Salicylic Acid-Induced Expression Profiles of LRR and LRR-RLK Candidate Genes Modulate Mungbean Yellow Mosaic India Virus Resistance in Blackgram and Its Two Wild Non-Progenitors
Abstract
:1. Introduction
2. Results
2.1. Genome-Wide Identification and Characterization of R-Genes
2.2. Physical Mapping of R-Genes on Vigna Genome Assembly
2.3. Phylogenetic Relationships Among Identified Candidate R-Genes
2.4. Gene Structure and Conserved Domain Prediction of Different R-Genes
2.5. Motif Analysis of LRR and LRR-RLK Proteins
2.6. In Silico Expression Analysis
2.7. Expression Profile of Identified Candidate R-Genes in Different Genotypes
2.8. Predicted Structure Analysis of LRR Receptors
2.9. Protein–Protein Interaction
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Stress Treatment
4.2. RNA Extraction and cDNA Synthesis
4.3. Genome-Wide Identification, Characterization, and Distribution of LRR and LRR-RLK Candidates
4.4. Evolutionary Tree Analysis
4.5. Gene Structure, Domain, and Conserved Motif Prediction
4.6. In Silico Expression
4.7. Selection of Candidate Genes, Primer Design, and qRT-PCR Analysis
4.8. Predicted Protein Structure, Interaction Network, and Co-Expression Network Construction
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- MoAF&W, DES, Agricultural Statistics Division. 2022. Available online: https://desagri.gov.in/document-report-category/agriculture-statistics-at-a-glance/ (accessed on 23 February 2024).
- Swarnalakshmi, K.; Yadav, V.; Tyagi, D.; Dhar, D.W.; Kannepalli, A.; Kumar, S. Significance of plant growth promoting Rhizobacteria in grain legumes: Growth promotion and crop production. Plants 2020, 9, 1596. [Google Scholar] [CrossRef] [PubMed]
- Kumari, N.; Aski, M.S.; Mishra, G.P.; Roy, A.; Dikshit, H.K.; Saxena, S.; Kohli, M.; Mandal, B.; Sinha, S.K.; Mishra, D.C.; et al. Development of infectious clones of mungbean yellow mosaic India virus (MYMIV, Begomovirus vigna radiata indiaense) infecting mungbean [Vigna radiata (L.) R. Wilczek] and evaluation of a RIL population for MYMIV resistance. PLoS ONE 2024, 19, e0310003. [Google Scholar] [CrossRef] [PubMed]
- Tripathi, A.; Singh, C.M.; Kumar, M.; Purwar, S.; Mishra, A.; Kumar, D.; Singh, N.P. Identification of potential sources of mungbean yellow mosaic India virus resistance in black gram (Vigna mungo) and expression of antioxidants and R-genes modulating resistance response in cultivated and its two wild relatives. Plant Breed. 2023, 142, 668–681. [Google Scholar] [CrossRef]
- Gozzo, F.; Faoro, F. Systemic acquired resistance (50 years after discovery): Moving from the lab to the field. J. Agric. Food Chem. 2013, 61, 12473–12491. [Google Scholar] [CrossRef]
- Kundu, S.; Chakraborty, D.; Pal, A. Proteomic analysis of salicylic acid induced resistance to Mungbean Yellow Mosaic India virus in Vigna mungo. J. Proteom. 2011, 74, 337–349. [Google Scholar] [CrossRef]
- Halim, V.A.; Altmann, S.; Ellinger, D.; Eschen-Lippold, L.; Miersch, O.; Scheel, D.; Rosahl, S. PAMP-induced defense responses in potato require both salicylic acid and jasmonic acid. Plant J. 2009, 57, 230–242. [Google Scholar] [CrossRef]
- Vimala, R.; Suriachandraselvan, M. Induced resistance in bhendi against powdery mildew by foliar application of salicylic acid. J. Biopest. 2009, 2, 111–114. [Google Scholar] [CrossRef]
- Ishihara, T.; Sekine, K.T.; Hase, S.; Kanayama, Y.; Seo, S.; Ohashi, Y.; Takahashi, H. Overexpression of the Arabidopsis thaliana EDS5 gene enhances resistance to viruses. Plant Biol. 2008, 10, 451–461. [Google Scholar] [CrossRef]
- Arfan, M.; Athar, H.R.; Ashraf, M. Does exogenous application of salicylic acid through the rooting medium modulate growth and photosynthetic capacity in two differently adapted spring wheat cultivars under salt stress? J. Plant Physiol. 2007, 164, 685–694. [Google Scholar] [CrossRef]
- El-Tayeb, M.A. Response of barley grains to the interactive effect of salinity and salicylic acid. Plant Growth Regul. 2005, 45, 215–224. [Google Scholar] [CrossRef]
- Gunes, A.Y.D.I.N.; Cicek, N.; Inal, A.; Alpaslan, M.; Eraslan, F.; Guneri, E.S.R.A.; Guzelordu, T. Genotypic response of chickpea (Cicer arietinum L.) cultivars to drought stress implemented at pre-and post-anthesis stages and its relations with nutrient uptake and efficiency. Plant Soil Environ. 2006, 52, 368–378. [Google Scholar] [CrossRef]
- Ananieva, E.A.; Christov, K.N.; Popova, L.P. Exogenous treatment with salicylic acid leads to increased antioxidant capacity in leaves of barley plants exposed to paraquat. J. Plant Physiol. 2004, 161, 319–328. [Google Scholar] [CrossRef] [PubMed]
- Kourelis, J.; van der Hoorn, R.A.L. Defended to the nines: 25 years of resistance gene cloning identifies nine mechanisms for r protein function. Plant Cell 2018, 30, 285–299. [Google Scholar] [CrossRef]
- Meyers, B.C.; Kozik, A.; Griego, A.; Kuang, H.; Michelmore, R.W. Genome-wide analysis of NBS-LRR–encoding genes in Arabidopsis. Plant Cell 2003, 15, 809–834. [Google Scholar] [CrossRef] [PubMed]
- Arya, P.; Kumar, G.; Acharya, V.; Singh, A.K. Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae. PLoS ONE 2014, 9, e107987. [Google Scholar] [CrossRef] [PubMed]
- Lehti-Shiu, M.D.; Zou, C.; Shiu, S.H. Origin, diversity, expansion history, and functional evolution of the plant receptor-like kinase/pelle family. In Receptor-like Kinases in Plants: From Development to Defense; Springer: Berlin/Heidelberg, Germany, 2012; pp. 1–22. [Google Scholar]
- Matsushima, N.; Tanaka, T.; Enkhbayar, P.; Mikami, T.; Taga, M.; Yamada, K.; Kuroki, Y. Comparative sequence analysis of leucine-rich repeats (LRRs) within vertebrate toll-like receptors. BMC Genom. 2007, 8, 124. [Google Scholar] [CrossRef]
- Shiu, S.H.; Bleecker, A.B. Plant receptor-like kinase gene family: Diversity, function, and signaling. Sci. STKE 2001, 113, re22. [Google Scholar] [CrossRef]
- Wei, Z.; Wang, J.; Yang, S.; Song, Y. Identification and expression analysis of the LRR-RLK gene family in tomato (Solanum lycopersicum) Heinz 1706. Genome 2015, 58, 121–134. [Google Scholar] [CrossRef]
- Wu, Y.; Xun, Q.; Guo, Y.; Zhang, J.; Cheng, K.; Shi, T.; Li, J. Genome-wide expression pattern analyses of the Arabidopsis leucine-rich repeat receptor-like kinases. Mol. Plant 2016, 9, 289–300. [Google Scholar] [CrossRef]
- Zhou, F.; Guo, Y.; Qiu, L.J. Genome-wide identification and evolutionary analysis of leucine-rich repeat receptor-like protein kinase genes in soybean. BMC Plant Boil. 2016, 16, 58. [Google Scholar] [CrossRef]
- Magalhães, D.M.; Scholte, L.L.; Silva, N.V.; Oliveira, G.C.; Zipfel, C.; Takita, M.A.; De Souza, A.A. LRR-RLK family from two citrus species: Genome-wide identification and evolutionary aspects. BMC Genom. 2016, 17, 623. [Google Scholar] [CrossRef] [PubMed]
- Singh, C.M.; Singh, P.; Pratap, A.; Pandey, R.; Purwar, S.; Douglas, C.A.; Mishra, A.K. Breeding for enhancing Legumovirus resistance in mungbean: Current understanding and future directions. Agronomy 2019, 9, 622. [Google Scholar] [CrossRef]
- Singh, Y.J.; Grewal, S.K.; Gill, R.K. Role of antioxidative defense in yellow mosaic disease resistance in black gram [Vigna mungo (L.) Hepper]. J. Plant Growth Regul. 2022, 41, 2138–2156. [Google Scholar] [CrossRef]
- Li, N.; Han, X.; Feng, D.; Yuan, D.; Huang, L.J. Signaling crosstalk between salicylic acid and ethylene/jasmonate in plant defense: Do we understand what they are whispering? Int. J. Mol. Sci. 2019, 20, 671. [Google Scholar] [CrossRef]
- Akhter, M.S.; Nakahara, K.S.; Masuta, C. Resistance induction based on the understanding of molecular interactions between plant viruses and host plants. Virol. J. 2021, 18, 176. [Google Scholar] [CrossRef]
- Huang, P.C.; Tate, M.; Berg-Falloure, K.M.; Christensen, S.A.; Zhang, J.; Schirawski, J.; Kolomiets, M.V. A non-JA producing oxophytodienoate reductase functions in salicylic acid-mediated antagonism with jasmonic acid during pathogen attack. Mol. Plant Pathol. 2023, 24, 725–741. [Google Scholar] [CrossRef]
- Iqbal, N.; Czékus, Z.; Poór, P.; Ördög, A. Plant defence mechanisms against mycotoxin Fumonisin B1. Chem.-Biol. Interact. 2021, 343, 109494. [Google Scholar] [CrossRef]
- Wang, X.; Fu, M.; Qu, X.; Liu, J.; Bu, J.; Feng, S.; Zhao, H.; Jiao, W.; Sun, F. (E)-2-Hexenal-based coating induced acquired resistance in apple and its antifungal effects against Penicillium expansum. LWT 2022, 163, 113536. [Google Scholar] [CrossRef]
- Lolle, S.; Stevens, D.; Coaker, G. Plant NLR-triggered immunity: From receptor activation to downstream signaling. Curr. Opin. Immunol. 2020, 62, 99–105. [Google Scholar] [CrossRef]
- Man, J.; Gallagher, J.P.; Bartlett, M. Structural evolution drives diversification of the large LRR-RLK gene family. New Phytol. 2020, 226, 1492–1505. [Google Scholar] [CrossRef]
- Meyers, B.C.; Dickerman, A.W.; Michelmore, R.W.; Sivaramakrishnan, S.; Sobral, B.W.; Young, N.D. Plant disease resistance genes encode members of an ancient and diverse protein family within the nucleotide-binding superfamily. Plant J. 1999, 20, 317–332. [Google Scholar] [CrossRef] [PubMed]
- Kanazin, V.; Talbert, H.; See, D.; DeCamp, P.; Nevo, E.; Blake, T. Discovery and assay of single-nucleotide polymorphisms in barley (Hordeum vulgare). Plant Mol. Biol. 2002, 48, 529–537. [Google Scholar] [CrossRef] [PubMed]
- Yuan, N.; Rai, K.M.; Balasubramanian, V.K.; Upadhyay, S.K.; Luo, H.; Mendu, V. Genome-wide identification and characterization of LRR-RLKs reveal functional conservation of the SIF subfamily in cotton (Gossypium hirsutum). BMC Plant Biol. 2018, 18, 185. [Google Scholar] [CrossRef] [PubMed]
- Cheng, W.; Wang, Z.; Xu, F.; Ahmad, W.; Lu, G.; Su, Y.; Xu, L. Genome-wide identification of LRR-RLK family in Saccharum and expression analysis in response to biotic and abiotic stress. Curr. Issues Mol. Biol. 2021, 43, 1632–1651. [Google Scholar] [CrossRef]
- Shiu, S.H.; Bleecker, A.B. Receptor-like kinases from Arabidopsis form a monophyletic gene family related to animal receptor kinases. Proc. Nat. Acad. Sci. USA 2001, 98, 10763–10768. [Google Scholar] [CrossRef]
- Purwar, S.; Singh, C.M.; Kumar, M.; Singh, A.K.; Pratap, A.; Singh, P.; Singh, N.P. Genome-wide identification and analysis of NBS-LRR-encoding genes in mungbean (Vigna radiata L. Wilczek) and their expression in two wild non-progenitors reveal their role in MYMIV resistance. J. Plant Growth Regul. 2023, 42, 6667–6680. [Google Scholar] [CrossRef]
- Ng, A.; Xavier, R.J. Leucine-rich repeat (LRR) proteins: Integrators of pattern recognition and signaling in immunity. Autophagy 2011, 7, 1082–1084. [Google Scholar] [CrossRef]
- Liu, J.; Yuan, R.; Shao, W.; Wang, J.; Silman, I.; Sussman, J.L. Do “newly born” orphan proteins resemble “never born” proteins? a study using three deep learning algorithms. Proteins Struct. Funct. Bioinform. 2023, 91, 1097–1115. [Google Scholar] [CrossRef]
- Padmanabhan, M.; Cournoyer, P.; Dinesh-Kumar, S.P. The leucine-rich repeat domain in plant innate immunity: A wealth of possibilities. Cell. Microbiol. 2009, 11, 191–198. [Google Scholar] [CrossRef]
- Martin, T.; Fraser, H.B. Comparative expression profiling reveals widespread coordinated evolution of gene expression across eukaryotes. Nat. Commun. 2018, 9, 4963. [Google Scholar] [CrossRef]
- Kundu, A.; Singh, P.K.; Dey, A.; Ganguli, S.; Pal, A. Complex molecular mechanisms underlying MYMIV-resistance in Vigna mungo revealed by comparative transcriptome profiling. Sci. Rep. 2019, 9, 8858. [Google Scholar] [CrossRef] [PubMed]
- Maiti, S.; Paul, S.; Pal, A. Isolation, characterization, and structure analysis of a non-TIR-NBS-LRR encoding candidate gene from MYMIV-resistant Vigna mungo. Mol. Biotechnol. 2012, 52, 217–233. [Google Scholar] [CrossRef] [PubMed]
- Khoshru, B.; Mitra, D.; Joshi, K.; Adhikari, P.; Rion, M.S.I.; Fadiji, A.E.; Alizadeh, M.; Priyadarshini, A.; Senapati, A.; Sarikhani, M.R. Decrypting the multi-functional biological activators and inducers of defense responses against biotic stresses in plants. Heliyon. 2023, 9, e13825. [Google Scholar] [CrossRef]
- Kumar, S.; Kumar, K.; Tewari, K.; Sagar, P.; Pandey, J.; Shanmugavadivel, P.S.; Rathore, M.; Kumar, V.; Akram, M.; Singh, A.K.; et al. Gene expression and biochemical profiling of contrasting Vigna mungo genotypes against Mungbean Yellow Mosaic India Virus (MYMIV). (2024). J. Food Legumes 2024, 35, 107–116. [Google Scholar]
- Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Schwede, T. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef]
- Chakraborty, J.; Ghosh, P.; Sen, S.; Nandi, A.K.; Das, S. CaMPK9 increases the stability of CaWRKY40 transcription factor which triggers defense response in chickpea upon Fusarium oxysporum f. sp. ciceri race 1 infection. Plant Mol. Biol. 2019, 100, 411–431. [Google Scholar] [CrossRef]
- Purwar, S.; Sundaram, S.; Pandey, D.; Kumar, A. Basal expression of abscisic acid inducing immunity against Karnal bunt of wheat. Pl. Biosyst. 2014, 148, 691–698. [Google Scholar] [CrossRef]
- Kang, Y.J.; Kim, S.K.; Kim, M.Y.; Lestari, P.; Kim, K.H.; Ha, B.K.; Lee, S.H. Genome sequence of mungbean and insights into evolution within Vigna species. Nat. Commun. 2014, 5, 5443. [Google Scholar] [CrossRef]
- Finn, R.D.; Clements, J.; Arndt, W.; Miller, B.L.; Wheeler, T.J.; Schreiber, F.; Eddy, S.R. HMMER web server: 2015 update. Nucleic Acids Res. 2015, 43, W30–W38. [Google Scholar] [CrossRef]
- Voorrips, R. MapChart: Software for the graphical presentation of linkage maps and QTLs. J Hered. 2002, 93, 77–78. [Google Scholar] [CrossRef]
- Thompson, J.D.; Gibson, T.J.; Higgins, D.G. Multiple sequence alignment using ClustalW and ClustalX. Curr. Protoc. Bioinform. 2002, 1, 2–3. [Google Scholar] [CrossRef] [PubMed]
- Guindon, S.; Gascuel, O. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 2003, 52, 696–704. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant. 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
- Marchler-Bauer, A.; Lu, S.; Anderson, J.B.; Chitsaz, F.; Derbyshire, M.K.; DeWeese-Scott, C.; Bryant, S.H. CDD: A conserved domain database for the functional annotation of proteins. Nucleic Acids Res. 2010, 39, D225–D229. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- von Mering, C.; Jensen, L.J.; Snel, B.; Hooper, S.D.; Krupp, M.; Foglierini, M.; Jouffre, N.; Huynen, M.A.; Bork, P. STRING: Known and predicted protein–protein associations, integrated and transferred across organisms. Nucleic Acids Res. 2005, 33, D433–D437. [Google Scholar] [CrossRef]
Alias Name | Gene ID | Start | End | Genomic Length (bp) | CDS Length (bp) | LG | Protein Length (AA) | Molecular Weight (KD) | pI | Exons |
---|---|---|---|---|---|---|---|---|---|---|
VrNBS_CNLRR-1 | Vradi04g06660 | 14210891 | 14220840 | 9949 | 4989 | 4 | 1662 | 191.81 | 5.83 | 5 |
VrNBS_CNLRR-2 | Vradi04g06670 | 14251005 | 14255633 | 4628 | 4097 | 4 | 1342 | 155.21 | 5.76 | 4 |
VrNBS_CNLRR-3 | Vradi04g06680 | 14272269 | 14285978 | 13709 | 6105 | 4 | 1464 | 169.18 | 5.66 | 8 |
VrNBS_CNLRR-4 | Vradi04g06840 | 14628767 | 14647415 | 18648 | 7498 | 4 | 2420 | 272.73 | 6.5 | 23 |
VrNBS_NLRRcc-5 | Vradi09g04000 | 5436962 | 5450570 | 13608 | 3772 | 9 | 1093 | 130.68 | 6.09 | 5 |
VrNBS_LRR-6 | Vradi09g07330 | 12141674 | 12157663 | 15989 | 3795 | 9 | 1264 | 145.8 | 5.57 | 9 |
VrNBS_TNLRR-7 | Vradi0023s00600 | 1453281 | 1464622 | 11341 | 3643 | Scf | 1199 | 137.21 | 7.01 | 7 |
VrNBS_TNLRR-8 | Vradi02g09230 | 14138816 | 14142451 | 3635 | 3222 | 2 | 1057 | 121.51 | 6.65 | 5 |
VrNBS_TNLRR-9 | Vradi07g04750 | 8980383 | 8989982 | 9599 | 4110 | 7 | 1369 | 155.74 | 8.38 | 7 |
VrNBS_TNLRR-10 | Vradi10g01550 | 4532573 | 4537238 | 4665 | 3465 | 10 | 970 | 111.08 | 7.17 | 5 |
VrNBS_NLRRtir-11 | Vradi06g03670 | 4063230 | 4071861 | 8631 | 5064 | 6 | 1687 | 191.8 | 5.36 | 10 |
VrNBS_RNLRR-12 | Vradi05g17300 | 26439031 | 26441659 | 2628 | 2628 | 5 | 875 | 100.33 | 8.5 | 1 |
VrNBS_RNLRR-13 | Vradi11g08410 | 9037552 | 9040739 | 3187 | 3012 | 11 | 940 | 107.32 | 9.09 | 2 |
VrLRR_RLK-14 | Vradi0364s00070 | 221815 | 222387 | 573 | 489 | scf | 1024 | 115.02 | 5.46 | 1 |
VrLRR_RLK-15 | Vradi04g08160 | 16479429 | 16479782 | 354 | 354 | 4 | 1097 | 120.46 | 7.02 | 1 |
VrLRR_RLK-16 | Vradi05g23590 | 37053695 | 37056798 | 3104 | 369 | 5 | 337 | 38.66 | 5.72 | 1 |
VrLRR_RLK-17 | Vradi06g16080 | 36338628 | 36342637 | 4010 | 192 | 6 | 691 | 78.29 | 8.44 | 1 |
VrLRR_RLK-18 | Vradi08g04290 | 7932027 | 7935482 | 3459 | 3324 | 8 | 1107 | 122.49 | 6.06 | 1 |
VrLRR_RLK-19 | Vradi10g09720 | 17290628 | 17291818 | 1191 | 507 | 10 | 988 | 109.79 | 5.79 | 1 |
VrLRR_RLK-20 | Vradi11g09460 | 11258567 | 11259580 | 1014 | 564 | 11 | 680 | 76.27 | 6.54 | 1 |
VrLRR_RLK-21 | Vradi01g00000986 | 14577697 | 14580983 | 3287 | 600 | 1 | 1092 | 123.68 | 5.82 | 1 |
VrLRR_RLK-22 | Vradi01g00001365 | 23290961 | 23291479 | 519 | 519 | 1 | 1073 | 122.25 | 7.55 | 1 |
VrLRR_RLK-23 | Vradi02g00003902 | 66843924 | 66850789 | 6866 | 6866 | 2 | 1066 | 120.69 | 5.04 | 1 |
VrLRR_RLK-24 | Vradi03g00001007 | 15971710 | 15974841 | 3132 | 825 | 3 | 304 | 33.57 | 9.97 | 1 |
VrLRR_RLK-25 | Vradi03g00001199 | 23258997 | 23259299 | 303 | 303 | 3 | 703 | 79.67 | 6.96 | 1 |
VrLRR_RLK-26 | Vradi04g00000481 | 4153585 | 4167179 | 13595 | 5370 | 4 | 402 | 44.7 | 5.57 | 1 |
VrLRR_RLK-27 | Vradi04g00000484 | 4174685 | 4180979 | 6295 | 2826 | 4 | 680 | 76.27 | 6.54 | 1 |
VrLRR_RLK-28 | Vradi04g00003234 | 33378300 | 33378479 | 180 | 180 | 4 | 922 | 99.6 | 6.13 | 1 |
VrLRR_RLK-29 | Vradi05g00000393 | 4807277 | 4807618 | 342 | 342 | 5 | 832 | 92.09 | 5.54 | 1 |
VrLRR_RLK-30 | Vradi05g00000473 | 6026299 | 6029438 | 3140 | 513 | 5 | 532 | 59.48 | 6.74 | 1 |
VrLRR_RLK-31 | Vradi05g00000709 | 12794518 | 12794838 | 321 | 321 | 5 | 1024 | 115.02 | 5.46 | 1 |
VrLRR_RLK-32 | Vradi06g00001292 | 9691186 | 9694702 | 3517 | 2721 | 6 | 1010 | 111.86 | 9.08 | 1 |
VrLRR_RLK-33 | Vradi06g00001294 | 9706565 | 9709835 | 3271 | 3048 | 6 | 1033 | 112.78 | 5.93 | 1 |
VrLRR_RLK-34 | Vradi07g00000022 | 710126 | 710960 | 835 | 633 | 7 | 922 | 99.6 | 6.13 | 1 |
VrLRR_RLK-35 | Vradi07g00001333 | 15944451 | 15945107 | 657 | 657 | 7 | 304 | 33.57 | 9.97 | 1 |
VrLRR_RLK-36 | Vradi07g00001343 | 16073870 | 16077673 | 3804 | 3210 | 7 | 1073 | 118.56 | 6.72 | 1 |
VrLRR_RLK-37 | Vradi07g00001347 | 16099525 | 16103169 | 3645 | 2922 | 7 | 1114 | 123.46 | 6.41 | 1 |
VrLRR_RLK-38 | Vradi07g00001350 | 16138091 | 16141487 | 3397 | 1527 | 7 | 1114 | 122.33 | 1 | |
VrLRR_RLK-39 | Vradi08g00000540 | 3725060 | 3725818 | 759 | 549 | 8 | 988 | 109.79 | 5.79 | 1 |
VrLRR_RLK-40 | Vradi09g00000367 | 8973260 | 8973553 | 294 | 294 | 9 | 680 | 76.27 | 6.54 | 1 |
VrLRR_RLK-41 | Vradi09g00000606 | 13594570 | 13594863 | 294 | 294 | 9 | 1101 | 124.18 | 6.46 | 1 |
VrLRR_RLK-42 | Vradi09g00000615 | 13684182 | 13686370 | 2189 | 843 | 9 | 1258 | 141.55 | 7.53 | 1 |
VrLRR_RLK-43 | Vradi09g00002473 | 36363503 | 36363988 | 486 | 486 | 9 | 612 | 68.53 | 5.55 | 1 |
VrLRR_RLK-44 | Vradi10g00001185 | 18348747 | 18351531 | 2785 | 897 | 10 | 584 | 65.74 | 5.53 | 1 |
VrLRR_RLK-45 | Vradi11g00000925 | 8782787 | 8783011 | 225 | 225 | 11 | 635 | 70.12 | 5.92 | 1 |
VrLRR_RLK-46 | VradiU00001261 | 558716 | 561486 | 2771 | 1197 | scf | 856 | 93.6 | 6.96 | 1 |
Primer Name | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) |
---|---|---|
VrNBS_NLRRTr-8 | AGTGTGGTTGCCGTGTGATA | GGGAGAGGATGTGTTTGGAG |
VrNBS_NLRRTir-11 | TGGAGTGACCAATCTCAGCA | CCCCTCATCATCTTTTGGAC |
VrNBS_NLRRcc-5 | ACAGGGACACCCATGACAAT | GGGGTAGAGGACCCATTTGA |
VrNBS_TNLRR-8 | CCCGAGCTTCCAACAATACA | CATCCGAGGGACCAACTAAA |
VrNBS_CNLRR-4 | GTCAGGAAAAAGGGGTCTCC | TTTTTGGCTTATTAGACTGACTT |
VrLRR_RLK-16 | TGG CCC CGG AGG TAT GTG | CCA TCC CCA TGT GTC AGC A |
VrLRR_RLK-17 | CAA CAA TTC GCT TAG TGG GC | GCT TGG CAT CTG AGA GAG CT |
VrLRR_RLK-30 | CGA TGG CCG GAA ACG TGT C | GAC AAA CAG GCT AAG CAG GC |
VrLRR_RLK-18 | GGG TCC ACT GCC CAA CAT TC | GCA TGG AAG TGC CCA AAC C |
VrLRR_RLK-20 | GTT TCC AAT GCC ACC ACT CTG | GGT GTG AGA GGT GTT GGT CC |
VrLRR_RLK-19 | GAC GGA GAT GTT CAG GGT G | GCG AGT GAT TCT TCC CTG AAC |
VrLRR_RLK-31 | GGA GTT GTG TGG GAA GAA AG | GTC ACT CTT TCC CAG GAG C |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shukla, M.; Kaundal, P.; Purwar, S.; Kumar, M.; Maurya, C.; Chirag; Mishra, A.K.; Baek, K.-H.; Singh, C.M. Salicylic Acid-Induced Expression Profiles of LRR and LRR-RLK Candidate Genes Modulate Mungbean Yellow Mosaic India Virus Resistance in Blackgram and Its Two Wild Non-Progenitors. Plants 2024, 13, 3601. https://doi.org/10.3390/plants13243601
Shukla M, Kaundal P, Purwar S, Kumar M, Maurya C, Chirag, Mishra AK, Baek K-H, Singh CM. Salicylic Acid-Induced Expression Profiles of LRR and LRR-RLK Candidate Genes Modulate Mungbean Yellow Mosaic India Virus Resistance in Blackgram and Its Two Wild Non-Progenitors. Plants. 2024; 13(24):3601. https://doi.org/10.3390/plants13243601
Chicago/Turabian StyleShukla, Mansi, Priyanka Kaundal, Shalini Purwar, Mukul Kumar, Chandragupt Maurya, Chirag, Awdhesh Kumar Mishra, Kwang-Hyun Baek, and Chandra Mohan Singh. 2024. "Salicylic Acid-Induced Expression Profiles of LRR and LRR-RLK Candidate Genes Modulate Mungbean Yellow Mosaic India Virus Resistance in Blackgram and Its Two Wild Non-Progenitors" Plants 13, no. 24: 3601. https://doi.org/10.3390/plants13243601
APA StyleShukla, M., Kaundal, P., Purwar, S., Kumar, M., Maurya, C., Chirag, Mishra, A. K., Baek, K.-H., & Singh, C. M. (2024). Salicylic Acid-Induced Expression Profiles of LRR and LRR-RLK Candidate Genes Modulate Mungbean Yellow Mosaic India Virus Resistance in Blackgram and Its Two Wild Non-Progenitors. Plants, 13(24), 3601. https://doi.org/10.3390/plants13243601