Both the Positioned Supplemental or Night-Interruptional Blue Light and the Age of Leaves (or Tissues) Are Important for Flowering and Vegetative Growth in Chrysanthemum
Abstract
:1. Introduction
2. Results
2.1. Growth and Flowering
2.2. Anatomical Structures of Leaves and Stems
2.3. Gene Expression
3. Discussion
3.1. Plant Vegetative Growth
3.2. Photoperiodic Flowering and Gene Expression
4. Materials and Methods
4.1. Plant Materials and Growth Conditions
4.2. Light Treatments
4.3. Measurements of Growth Parameters
4.4. Microscopic Observation of Leaf and Stem Anatomy
4.5. Verification by Real-Time Quantitative PCR
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kami, C.; Lorrain, S.; Hornitschek, P.; Fankhauser, C. Light-regulated plant growth and development. Curr. Top. Dev. Biol. 2010, 91, 29–66. [Google Scholar] [PubMed]
- Leopold, A. Photoperiodism in plants. Q. Rev. Biol. 1951, 26, 247–263. [Google Scholar] [CrossRef] [PubMed]
- Cockshull, K.E. Chrysanthemum morifolium. In Handbook of Flowering; CRC Press: Boca Raton, FL, USA, 2019; pp. 238–257. [Google Scholar]
- Lin, C. Photoreceptors and regulation of flowering time. Plant Physiol. 2000, 123, 39–50. [Google Scholar] [CrossRef]
- Takemiya, A.; Inoue, S.-I.; Doi, M.; Kinoshita, T.; Shimazaki, K.-i. Phototropins promote plant growth in response to blue light in low light environments. Plant Cell 2005, 17, 1120–1127. [Google Scholar] [CrossRef]
- Kimura, M.; Kagawa, T. Phototropin and light-signaling in phototropism. Curr. Opin. Plant Biol. 2006, 9, 503–508. [Google Scholar] [CrossRef] [PubMed]
- López-Juez, E.; Bowyer, J.R.; Sakai, T. Distinct leaf developmental and gene expression responses to light quantity depend on blue-photoreceptor or plastid-derived signals, and can occur in the absence of phototropins. Planta 2007, 227, 113–123. [Google Scholar] [CrossRef]
- Chailakhyan, M.K. About the mechanism of the photoperiodic response. In Dokl Akad Nauk SSSR; Mezhdunarodnaya Kniga: Moscow, Russia, 1936; pp. 85–89. [Google Scholar]
- Kobayashi, Y.; Weigel, D. Move on up, it’s time for change—Mobile signals controlling photoperiod-dependent flowering. Gene. Dev. 2007, 21, 2371–2384. [Google Scholar] [CrossRef]
- Zeevaart, J.A. Leaf-produced floral signals. Curr. Opin. Plant Biol. 2008, 11, 541–547. [Google Scholar] [CrossRef]
- Turnbull, C. Long-distance regulation of flowering time. J. Exp. Bot. 2011, 62, 4399–4413. [Google Scholar] [CrossRef]
- McGarry, R.C.; Ayre, B.G. Manipulating plant architecture with members of the CETS gene family. Plant Sci. 2012, 188, 71–81. [Google Scholar] [CrossRef]
- Abe, M.; Kobayashi, Y.; Yamamoto, S.; Daimon, Y.; Yamaguchi, A.; Ikeda, Y.; Ichinoki, H.; Notaguchi, M.; Goto, K.; Araki, T. FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science 2005, 309, 1052–1056. [Google Scholar] [CrossRef] [PubMed]
- Wigge, P.A.; Kim, M.C.; Jaeger, K.E.; Busch, W.; Schmid, M.; Lohmann, J.U.; Weigel, D. Integration of spatial and temporal information during floral induction in Arabidopsis. Science 2005, 309, 1056–1059. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, Y.; Kaya, H.; Goto, K.; Iwabuchi, M.; Araki, T. A pair of related genes with antagonistic roles in mediating flowering signals. Science 1999, 286, 1960–1962. [Google Scholar] [CrossRef]
- Kardailsky, I.; Shukla, V.K.; Ahn, J.H.; Dagenais, N.; Christensen, S.K.; Nguyen, J.T.; Chory, J.; Harrison, M.J.; Weigel, D. Activation tagging of the floral inducer FT. Science 1999, 286, 1962–1965. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, A.; Kobayashi, Y.; Goto, K.; Abe, M.; Araki, T. TWIN SISTER OF FT (TSF) acts as a floral pathway integrator redundantly with FT. Plant Cell Physiol. 2005, 46, 1175–1189. [Google Scholar] [CrossRef] [PubMed]
- Bradley, D.; Ratcliffe, O.; Vincent, C.; Carpenter, R.; Coen, E. Inflorescence commitment and architecture in Arabidopsis. Science 1997, 275, 80–83. [Google Scholar] [CrossRef]
- Mimida, N.; Goto, K.; Kobayashi, Y.; Araki, T.; Ahn, J.H.; Weigel, D.; Murata, M.; Motoyoshi, F.; Sakamoto, W. Functional divergence of the TFL1-like gene family in Arabidopsis revealed by characterization of a novel homologue. Genes Cells 2001, 6, 327–336. [Google Scholar] [CrossRef]
- Yoo, S.J.; Chung, K.S.; Jung, S.H.; Yoo, S.Y.; Lee, J.S.; Ahn, J.H. BROTHER OF FT AND TFL1 (BFT) has TFL1-like activity and functions redundantly with TFL1 in inflorescence meristem development in Arabidopsis. Plant J. 2010, 63, 241–253. [Google Scholar] [CrossRef]
- Xi, W.; Liu, C.; Hou, X.; Yu, H. MOTHER OF FT AND TFL1 regulates seed germination through a negative feedback loop modulating ABA signaling in Arabidopsis. Plant Cell 2010, 22, 1733–1748. [Google Scholar] [CrossRef]
- Conti, L.; Bradley, D. TERMINAL FLOWER1 is a mobile signal controlling Arabidopsis architecture. Plant Cell 2007, 19, 767–778. [Google Scholar] [CrossRef]
- Huang, N.C.; Jane, W.N.; Chen, J.; Yu, T.S. Arabidopsis thaliana CENTRORADIALIS homologue (ATC) acts systemically to inhibit floral initiation in Arabidopsis. Plant J. 2012, 72, 175–184. [Google Scholar] [CrossRef]
- Thomas, B.; Vince-Prue, D. Photoperiodism in Plants; Elsevier: Amsterdam, The Netherlands, 1996. [Google Scholar]
- Lang, A.; Chailakhyan, M.K.; Frolova, I. Promotion and inhibition of flower formation in a dayneutral plant in grafts with a short-day plant and a long-day plant. Proc. Natl. Acad. Sci. USA 1977, 74, 2412–2416. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, T. Studies on the regulation of Chrysanthemum flowering with special reference to plant regulators I. The inhibiting action of non-induced leaves on floral stimulus. J. Jpn. Soc. Hortic. Sci. 1967, 36, 339–347. [Google Scholar] [CrossRef]
- Zheng, Q.; Weng, Q.; Huang, L.; Wang, K.; Deng, J.; Jiang, R.; Ye, Z.; Gan, M. A new source of multi-spectral high spatial resolution night-time light imagery—JL1-3B. Remote Sens. Environ. 2018, 215, 300–312. [Google Scholar] [CrossRef]
- Yamada, A.; Tanigawa, T.; Suyama, T.; Matsuno, T.; Kunitake, T. Night break treatment using different light sources promotes or delays growth and flowering of Eustoma grandiflorum (Raf.) Shinn. J. Jpn. Soc. Hortic. Sci. 2008, 77, 69–74. [Google Scholar] [CrossRef]
- Park, Y.G.; Muneer, S.; Jeong, B.R. Morphogenesis, flowering, and gene expression of Dendranthema grandiflorum in response to shift in light quality of night interruption. Int. J. Mol. Sci. 2015, 16, 16497–16513. [Google Scholar] [CrossRef]
- Higuchi, Y.; Sumitomo, K.; Oda, A.; Shimizu, H.; Hisamatsu, T. Day light quality affects the night-break response in the short-day plant chrysanthemum, suggesting differential phytochrome-mediated regulation of flowering. J. Plant Physiol. 2012, 169, 1789–1796. [Google Scholar] [CrossRef]
- Park, Y.G.; Jeong, B.R. How supplementary or night-interrupting low-intensity blue light affects the flower induction in chrysanthemum, a qualitative short-day plant. Plants 2020, 9, 1694. [Google Scholar] [CrossRef]
- Park, Y.G.; Jeong, B.R. Night interruption light quality changes morphogenesis, flowering, and gene expression in Dendranthema grandiflorum. Hortic. Environ. Biotechnol. 2019, 60, 167–173. [Google Scholar] [CrossRef]
- SharathKumar, M.; Heuvelink, E.; Marcelis, L.F.; Van Ieperen, W. Floral induction in the short-day plant chrysanthemum under blue and red extended long-days. Front. Plant Sci. 2021, 11, 610041. [Google Scholar] [CrossRef] [PubMed]
- Park, Y.G.; Jeong, B.R. Both the quality and positioning of the night interruption light are important for flowering and plant extension growth. J. Plant Growth Regul. 2020, 39, 583–593. [Google Scholar] [CrossRef]
- Yang, J.; Song, J.; Jeong, B.R. Blue light supplemented at intervals in long-day conditions intervenes in photoperiodic flowering, photosynthesis, and antioxidant properties in chrysanthemums. Antioxidants 2022, 11, 2310. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Song, J.; Jeong, B.R. The flowering of SDP chrysanthemum in response to intensity of supplemental or night-interruptional blue light is modulated by both photosynthetic carbon assimilation and photoreceptor-mediated regulation. Front. Plant Sci. 2022, 13, 981143. [Google Scholar] [CrossRef] [PubMed]
- Higuchi, Y.; Narumi, T.; Oda, A.; Nakano, Y.; Sumitomo, K.; Fukai, S.; Hisamatsu, T. The gated induction system of a systemic floral inhibitor, antiflorigen, determines obligate short-day flowering in chrysanthemums. Proc. Natl. Acad. Sci. USA 2013, 110, 17137–17142. [Google Scholar] [CrossRef] [PubMed]
- Shchennikova, A.V.; Shulga, O.A.; Immink, R.; Skryabin, K.G.; Angenent, G.C. Identification and characterization of four chrysanthemum MADS-box genes, belonging to the APETALA1/FRUITFULL and SEPALLATA3 subfamilies. Plant Physiol. 2004, 134, 1632–1641. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Niki, T.; Nishijima, T.; Douzono, M.; Koshioka, M.; Hisamatsu, T. Roles of CmFL, CmAFL1, and CmSOC1 in the transition from vegetative to reproductive growth in Chrysanthemum morifolium Ramat. J. Hortic. Sci. Biotech. 2009, 84, 447–453. [Google Scholar] [CrossRef]
- Sun, J.; Wang, H.; Ren, L.; Chen, S.; Chen, F.; Jiang, J. CmFTL2 is involved in the photoperiod-and sucrose-mediated control of flowering time in chrysanthemum. Hortic. Res. 2017, 4, 17001. [Google Scholar] [CrossRef]
- Zhao, K.; Li, S.; Jia, D.; Xing, X.; Wang, H.; Song, A.; Jiang, J.; Chen, S.; Chen, F.; Ding, L. Characterization of the MADS-Box Gene CmFL3 in chrysanthemum. Agronomy 2022, 12, 1716. [Google Scholar] [CrossRef]
- Komiya, R.; Yokoi, S.; Shimamoto, K. A gene network for long-day flowering activates RFT1 encoding a mobile flowering signal in rice. Development 2009, 136, 3443–3450. [Google Scholar] [CrossRef]
- Van Ieperen, W. Plant morphological and developmental responses to light quality in a horticultural context. In Proceedings of the VII International Symposium on Light in Horticultural Systems 956, Wageningen, The Netherlands, 15–18 October 2012; pp. 131–139. [Google Scholar]
- Pearcy, R.W. Radiation and light measurements. In Plant Physiological Ecology: Field Methods and Instrumentation; Springer: Berlin/Heidelberg, Germany, 1989; pp. 97–116. [Google Scholar]
- Gent, M.P. Dynamic carbohydrate supply and demand model of vegetative growth: Response to temperature, light, carbon dioxide, and day length. Agronomy 2018, 8, 21. [Google Scholar] [CrossRef]
- Garner, W.W. Comparative responses of long-day and short-day plants to relative length of day and night. Plant Physiol. 1933, 8, 347. [Google Scholar] [CrossRef] [PubMed]
- Oyaert, E.; Volckaert, E.; Debergh, P. Growth of chrysanthemum under coloured plastic films with different light qualities and quantities. Sci. Hortic. 1999, 79, 195–205. [Google Scholar] [CrossRef]
- Kim, H.-H.; Goins, G.D.; Wheeler, R.M.; Sager, J.C. Green-light supplementation for enhanced lettuce growth under red-and blue-light-emitting diodes. HortScience 2004, 39, 1617–1622. [Google Scholar] [CrossRef] [PubMed]
- Shimizu, H.; Ma, Z.; Tazawa, S.; Douzono, M.; Runkle, E.; Heins, R. Blue light inhibits stem elongation of chrysanthemum. In Proceedings of the V International Symposium on Artificial Lighting in Horticulture 711, Lillehammer, Norway, 21–24 June 2005; pp. 363–368. [Google Scholar]
- Khattak, A.M.; Pearson, S. Spectral filters and temperature effects on the growth and development of chrysanthemums under low light integral. Plant Growth Regul. 2006, 49, 61–68. [Google Scholar] [CrossRef]
- Tewolde, F.T.; Lu, N.; Shiina, K.; Maruo, T.; Takagaki, M.; Kozai, T.; Yamori, W. Nighttime supplemental LED inter-lighting improves growth and yield of single-truss tomatoes by enhancing photosynthesis in both winter and summer. Front. Plant Sci. 2016, 7, 448. [Google Scholar] [CrossRef]
- Schuerger, A.C.; Brown, C.S.; Stryjewski, E.C. Anatomical features of pepper plants (Capsicum annuum L.) grown under red light-emitting diodes supplemented with blue or far-red light. Ann. Bot. 1997, 79, 273–282. [Google Scholar] [CrossRef]
- Gao, Y.; Gao, Y.; Wu, Z.; Bu, X.; Fan, M.; Zhang, Q. Characterization of TEMINAL FLOWER1 homologs CmTFL1c gene from Chrysanthemum morifolium. Plant Mol. Biol. 2019, 99, 587–601. [Google Scholar] [CrossRef]
- Jensen, C.S.; Salchert, K.; Nielsen, K.K. A TERMINAL FLOWER1-like gene from perennial ryegrass involved in floral transition and axillary meristem identity. Plant Physiol. 2001, 125, 1517–1528. [Google Scholar] [CrossRef]
- Ratcliffe, O.J.; Amaya, I.; Vincent, C.A.; Rothstein, S.; Carpenter, R.; Coen, E.S.; Bradley, D.J. A common mechanism controls the life cycle and architecture of plants. Development 1998, 125, 1609–1615. [Google Scholar] [CrossRef]
- Wang, Y.; Pijut, P.M. Isolation and characterization of a TERMINAL FLOWER 1 homolog from Prunus serotina Ehrh. Tree Physiol. 2013, 33, 855–865. [Google Scholar] [CrossRef] [PubMed]
- Guo, X.; Zhao, Z.; Chen, J.; Hu, X.; Luo, D. A putative CENTRORADIALIS/TERMINAL FLOWER 1-like gene, Ljcen1, plays a role in phase transition in Lotus japonicus. J. Plant Physiol. 2006, 163, 436–444. [Google Scholar] [CrossRef] [PubMed]
- Higuchi, Y.; Hisamatsu, T. CsTFL1, a constitutive local repressor of flowering, modulates floral initiation by antagonising florigen complex activity in chrysanthemum. Plant Sci. 2015, 237, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Fu, Q.; Niu, L.; Luo, L.; Chen, J.; Xu, Z.-F. Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas. Sci. Rep. 2017, 7, 43090. [Google Scholar] [CrossRef]
- Lang, A.; Melchers, G. Die photoperiodische Reaktion von Hyoscyamus niger. Planta 1943, 33, 653–702. [Google Scholar] [CrossRef]
- Oda, A.; Narumi, T.; Li, T.; Kando, T.; Higuchi, Y.; Sumitomo, K.; Fukai, S.; Hisamatsu, T. CsFTL3, a chrysanthemum FLOWERING LOCUS T-like gene, is a key regulator of photoperiodic flowering in chrysanthemums. J. Exp. Bot. 2012, 63, 1461–1477. [Google Scholar] [CrossRef]
- Matsuki, M. Regulation of plant phenolic synthesis: From biochemistry to ecology and evolution. Aust. J. Bot. 1996, 44, 613–634. [Google Scholar] [CrossRef]
- Park, Y.G.; Oh, H.J.; Jeong, B.R. Growth and anthocyanin concentration of Perilla frutescens var. acuta Kudo as affected by light source and DIF under controlled environment. Hortic. Environ. Biotechnol. 2013, 54, 103–108. [Google Scholar] [CrossRef]
- Yang, J.; Song, J.; Jeong, B.R. Low-intensity blue light supplemented during photoperiod in controlled environment induces flowering and antioxidant production in kalanchoe. Antioxidants 2022, 11, 811. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Gu, C.; Chen, S.; Liu, Z.; Shan, H.; Luo, H.; Guan, Z.; Chen, F. Reference gene selection for quantitative real-time PCR in Chrysanthemum subjected to biotic and abiotic stress. Mol. Biotechnol. 2011, 49, 192–197. [Google Scholar] [CrossRef]
Name | Accession Number | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
---|---|---|---|
CmACTIN | AB205087 | GATGACGCAGATCATGTTCG | AGCATGTGGAAGTGCATACC |
CmEF1α | AB548817 | CTTGTTGCTTGATGACTGTGG | CTTGTTGCTTGATGACTGTGG |
CmTFL1 | AB839767 | CCATCATCAAGGCACAATTTCA | TTTCCCTTTGGCAGTTGAAGAA |
CDM111 | AY173054 | GGTCTCAAGAATATTCGCAC | TCATTAGTCATCCCATCAGC |
CmAFL1 | AB451218 | CAAGCTCAACCATCAATAGTC | TGCAGCACATGAACGAGTAG |
CmFL | AB451217 | CATTGATGCCATATTTAACTC | ACACGGATCATTCATTGTATA |
CmFTL1 | AB679270 | AATCGTGTGCTATGAGAGCC | GCTTGTAACGTCCTCTTCATGC |
CmFTL2 | AB679271 | ATGTGTTATTCCGGCAATTGGGTCG | AAATATGCATTTGTAACGTCATGTG |
CmFTL3 | AB679272 | GGGAAAGTGGATTTGGTGGACG | GTCTTACAATTTGGTACTGTCG |
CmAFT | AB839766 | CAAGCAAAAAGCAAGGCAATCA | CAACCGGTAACCCCAAGTCATT |
CmPHYA | AB733629 | TGGAAGCAGTATGGATGCAA | TCGCAGGTATTGCACATCTC |
CmPHYB | AB733630 | TCCAAGAGGGTCATTTGGAG | ACCTGGCTAACCACAGCATC |
CmCRY1 | NM-116961 | CGTAAGGGATCACCGAGTAAAG | CTTTTAGGTGGGAGTTGTGGAG |
PCR Conditions | PCR was performed with an initial denaturing step at 95 °C for 5 min, followed by 40 cycles at 95 °C for 5 s, 60 °C for 20 s, 72 °C for 30 s, and 72 °C for 10 min to final extension. Fluorescence was quantified after the incubation at 72 °C. |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, J.; Song, J.; Park, Y.G.; Jeong, B.R. Both the Positioned Supplemental or Night-Interruptional Blue Light and the Age of Leaves (or Tissues) Are Important for Flowering and Vegetative Growth in Chrysanthemum. Plants 2024, 13, 2874. https://doi.org/10.3390/plants13202874
Yang J, Song J, Park YG, Jeong BR. Both the Positioned Supplemental or Night-Interruptional Blue Light and the Age of Leaves (or Tissues) Are Important for Flowering and Vegetative Growth in Chrysanthemum. Plants. 2024; 13(20):2874. https://doi.org/10.3390/plants13202874
Chicago/Turabian StyleYang, Jingli, Jinnan Song, Yoo Gyeong Park, and Byoung Ryong Jeong. 2024. "Both the Positioned Supplemental or Night-Interruptional Blue Light and the Age of Leaves (or Tissues) Are Important for Flowering and Vegetative Growth in Chrysanthemum" Plants 13, no. 20: 2874. https://doi.org/10.3390/plants13202874
APA StyleYang, J., Song, J., Park, Y. G., & Jeong, B. R. (2024). Both the Positioned Supplemental or Night-Interruptional Blue Light and the Age of Leaves (or Tissues) Are Important for Flowering and Vegetative Growth in Chrysanthemum. Plants, 13(20), 2874. https://doi.org/10.3390/plants13202874