Genetic Diversity and Relationships Among Tunisian Wild and Cultivated Rosa L. Species
Abstract
1. Introduction
2. Results
2.1. Genetic Diversity Analysis and Polymorphism Level Identified Among Rosa Species in Tunisia
2.2. Genetic Diversity Structuration Among Rosa Species in Tunisia
2.3. Resolving the Phylogeny of the ‘Rose of Ariana’ and the Nomenclature Confusions of Rose Species in Tunisia
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. DNA Extraction and SSR Marker Amplification
4.3. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gudin, S. Rose Breeding Technologies. Acta Hortic. 2001, 547, 23–33. [Google Scholar] [CrossRef]
- Wissemann, V. Classification | Conventional Taxonomy (Wild Roses). In Encyclopedia of Rose Science; Academic Press: Cambridge, MA, USA, 2003; pp. 111–117. ISBN 978-0-12-227620-0. [Google Scholar]
- Anderson, N. Flower Breeding and Genetics: Issues, Challenges and Opportunities for the 21st Century; Springer: Dordrecht, The Netherlands, 2006; p. 824. [Google Scholar]
- Crespel, L.; Mouchotte, J. BREEDING | Methods of Cross-Breeding. In Encyclopedia of Rose Science; Academic Press: Cambridge, MA, USA, 2003; Volume 1, pp. 30–33. ISBN 978-0-12-227620-0. [Google Scholar]
- Stewart, R.N. Origin, Cytology and Genetics. In Roses; Mastalerz, J.W., Langhans, R.W., Eds.; New York State Flower Grower Association Inc.: New York, NY, USA, 1969. [Google Scholar]
- Pottier-Alapetite, G. (19-)-botaniste A. In Flore de La Tunisie: Angiospermes-Dicotylédones; Ministry of Higher Education and Scientific Research and the Ministry of Agriculture: Tunis, Tunisia, 1979. [Google Scholar]
- Ben Cheikh-Affene, Z.B.; Haouala, F.; Harzallah-Skhiri, F. Morphometric Variation and Taxonomic Identification of Thirteen Wild Rose Populations from Tunisia. Acta Bot. Croat. 2015, 74, 1–17. [Google Scholar] [CrossRef][Green Version]
- Ghazghazi, H.; Miguel, M.; Al Weslati, M.; Hasnaoui, B.; Sebei, H.; Barroso, J.; Pedro, L.; Figueiredo, A. Chemical Variability of the Essential Oils from Rosa canina L. and Rosa sempervirens L. Flowers Collected at Tunisia. J. Essent. Oil Res. 2012, 24, 475–480. [Google Scholar] [CrossRef]
- Ouerghemmi, S.; Sebei, H.; Siracusa, L.; Ruberto, G.; Saija, A.; Cimino, F.; Cristani, M. Comparative Study of Phenolic Composition and Antioxidant Activity of Leaf Extracts from Three Wild Rosa Species Grown in Different Tunisia Regions: Rosa canina L., Rosa Moschata Herrm. and Rosa sempervirens L. Ind. Crops Prod. 2016, 94, 167–177. [Google Scholar] [CrossRef]
- Mezghani, N.; Debbabi, O.; Rouz, S.; Medini, M. AFLP Markers for the Assessment of Genetic Variability in Rose (Rosa gallica L.) Cultivars in Tunisia. Int. J. Adv. Res. 2015, 3, 35–42. [Google Scholar]
- Loghmani-Khouzani, H. Essential Oil Composition of Rosa damascena Mill Cultivated in Central Iran. Sci. Iran. 2007, 14, 316–319. [Google Scholar]
- Tabaei-Aghdaei, S.; Hosseini Monfared, H.; Fahimi, H.; Ebrahimzadeh, H.; Jebbely, M.; Naghavi, M.R.; Babaei, A. Genetic Variation Analysis of Different Populations of Rosa damascena in NW Iran Using RAPD Markers. Iran. J. Bot. 2006, 12, 121–127. [Google Scholar]
- Achuthan, C.R.; Babu, B.H.; Padikkala, J. Antioxidant and Hepatoprotective Effects of Rosa damascena. Pharm. Biol. 2003, 41, 357–361. [Google Scholar] [CrossRef]
- Bano, H.; Ahmad, I.; Qureshi, M. Pharmacological Effects of Rosa damascena Mill and Its Various Isolated Constituents from Flowers, an Important Drug of Unani Medicine. A Review. JETIR J. Emerg. Technol. Innov. Res. 2018, 5, 1301–1311. [Google Scholar]
- Thallaj, N.; Agha, M.I.H.; Nattouf, A.H.; Khatib, C.; Karaali, A.; Moustapha, A.; Labban, L. Evaluation of Antimicrobial Activities and Bioactive Compounds of Different Extracts Related to Syrian Traditional Products of Damask Rose (Rosa damascena). Open Access Libr. J. 2020, 7, 1–21. [Google Scholar] [CrossRef]
- Boskabady, M.H.; Shafei, M.N.; Saberi, Z.; Amini, S. Pharmacological Effects of Rosa damascena. Iran. J. Basic Med. Sci. 2011, 14, 295–307. [Google Scholar] [PubMed]
- Baccouche, A. L’Ariana: Du Village à la Grande Ville; Arabesques: Tunis, Tunisia, 2015; ISBN 978-9938-07-118-4. [Google Scholar]
- DGPA: The General Direction of Agricultural Production-Statistical Directories. Distribution of areas and yields of rose cultivation in Tunisia; Ministry of Agriculture: Tunis, Tunisia, 2024.
- Hibrand-Saint Oyant, L.; Crespel, L.; Rajapakse, S.; Zhang, L.; Foucher, F. Genetic Linkage Maps of Rose Constructed with New Microsatellite Markers and Locating QTL Controlling Flowering Traits. Tree Genet. Genomes 2008, 4, 11–23. [Google Scholar] [CrossRef]
- Rusanov, K.; Kovacheva, N.; Atanassov, A.; Atanassov, I. Rosa damascena Mill., the Oil-Bearing Damask Rose: Genetic Resources, Diversity and Perspectives for Molecular Breeding. Floric. Ornam. Biotechnol. 2009, 3, 14–20. [Google Scholar]
- Scariot, V.; Akkak, A.; Botta, R. Characterization and Genetic Relationships of Wild Species and Old Garden Roses Based on Microsatellite Analysis. J. Am. Soc. Hortic. Sci. 2006, 131, 66–73. [Google Scholar] [CrossRef]
- Sharma, R.K.; Chaudhary, A.; Sharma, H.; Bhardwaj, P.; Sharma, V.; Kumar, R.; Ahuja, P.S. Identification and Cross-Species Amplification of Microsatellite Markers Derived from Expressed Sequence Data of Rose Species. J. Plant Biochem. Biotechnol. 2015, 24, 359–364. [Google Scholar] [CrossRef]
- Nybom, H.; Werlemark, G.; Esselink, D.G.; Vosman, B. Sexual Preferences Linked to Rose Taxonomy and Cytology. Acta Hortic. 2005, 690, 21–28. [Google Scholar] [CrossRef]
- Bendahmane, M.; Dubois, A.; Raymond, O.; Bris, M.L. Genetics and Genomics of Flower Initiation and Development in Roses. J. Exp. Bot. 2013, 64, 847–857. [Google Scholar] [CrossRef]
- Veluru, A.; Bhat, K.; Janakiram, T.; Prasad, K.; Raju, D.V.S.; Banyal, N.; Panwar, S.; Singh, K. Molecular Characterization and Relationship among Wild and Partially Cultivated Rosa Species. Indian J. Hortic. 2022, 79, 387–393. [Google Scholar] [CrossRef]
- Bruneau, A.; Starr, J.; Joly, S. Phylogenetic Relationships in the Genus Rosa: New Evidence from Chloroplast DNA Sequences and an Appraisal of Current Knowledge. Syst. Bot. 2007, 32, 366–378. [Google Scholar] [CrossRef]
- Wissemann, V.; Ritz, C.M. The Genus Rosa (Rosoideae, Rosaceae) Revisited: Molecular Analysis of nrITS-1 and atpB-rbcL Intergenic Spacer (IGS) versus Conventional Taxonomy. Bot. J. Linn. Soc. 2005, 147, 275–290. [Google Scholar] [CrossRef]
- Gaurav, A.K.; Namita; Raju, D.V.S.; Ramkumar, M.K.; Singh, M.K.; Singh, B.; Krishnan, S.G.; Panwar, S.; Sevanthi, A.M. Genetic Diversity Analysis of Wild and Cultivated Rosa Species of India Using Microsatellite Markers and Their Comparison with Morphology Based Diversity. J. Plant Biochem. Biotechnol. 2022, 31, 61–70. [Google Scholar] [CrossRef]
- Liorzou, M.; Pernet, A.; Li, S.; Chastellier, A.; Thouroude, T.; Michel, G.; Malécot, V.; Gaillard, S.; Briée, C.; Foucher, F.; et al. Nineteenth Century French Rose (Rosa sp.) Germplasm Shows a Shift over Time from a European to an Asian Genetic Background. J. Exp. Bot. 2016, 67, 4711–4725. [Google Scholar] [CrossRef] [PubMed]
- Veluru, A.; Bhat, K.V.; Raju, D.V.S.; Prasad, K.V.; Tolety, J.; Bharadwaj, C.; Mitra, S.V.A.C.R.; Banyal, N.; Singh, K.P.; Panwar, S. Characterization of Indian Bred Rose Cultivars Using Morphological and Molecular Markers for Conservation and Sustainable Management. Physiol. Mol. Biol. Plants 2020, 26, 95–106. [Google Scholar] [CrossRef] [PubMed]
- Vukosavljev, M.; Zhang, J.; Esselink, G.D.; Van ‘T Westende, W.P.C.; Cox, P.; Visser, R.G.F.; Arens, P.; Smulders, M.J.M. Genetic Diversity and Differentiation in Roses: A Garden Rose Perspective. Sci. Hortic. 2013, 162, 320–332. [Google Scholar] [CrossRef]
- Bruvo, R.; Michiels, N.K.; D’Souza, T.G.; Schulenburg, H. A Simple Method for the Calculation of Microsatellite Genotype Distances Irrespective of Ploidy Level. Mol. Ecol. 2004, 13, 2101–2106. [Google Scholar] [CrossRef]
- Ward, J.H., Jr. Hierarchical Grouping to Optimize an Objective Function. J. Am. Stat. Assoc. 1963, 58, 236–244. [Google Scholar] [CrossRef]
- Austin, D. Handbook of Roses 2012/2013. Available online: https://www.davidaustinroses.co.uk/pages/handbook-of-roses-2024 (accessed on 24 September 2024).
- Veluru, A.; Bhat, K.; Janakiram, T.; Prasad, K.; Raju, V.; Singh, K. Assessment of Genetic Diversity and Population Structure of Fragrant Rose (Rosa × Hybrida) Cultivars Using Microsatellite Markers. Indian J. Agric. Sci. 2019, 89, 1964–1970. [Google Scholar] [CrossRef]
- Samiei, L.; Naderi, R.; Khalighi, A.; Bushehri, A.; Mozaffarian, V.; Esselink, D.; Kazempour-Osaloo, S.; Smulders, M.J.M. Genetic Diversity and Genetic Similarities between Iranian Rose Species. J. Hortic. Sci. Biotechnol. 2010, 85, 231–237. [Google Scholar] [CrossRef]
- Smulders, M.J.M.; Esselink, D.; Voorrips, R.E.; Vosman, B. Analysis of a Database of DNA Profiles of 734 Hybrid Tea Rose Varieties. Acta Hortic. 2009, 836, 169–175. [Google Scholar] [CrossRef]
- Cheng, B.; Wan, H.; Han, Y.; Yu, C.; Luo, L.; Pan, H.; Zhang, Q. Identification and QTL Analysis of Flavonoids and Carotenoids in Tetraploid Roses Based on an Ultra-High-Density Genetic Map. Front. Plant Sci. 2021, 12, 682305. [Google Scholar] [CrossRef] [PubMed]
- Agaoglu, Y.S.; Ergül, A.; Baydar, N. Molecular Analysis of Genetic Diversity Oil Rose (Rosa damascena Mill.) Grown Isparta (Turkey) Region. Biotechnol. Biotechnol. Equip. 2000, 14, 16–18. [Google Scholar] [CrossRef]
- Baydar, N.G.; Baydar, H.; Debener, T. Analysis of Genetic Relationships among Rosa damascena Plants Grown in Turkey by Using AFLP and Microsatellite Markers. J. Biotechnol. 2004, 111, 263–267. [Google Scholar] [CrossRef]
- Farooq, A.; Kiani, M.; Khan, M.A.; Riaz, A.; Khan, A.A.; Anderson, N.; Byrne, D.H. Microsatellite Analysis of Rosa damascena from Pakistan and Iran. Hortic. Environ. Biotechnol. 2013, 54, 141–147. [Google Scholar] [CrossRef]
- Joichi, A.; Yomogida, K.; Awano, K.; Ueda, Y. Volatile Components of Tea-Scented Modern Roses and Ancient Chinese Roses. Flavour Fragr. J. 2005, 20, 152–157. [Google Scholar] [CrossRef]
- Gardès, L.; Heizmann, P.; Joyaux, F. Molecular Typing and History of the Provins Roses Horticultural Group. Eur. J. Hortic. Sci. 2005, 70, 162. [Google Scholar]
- Bernatzky, R.; Tanksley, S.D. Genetics of Actin-Related Sequences in Tomato. Theor. Appl. Genet. 1986, 72, 314–321. [Google Scholar] [CrossRef]
- Batnini, M.; Bourguiba, H.; Neila, T.-F.; Krichen, L. Chloroplast DNA Sequence Data Provides New Insights into Genetic Diversity and Phylogenetic Relationships of Tunisian Apricot Germplasm. Sci. Hortic. 2014, 178, 241–247. [Google Scholar] [CrossRef]
- Bnikkou, S.; Laknifli, A.; Majourhat, K.; Jalili, S.; Hernández, J.A.; Martínez-Gómez, P.; Martínez-García, P.J. Molecular Characterization Using SSR Markers and Biochemical Analysis of Moroccan and Spanish Argan [Argania spinosa (L.) Skeels] Ecotypes under Water Stress and Rewatering. Biologia 2021, 76, 799–808. [Google Scholar] [CrossRef]
- Esselink, G.; Smulders, M.; Vosman, B. Identification of Cut Rose (Rosa hybrida) and Rootstock Varieties Using Robust Sequence Tagged Microsatellite Site Markers. Theor. Appl. Genet. 2003, 106, 277–286. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.H.; Byrne, D.H.; Ballard, R.E.; Rajapakse, S. Microsatellite Marker Development in Rose and Its Application in Tetraploid Mapping. J. Am. Soc. Hortic. Sci. 2006, 131, 380–387. [Google Scholar] [CrossRef]
- Becher, S.A.; Steinmetz, K.; Weising, K.; Boury, S.; Peltier, D.; Renou, J.-P.; Kahl, G.; Wolff, K. Microsatellites for Cultivar Identification in Pelargonium. Theor. Appl. Genet. 2000, 101, 643–651. [Google Scholar] [CrossRef]
- Park, Y.H.; Ahn, S.G.; Choi, Y.M.; Oh, H.J.; Ahn, D.C.; Kim, J.G.; Kang, J.S.; Choi, Y.W.; Jeong, B.R. Rose (Rosa hybrida L.) EST-Derived Microsatellite Markers and Their Transferability to Strawberry (Fragaria spp.). Sci. Hortic. 2010, 125, 733–739. [Google Scholar] [CrossRef]
- Hardy, O.J.; Vekemans, X. Spagedi: A Versatile Computer Program to Analyse Spatial Genetic Structure at the Individual or Population Levels. Mol. Ecol. Notes 2002, 2, 618–620. [Google Scholar] [CrossRef]
- Nei, M. Estimation of Average Heterozygosity and Genetic Distance from a Small Number of Individuals. Genetics 1978, 89, 583–590. [Google Scholar] [CrossRef] [PubMed]
- Holsinger, K.E.; Weir, B.S. Genetics in Geographically Structured Populations: Defining, Estimating and Interpreting FST. Nat. Rev. Genet. 2009, 10, 639–650. [Google Scholar] [CrossRef] [PubMed]
- Peakall, R.; Smouse, P.E. Genalex 6: Genetic Analysis in Excel. Population Genetic Software for Teaching and Research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef]
- Peakall, R.; Smouse, P.E. GenALEx 6.5: Genetic Analysis in Excel. Population Genetic Software for Teaching and Research-an Update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [PubMed]
- Thummajitsakul, S.; Klinbunga, S.; Smith, D.; Sittipraneed, S. Genetic Diversity and Population Structure of Trigona Pagdeni Schwarz in Thailand. Apidologie 2008, 39, 446–455. [Google Scholar] [CrossRef]
- Clark, L.V.; Jasieniuk, M. Polysat: An R Package for Polyploid Microsatellite Analysis. Mol. Ecol. Resour. 2011, 11, 562–566. [Google Scholar] [CrossRef] [PubMed]
- R Core Team R: A Language and Environment for Statistical Computing. Available online: https://www.yumpu.com/en/document/view/6853895/r-a-language-and-environment-for-statistical-computing (accessed on 21 September 2024).
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a Genetic Linkage Map in Man Using Restriction Fragment Length Polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar] [PubMed]
- Becker, R.A.; Chambers, J.M.; Wilks, A.R. The New S Language; Computer Science Series; Chapman and Hall/CRC: Pacific Grove, CA, USA, 1988; ISBN 0534091938/9780534091934. [Google Scholar]
- Mardia, K.V.; Kent, J.T.; Taylor, C.C. Multivariate Analysis; John Wiley & Sons: Hoboken, NJ, USA, 2024; ISBN 978-1-118-73802-3. [Google Scholar]
- Venables, W.N.; Ripley, B.D. Modern Applied Statistics with S; Springer: New York, NY, USA, 2002. [Google Scholar]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of Population Structure Using Multilocus Genotype Data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [PubMed]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the Number of Clusters of Individuals Using the Software STRUCTURE: A Simulation Study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [PubMed]
SSR | Number of Alleles | Size (bp) | He | Ho | PIC | APN |
---|---|---|---|---|---|---|
RhE2b | 23 | 162–198 | 0.878 | 0.679 | 0.941 | 72 |
RW52D4 | 23 | 203–273 | 0.870 | 0.706 | 0.912 | 47 |
H10D03 | 22 | 205–246 | 0.924 | 0.583 | 0.927 | 55 |
RW10M24 | 22 | 253–292 | 0.894 | 0.220 | 0.911 | 40 |
RhD201 | 21 | 188–248 | 0.904 | 0.541 | 0.895 | 47 |
RhB303 | 19 | 119–152 | 0.803 | 0.527 | 0.881 | 54 |
H20D08 | 17 | 237–290 | 0.903 | 0.128 | 0.891 | 28 |
Average | 21 | 195–243 | 0.882 | 0.483 | 0.908 | |
Total | 147 | 343 |
Source | DF | SS | MS | EV | PV | PhiPT 1 | p-Value (Rand ≥ Data) 2 |
---|---|---|---|---|---|---|---|
Among group | 10 | 9.252 | 0.925 | 0.068 | 11% | 0.180 | 0.001 |
Within group | 103 | 31.717 | 0.308 | 0.308 | 89% | ||
Total | 113 | 40.969 | 0.376 | 100% |
SSR Primers 1 | |||||||
Rose Samples | H10D03 | H20D08 | RhB303 | RhD201 | RhE2b | RW10M24 | RW52D04 |
RA.LK(1) | (208, 223, 240) | 258 | 129 | 203 | (179, 184, 186) | 284 | (204, 218) |
RA.LK(2) | (208, 223, 240) | 260 | 127 | 203 | (177, 180, 186) | 285 | 207 |
RA.LK(3) | (208, 223, 240) | 258 | 128 | 200 | (177, 182, 186) | 285 | (204, 216) |
RA.LK(4) | (208, 225, 240) | 265 | 129 | 200 | (175, 182, 186) | 0 | 204 |
RA.BNG(1) | (205, 223, 240) | 261 | 126 | (197, 203) | (167, 176, 180) | 285 | (204, 218) |
RA.BNG(2) | (205, 220, 235) | 258 | 126 | 203 | (167, 176, 180) | 284 | (207, 218) |
RA.BNG(3) | (205, 223, 239) | 260 | 126 | 203 | (165, 176, 180) | 285 | (207, 218) |
RA.BNG(4) | (208, 223, 239) | 254 | 130 | (198, 203) | (167, 176, 180) | 285 | (204, 218) |
RA.IB(1) | (208, 225, 240) | 260 | 126 | (198, 203) | (165, 175) | 285 | (204, 218) |
RA.IB(2) | 0 | 260 | 126 | (198, 203) | (175, 180) | 284 | 0 |
RCe.IB(1) | (205, 223, 239) | 260 | (127, 135) | (197, 200) | (175, 180, 187) | 285 | (204, 216) |
RCe.IB(2) | 0 | 260 | (127, 135) | 0 | (176, 182, 187) | 0 | 0 |
RCe.IB(3) | (205, 223, 239) | 260 | (127, 135) | (197, 200) | 0 | 285 | (204, 216) |
RG.RdP.SA | (223, 235) | (260, 290) | 127 | (198, 203, 215) | (167, 176, 187) | 283 | (207, 213) |
SSR Primers 1 | |||||||
Rose Samples | H10D03 | H20D08 | RhB303 | RhD201 | RhE2b | RW10M24 | RW52D04 |
RB.MIP.SA | 232 | 247 | (131, 147) | 206 | (167, 188) | 273 | (216, 231) |
RK.IB(1) | (223, 232) | 247 | (127, 147) | (197, 206, 239) | (184, 193) | (253, 265) | (216, 231) |
RK.IB(2) | (223, 232) | 247 | (127, 135) | (199, 206, 240) | (184, 193) | (253, 285) | (216, 231) |
RK.IB(3) | (223, 232) | 247 | (127, 147) | (197, 206, 239) | (184, 193) | 0 | (216, 231) |
RCe.SA(1) | 232 | 260 | (119, 127, 147) | (198, 203) | (167, 188) | 273 | (212, 231) |
RCe.SA(2) | 232 | 260 | (119, 127, 147) | (198, 203) | (167, 188) | 273 | (212, 231) |
RCe.SA(3) | 232 | 260 | (119, 127, 147) | (199, 203) | (167, 188) | 273 | (212, 231) |
RCe.SA(4) | 232 | 260 | (119, 127, 147) | (198, 203) | (167, 188) | 273 | (212, 231) |
SSRs | Forward (5′-3′) | Reverse (5′-3′) | LG | Ta | Ref. |
---|---|---|---|---|---|
RhD201 | GGTATGCAAATAAGAGATACAGT | GTTTCTTCCTAACAAACCCATTTTGAAAGGG | 1 | 53 °C | [47] |
RhB303 | CACTGCAACAACCCAATAGC | GTTTCTTGTCTTCAGCTTAGACTGTGCTG | 2 | 50 °C | [47] |
H20D08 | TTCGGCTCTCTTCTCTGCTC | GACATTACAGCGACGAAGCA | 4 | 53 °C | [19] |
RW52D4 | GGCAGTTGCTGTGCAGTG | TTGTGCCGACTCAAAATCAA | 5 | 55 °C | [19] |
RhE2b | CTTTGCATCAGAATCTGCTGCATT | GTTTCTTGCAGACACAGTTCATTAAAGCAG | 6 | 53 °C | [47] |
H10D03 | CAATTCAAAACCACCGCTCT | CGCAGAGTCAACGAACCATA | 7 | 55 °C | [19] |
RW10M24 | TTAATCCAAGGTCAAAGCTG | TCTCTTTCCCTCCTCACTCT | 7 | 53 °C | [48] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chtourou, K.; Salazar, J.A.; Ortuño-Hernández, G.; Mezghani, N.; Trifi-Farah, N.; Martínez-Gómez, P.; Krichen, L. Genetic Diversity and Relationships Among Tunisian Wild and Cultivated Rosa L. Species. Plants 2024, 13, 3563. https://doi.org/10.3390/plants13243563
Chtourou K, Salazar JA, Ortuño-Hernández G, Mezghani N, Trifi-Farah N, Martínez-Gómez P, Krichen L. Genetic Diversity and Relationships Among Tunisian Wild and Cultivated Rosa L. Species. Plants. 2024; 13(24):3563. https://doi.org/10.3390/plants13243563
Chicago/Turabian StyleChtourou, Khouloud, Juan Alfonso Salazar, Germán Ortuño-Hernández, Najla Mezghani, Neila Trifi-Farah, Pedro Martínez-Gómez, and Lamia Krichen. 2024. "Genetic Diversity and Relationships Among Tunisian Wild and Cultivated Rosa L. Species" Plants 13, no. 24: 3563. https://doi.org/10.3390/plants13243563
APA StyleChtourou, K., Salazar, J. A., Ortuño-Hernández, G., Mezghani, N., Trifi-Farah, N., Martínez-Gómez, P., & Krichen, L. (2024). Genetic Diversity and Relationships Among Tunisian Wild and Cultivated Rosa L. Species. Plants, 13(24), 3563. https://doi.org/10.3390/plants13243563