Metarhizium anisopliae and the specialist Metarhizium acridum. Pest Manag. Sci. 2024, 80, 820–836. [Google Scholar] [CrossRef] [Scilit]
  31. Rep, M.; Kistler, H.C. The genomic organization of plant pathogenicity in Fusarium species. Curr. Opin. Plant Biol. 2010, 13, 420–426. [Google Scholar] [CrossRef] [Scilit]
  32. Weir, B.S.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides species complex. Stud. Mycol. 2012, 73, 115–180. [Google Scholar] [CrossRef] [Scilit]
  33. Choi, Y.H.; Mageswari, A.; Choi, H.R.; Lee, J.S.; Lee, D.S.; Hong, S.B. Re-identification of Fusarium sambucinum species complex strains in Korea and their literature review. Res. Plant Dis. 2023, 29, 118–129. [Google Scholar] [CrossRef] [Scilit]
  34. Dučkena, L.; Bimšteine, G.; Bankina, B.; Skinderskis, E.; Roga, A.; Frîdmanis, D. Morphological diversity and mycelial compatibility of Botrytis pseudocinerea and Botrytis cinerea isolated in Latvia. Proc. Latv. Acad. Sci. Sect. B 2024, 78, 197–205. [Google Scholar] [CrossRef] [Scilit]
  35. Thao, L.D.; Choi, H.; Choi, Y.; Mageswari, A.; Lee, D.; Kim, D.H.; Shin, H.D.; Choi, H.; Ju, H.J.; Hong, S.B. Re-identification of Colletotrichum gloeosporioides species complex isolates in Korea and their host plants. Plant Pathol. J. 2024, 40, 16–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Manawasinghe, I.S.; Phillips, A.J.L.; Xu, J.; Balasuriya, A.; Hyde, K.D.; Stępień, Ł.; Harischandra, D.L.; Karunarathna, A.; Yan, J.; Weerasinghe, J.; et al. Defining a species in fungal plant pathology: Beyond the species level. Fungal Divers. 2021, 109, 267–282. [Google Scholar] [CrossRef] [Scilit]
  37. Dallacorte, L.V.; Bosse, M.A.; Capelin, D.; Paladini, M.V.; Cattani, F.; Remor, M.B.; Lima, J.D.; Perboni, A.T.; Marchese, J.A. Economic versus technical efficiency in using ASM combined with fungicides to elicit wheat varieties with different disease susceptibilities. Heliyon 2023, 9, e17012. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Devyatkina, T.F.; Chigorin, S.S.; Silaev, A.I.; Bochkarev, D.V. Effectiveness of fungicides in reducing harmfulness of biotrophic pathogens on spring rape. Agrar. Sci. J. 2024, 4–10. [Google Scholar] [CrossRef] [Scilit]
  39. Mikaberidze, A.; Gokhale, C.S.; Bargués-Ribera, M.; Verma, P. Economic analysis of disease and control of multi-field epidemics in agriculture. bioRxiv 2025. [CrossRef] [Scilit]
Figure 1. Pathogenicity test of dollar spot isolates. (A): Typical dollar spot symptoms of dollar spot on creeping bentgrass putting green. (B): Typical symptom of dollar spot on Kentucky bluegrass rough. (C): Mycelial colony of dollar spot pathogen on PDA. (D): At 7 days after KKBD-02 inoculation, a typical dollar spot symptom (leaf blade bleached in red circle) on creeping bentgrass. (E): At 7 days after KCBD-01 inoculation, stroma, a typical dollar spot symptom (red circle) on Kentucky bluegrass leaf blade. (F): Typical dollar spot symptoms on creeping bentgrass putting green at 14 days after KKBD-36 inoculation.
Figure 1. Pathogenicity test of dollar spot isolates. (A): Typical dollar spot symptoms of dollar spot on creeping bentgrass putting green. (B): Typical symptom of dollar spot on Kentucky bluegrass rough. (C): Mycelial colony of dollar spot pathogen on PDA. (D): At 7 days after KKBD-02 inoculation, a typical dollar spot symptom (leaf blade bleached in red circle) on creeping bentgrass. (E): At 7 days after KCBD-01 inoculation, stroma, a typical dollar spot symptom (red circle) on Kentucky bluegrass leaf blade. (F): Typical dollar spot symptoms on creeping bentgrass putting green at 14 days after KKBD-36 inoculation.
Processes 13 01694 g001
Figure 2. Colony morphology of dollar spot isolates after incubation at 25 °C. Colony front (left side petri dish) (A) and colony back (right side petri dish) (B) on PDA with ascorbic acid at 10 days after incubation, respectively; colony front (C) and colony back (D) on PDA with ascorbic acid at 3 weeks after incubation, respectively. Apothecium (E,F) on ascorbic PDA culture and close-up images of an Apothecium (GI) (bar size: 10 mm).
Figure 2. Colony morphology of dollar spot isolates after incubation at 25 °C. Colony front (left side petri dish) (A) and colony back (right side petri dish) (B) on PDA with ascorbic acid at 10 days after incubation, respectively; colony front (C) and colony back (D) on PDA with ascorbic acid at 3 weeks after incubation, respectively. Apothecium (E,F) on ascorbic PDA culture and close-up images of an Apothecium (GI) (bar size: 10 mm).
Processes 13 01694 g002
Figure 3. A majority rule Bayesian phylogenetic tree from the combined ITS and CaM analysis showing relationships among fungal isolates in the Sclerotiniaceae and Rutstroemiaceae families. The Mcm7 sequences were excluded due to insufficient reference data in NCBI. Support values (posterior probability (PP)/maximum likelihood (ML) bootstrap) are indicated above the branches. Branch lengths are proportional to levels of sequence divergence.
Figure 3. A majority rule Bayesian phylogenetic tree from the combined ITS and CaM analysis showing relationships among fungal isolates in the Sclerotiniaceae and Rutstroemiaceae families. The Mcm7 sequences were excluded due to insufficient reference data in NCBI. Support values (posterior probability (PP)/maximum likelihood (ML) bootstrap) are indicated above the branches. Branch lengths are proportional to levels of sequence divergence.
Processes 13 01694 g003
Table 1. Isolates of dollar spot pathogen used in this study.
Table 1. Isolates of dollar spot pathogen used in this study.
Isolate LocationHostIsolateIsolated Year
Icheon, GyeonggiKentucky bluegrassKKBD-02, KKBD-362022
Incheoncreeping bentgrassKCBD-012020
Hoengseong, Gangwoncreeping bentgrassKCBD-02, KCBD-03, KCBD-042022
Kentucky bluegrassKKBD-012022
Table 2. Primer information for DNA amplification used in this study.
Table 2. Primer information for DNA amplification used in this study.
GenePrimerSequence (5′-3′)Annealing
Temperature (°C)
References
Mcm7Mcm7-709forACIMGIGTITCVGAYGTHAARCC56[26]
Mcm7-1348revGAYTTDGCIACICCIGGRTCWCCCAT
CamCAL-228FGAGTTCAAGGAGGCCTTCTCCC55[27]
CAL-737RCATCTTTCTGGCCATCATGG
ITSITS4TCCTCCGCTTATTGATATGC55[28]
ITS5GGAAGTAAAAGTCGTAACAAGG
Table 3. Fungal isolates used in this study.
Table 3. Fungal isolates used in this study.
Fungal SpeciesIsolate IDLocaleYearGenBank Number
CaMITS
Ciboria aestivalisCBS 119.47Australia1947KF545281KF545326
Clarireedia bennettiiCBS 309.37United Kingdom1937MF964321MF964270
Clarireedia bennettiiCBS 311.37United Kingdom1937MF964272MF964323
Clarireedia homoeocarpaHP-50NJ, USAN/AKF545247KF545291
Clarireedia homoeocarpaMB-01OH, USA2001KF545244KF545290
Clarireedia homoeocarpaD19OH, USA2002KF545252KF545298
Clarireedia homoeocarpaSH44Canada2000KF545251KF545299
Clarireedia homoeocarpaRCCPG-1NC, USA2003KF545253KF545297
Clarireedia homoeocarpa236-941NJ, USA2013KF545248KF545296
Clarireedia homoeocarpaA4OH, USA2001KF545243KF545295
Clarireedia homoeocarpaSH80Canada2000KF545245KF545294
Clarireedia jacksoniiCBS 510.89Netherlands1989KF545261KF545289
Clarireedia jacksoniiLEF17T-21Italy2008KF545250KF545293
Clarireedia jacksoniiLWC-10NC, USA2003MF964269MF964320
Clarireedia jacksoniiMAFF 235854Japan1987KF545242KF545301
Clarireedia jacksoniiMAFF 235856Japan1987KF545246KF545302
Clarireedia jacksoniiMAFF 235858Japan1988MF964273MF964324
Clarireedia monteithianaTEKP-2HI, USA2008KF545259KF545304
Clarireedia monteithianaBC-14NC, USA2008KF545255KF545307
Clarireedia monteithianaMAFF 236938Japan1991KF545258KF545305
Clarireedia paspaliHawaii2GA, USA2021MZ620646MZ578438
Clarireedia paspaliHawaii3GA, USA2021MZ620644MZ578439
Clarireedia paspaliKCBD-01Incheon, Republic of Korea 2020LC867002LC867009
Clarireedia paspaliKCBD-02Icheon, Republic of Korea2022LC867003LC867010
Clarireedia paspaliKCBD-03Hoengseong, Republic of Korea2022LC867004LC867011
Clarireedia paspaliKCBD-04Hoengseong, Republic of Korea2022LC867005LC867012
Clarireedia paspaliKKBD-01Hoengseong, Republic of Korea2022LC867006LC867013
Clarireedia paspaliKKBD-02Hoengseong, Republic of Korea2022LC867007LC867014
Clarireedia sp. KKBD-36Icheon, Republic of Korea2022LC867008LC867015
Monilinia vaccinii-corymbosiSSI-1NJ, USA2009MF964274MF964325
Sclerotinia matthiolaeCBS 111.17SwitzerlandN/AMF964263MF964314
Sclerotinia minorCBS 112.17NetherlandsN/AMF964264MF964315
Sclerotinia sclerotiorumSS1NJ, USA2009KF545279KF545320
Sclerotinia sclerotiorumSS5NJ, USA2009KF545280KF545319
Sclerotinia sulcataCBS 303.31MD, USA2017MF964266MF964317
Table 4. The pathogenicity of isolates on creeping bentgrass and Kentucky bluegrass in the pot and field.
Table 4. The pathogenicity of isolates on creeping bentgrass and Kentucky bluegrass in the pot and field.
IsolateDisease Severity y
Creeping BentgrassKentucky Bluegrass
PotFieldPotField
KKBD-01++N/A z+N/A
KKBD-02++N/A+N/A
KKBD-36+++++++N/A
KCBD-01+++N/A+N/A
KCBD-02++N/A+N/A
KCBD-03+++N/A+N/A
KCBD-04++N/A+N/A
y Degree of turfgrass mortality at three weeks after inoculation +: 1–20%, ++: 21–40%, +++: 41–60%, ++++: 61–80%. z Not applicable (pathogenicity tests were not conducted).
Table 5. The mycelial growth of the isolates of Clarireedia spp. on potato dextrose agar medium amended with 2.5 mM ascorbic acid.
Table 5. The mycelial growth of the isolates of Clarireedia spp. on potato dextrose agar medium amended with 2.5 mM ascorbic acid.
Salgado-Salazar (2018) [9] wPresent Isolate x
SpeciesGrowth (mm) yIsolateGrowth (mm) y
C. jacksonii80 a zKKBD-0177.9 a
C. homoeocarpa40 bKKBD-0241.7 b
C. monteithiana80 aKKBD-3679.8 a
C. bennettii80 aKCBD-0178.0 a
KCBD-0274.2 a
KCBD-0380.1 a
KCBD-0476.9 a
w At 6 days after incubation. x At 3 days after incubation. y Mycelia diameter grown on PDA amended with 2.5 mM ascorbic acid at 25 °C. z Means followed by the same letters are not significantly different within the column at p = 0.05 (LSD).
Table 6. Cultural and morphological characteristics of dollar spot isolates used in this study.
Table 6. Cultural and morphological characteristics of dollar spot isolates used in this study.
Clarireedia jacksonii [9]C. homoeocarpa [9]KKBD-01, KKBD-36,
KCBD-01, KCBD-02, and KCBD-04
KKBD-02KCBD-03
Cultural characteristicsColonies are fast growing, cottony, front white to off-white with light brown spots, back white to off-white, later collapsing and turning tan to brown. Colony reaches 8 cm radial growth after 6 days at 25 °C under continuous light on PDA + ascorbic acid. Colonies > 15 days old form thick, flat, black stroma on PDA + ascorbic acid. Hyphae septate, hyaline. Thalli at first aerial, white to off-white, later collapsing and turning brown, tan, olive, or gray, sometimes slightly pink. Colonies on PDA raised, aerial mycelium white to offwhite, collapsing and turning brown, tan, olive, or gray, with undulate margins. The colony reaches 4 cm radial growth after 6 days at 25 °C under continuous light on PDA + ascorbic acid. Colonies > 15 days old do not form a dark stroma on PDA + ascorbic acid. Hyphae septate, hyaline. Colonies fast growing, cottony, front white to off-white with light brown spots, back white to off-white, later collapsing and turning tan to brown. Colony reaches 8 cm radial growth after 3 days at 25 °C under continuous light on PDA + ascorbic acid. Colonies > 15 days old form thick, flat, black stroma on PDA + ascorbic acid. Hyphae septate, hyaline. Thalli at first aerial, white to off-white, later collapsing and turning brown, tan, olive, or gray, sometimes slightly pink. Colonies on PDA raised, aerial mycelium white to off-white, collapsing and turning brown, tan, olive, or gray, with undulate margins. Colony reaches 4 cm radial growth after 3 days at 25 °C under continuous light on PDA + ascorbic acid. Colonies > 15 days old do not form a dark stroma on PDA + ascorbic acid.Colonies are fast growing, cottony, and front white to off-white with light brown spots and back white to off-white, later collapsing and turning brown. The colony reaches 8 cm radial growth after 3 days at 25 °C under continuous light on PDA + ascorbic acid. Colonies > 15 days old do not form a dark stroma on PDA + ascorbic acid.
Apothecia characteristicsApothecia arising from a substratal stroma, cupulate to discoid, brown, cinnamon, or light orange, receptacle pubescent. Apothecia 2.73 × 1.91 mm arising from dark, substratal stroma. Ascospores and conidia have not been observed.Hyphae septate, hyaline. Apothecia 0.5–1.5 mm in diameter, arising from a dark substratal stroma, cupulate to discoid, brown, cinnamon, or light orange, receptacle pubescent. Ascus 162.9 × 12.5 μm, on average. Ascospores hyaline, oblong to elliptical, mostly unicellular, occasionally with a medium septum, 20.7 × 8.3 μm. Conidia are not observed. Microconidia spherical, hyaline, 2.0 mm in diameter, formed in cream-colored pustules [7].Apothecia 0.5–2.0 mm in diameter, arising from a substrate stroma, cupulate to discoid, brown, cinnamon, or light orange, receptacle pubescent.Ascospores and conidia were not observed.Apothecia, ascospores, and conidia were not observed.Apothecia 0.5–2.0 mm in diameter, arising from a substrate stroma, cupulate to discoid, brown, cinnamon, or light orange, receptacle pubescent.Ascospores and conidia were not observed.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Jee, J.U.; Ryu, J.H.; Lee, J.H.; Chang, S.W.; Chun, S.C. Re-Identification of Dollar Spot Pathogen on Creeping Bentgrass and Kentucky Bluegrass in South Korea. Processes 2025, 13, 1694. https://doi.org/10.3390/pr13061694

AMA Style

Jee JU, Ryu JH, Lee JH, Chang SW, Chun SC. Re-Identification of Dollar Spot Pathogen on Creeping Bentgrass and Kentucky Bluegrass in South Korea. Processes. 2025; 13(6):1694. https://doi.org/10.3390/pr13061694

Chicago/Turabian Style

Jee, Jae Uk, Ju Hyun Ryu, Jeong Ho Lee, Seog Won Chang, and Se Chul Chun. 2025. "Re-Identification of Dollar Spot Pathogen on Creeping Bentgrass and Kentucky Bluegrass in South Korea" Processes 13, no. 6: 1694. https://doi.org/10.3390/pr13061694

APA Style

Jee, J. U., Ryu, J. H., Lee, J. H., Chang, S. W., & Chun, S. C. (2025). Re-Identification of Dollar Spot Pathogen on Creeping Bentgrass and Kentucky Bluegrass in South Korea. Processes, 13(6), 1694. https://doi.org/10.3390/pr13061694

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop