Development of qPCR Detection Assay for Potato Pathogen Pectobacterium atrosepticum Based on a Unique Target Sequence
Abstract
1. Introduction
2. Results
2.1. ANI Comparison and Phylogeny
2.2. Search for Species-Specific Primers
2.3. Conventional PCR
2.4. Selectivity of qPCR Assay
2.5. Sensitivity of qPCR Assay
2.6. Artificially Inoculated Tubers Testing
3. Discussion
4. Materials and Methods
4.1. ANI Calculations and Phylogeny
4.2. Species-Specific Sequence Search and Primer Design
4.3. Bacterial Strains, Growth Condition
4.4. DNA Isolation
4.5. Polymerase Chain Reaction (PCR)
4.6. Construction of the Test Plasmid for Sensitivity Assay
4.7. qPCR
4.8. Artificial Inoculation of Potato Tubers
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Bhat, K.A.; Masood, S.D.; Bhat, N.A.; Bhat, M.A.; Razvi, S.M.; Mir, M.R.; Akhtar, S.; Wani, N.; Habib, M. Current status of post harvest soft rot in vegetables: A review. Asian J. Plant Sci. 2010, 9, 200–208. [Google Scholar] [CrossRef]
- Mansfield, J.; Genin, S.; Magori, S.; Citovsky, V.; Sriariyanum, M.; Ronald, P.; Dow, M.; Verdier, V.; Beer, S.V.; Machado, M.A.; et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 614–629. [Google Scholar] [CrossRef]
- du Raan, S.; Coutinho, T.A.; van der Waals, J.E. Cardinal temperature differences, determined in vitro, between closely related species and subspecies of pectinolytic bacteria responsible for blackleg and soft rot on potatoes. Eur. J. Plant Pathol. 2016, 144, 361–369. [Google Scholar] [CrossRef][Green Version]
- Pérombelon, M.C.M. Potato diseases caused by soft rot erwinias: An overview of pathogenesis. Plant Pathol. 2002, 51, 1–12. [Google Scholar] [CrossRef]
- Elhalag, K.; Elbadry, N.; Farag, S.; Hagag, M.; Hussien, A. Etiology of potato soft rot and blackleg diseases complex in Egypt. J. Plant Dis. Prot. 2020, 127, 855–871. [Google Scholar] [CrossRef]
- Sarfraz, S.; Oulghazi, S.; Cigna, J.; Faure, D.; Riaz, K.; Sahi, S.T.; Hameed, A.; Oulghazi, S.; Cigna, J.; Khan, S.H.; et al. First report of pectobacterium parmentieri and pectobacterium polaris causing potato blackleg disease in Punjab, Pakistan. Plant Dis. 2019, 103, 1405. [Google Scholar] [CrossRef]
- Ismiyatuningsih, I.; Joko, T.; Hartono, S. Survey and Detection of Pectobacterium atrosepticum in major potato-growing areas in Central Java province, Indonesia. Ilmu Pertan. Agric. Sci. 2016, 1, 1–6. [Google Scholar] [CrossRef]
- Asad, S.; Munir, A.; Khan, A.; Ahmad, I.; Arshad, M. First report of bacterial head rot disease caused Bypectobacterium Atrosepticum on sunflower in Pakistan. Pakistan J. Phytopathol. 2017, 29, 167–169. [Google Scholar] [CrossRef]
- Baştaş, K.K.; Hekimhan, H.; Maden, S.; Tör, M. First report of bacterial stalk and head rot disease caused by Pectobacterium atrosepticum on sunflower in Turkey. Plant Dis. 2009, 93, 1352. [Google Scholar] [CrossRef]
- Czajkowski, R.; Pérombelon, M.C.M.; Van Veen, J.A.; Van der Wolf, J.M. Control of blackleg and tuber soft rot of potato caused by Pectobacterium and Dickeya species: A review. Plant Pathol. 2011, 60, 999–1013. [Google Scholar] [CrossRef]
- Charkowski, A.O. The changing face of bacterial soft-rot diseases. Annu. Rev. Phytopathol. 2018, 56, 269–288. [Google Scholar] [CrossRef]
- Czajkowski, R.; Pérombelon, M.M.C.M.; Jafra, S.; Lojkowska, E.; Potrykus, M.; van der Wolf, J.J.M.; Sledz, W. Detection, identification and differentiation of Pectobacterium and Dickeya species causing potato blackleg and tuber soft rot: A review. Ann. Appl. Biol. 2015, 166, 18–38. [Google Scholar] [CrossRef]
- Humphris, S.N.; Cahill, G.; Elphinstone, J.G.; Kelly, R.; Parkinson, N.M.; Pritchard, L.; Toth, I.K.; Saddler, G.S. Detection of the bacterial potato pathogens Pectobacterium and Dickeya spp. using conventional and real-time PCR. Methods Mol. Biol. 2015, 1302, 1–16. [Google Scholar] [CrossRef]
- De Boer, S.H.; Ward, L.J. PCR detection of Erwinia carotovora subsp atroseptica associated with potato tissue. Phytopathology 1995, 85, 854–858. [Google Scholar] [CrossRef]
- Frechon, D.; Exbrayat, P.; Helias, V.; Hyman, L.J.; Jouan, B.; Llop, P.; Lopez, M.M.; Payet, N.; Perombelon, M.C.M.; Toth, I.K.; et al. Evaluation of a PCR kit for the detection of Erwinia carotovora subsp. atroseptica on potato tubers. Potato Res. 1998, 41, 163–173. [Google Scholar] [CrossRef]
- Smid, E.J.; Hansen, A.H.J.; Gorris, L.G.M. Detection of Erwinia carotovora subsp. atroseptica and Erwinia chrysanthemi in potato tubers using polymerase chain reaction. Plant Pathol. 1995, 44, 1058–1069. [Google Scholar] [CrossRef]
- Park, D.S.; Shim, J.K.; Kim, J.S.; Kim, B.Y.; Kang, M.J.; Seol, Y.J.; Hahn, J.H.; Shrestha, R.; Lim, C.K.; Go, S.J.; et al. PCR-based sensitive and specific detection of Pectobacterium atrosepticum using primers based on Rhs family gene sequences. Plant Pathol. 2006, 55, 625–629. [Google Scholar] [CrossRef]
- Hu, L.X.; Yang, Z.H.; Zhang, D.; Zhao, D.M.; Zhu, J.H. Sensitive and rapid detection of Pectobacterium atrosepticum by targeting the gyr B gene using a real-time loop-mediated isothermal amplification assay. Lett. Appl. Microbiol. 2016, 63, 289–296. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Nie, J.; Ward, L.J.; Nickerson, J.; De Boer, S.H. Development and evaluation of a loop-mediated isothermal amplification assay for rapid detection and identification of Pectobacterium atrosepticum. Can. J. Plant Pathol. 2011, 33, 447–457. [Google Scholar] [CrossRef]
- Bell, K.S.; Sebaihia, M.; Pritchard, L.; Holden, M.T.G.; Hyman, L.J.; Holeva, M.C.; Thomson, N.R.; Bentley, S.D.; Churcher, L.J.C.; Mungall, K.; et al. Genome sequence of the enterobacterial phytopathogen Erwinia carotovora subsp. atroseptica and characterization of virulence factors. Proc. Natl. Acad. Sci. USA 2004, 101, 11105–11110. [Google Scholar] [CrossRef]
- Evseev, P.; Ignatov, A.; Miroshnikov, K. Bioinformatic basis to define the species formation within Pectobacterium and Dickeya bacterial genera. In Proceedings of the 2020 Cognitive Sciences, Genomics and Bioinformatics (CSGB); IEEE: Piscataway, NJ, USA, 2020; pp. 47–52. [Google Scholar] [CrossRef]
- Adeolu, M.; Alnajar, S.; Naushad, S.; Gupta, R.S. Genome-based phylogeny and taxonomy of the ‘Enterobacteriales’: Proposal for enterobacterales ord. nov. divided into the families Enterobacteriaceae, Erwiniaceae fam. nov., Pectobacteriaceae fam. nov., Yersiniaceae fam. nov., Hafniaceae fam. nov., Morgane. Int. J. Syst. Evol. Microbiol. 2016, 66, 5575–5599. [Google Scholar] [CrossRef]
- Satya, R.V.; Zavaljevski, N.; Kumar, K.; Reifman, J. A high-throughput pipeline for designing microarray-based pathogen diagnostic assays. BMC Bioinform. 2008, 9, 1–13. [Google Scholar] [CrossRef][Green Version]
- Satya, R.V.; Zavaljevski, N.; Kumar, K.; Bode, E.; Padilla, S.; Wasieloski, L.; Geyer, J.; Reifman, J. In silico microarray probe design for diagnosis of multiple pathogens. BMC Genom. 2008, 9, 496. [Google Scholar] [CrossRef]
- Phillippy, A.M.; Mason, J.A.; Ayanbule, K.; Sommer, D.D.; Taviani, E.; Huq, A.; Colwell, R.R.; Knight, I.T.; Salzberg, S.L. Comprehensive DNA signature discovery and validation. PLoS Comput. Biol. 2007, 3, e98. [Google Scholar] [CrossRef]
- Pritchard, L.; Holden, N.J.; Bielaszewska, M.; Karch, H.; Toth, I.K. Alignment-free design of highly discriminatory diagnostic primer sets for Escherichia coli O104:H4 outbreak strains. PLoS ONE 2012, 7. [Google Scholar] [CrossRef]
- Na, S.I.; Kim, Y.O.; Yoon, S.-H.; Ha, S.-M.; Baek, I.; Chun, J. UBCG: Up-to-date bacterial core gene set and pipeline for phylogenomic tree reconstruction. J. Microbiol. 2018, 56, 281–285. [Google Scholar] [CrossRef]
- Lee, I.; Kim, Y.O.; Park, S.C.; Chun, J. OrthoANI: An improved algorithm and software for calculating average nucleotide identity. Int. J. Syst. Evol. Microbiol. 2016, 66. [Google Scholar] [CrossRef]
- Portier, P.; Pédron, J.; Taghouti, G.; Fischer-Le Saux, M.; Caullireau, E.; Bertrand, C.; Laurent, A.; Chawki, K.; Oulgazi, S.; Moumni, M.; et al. Elevation of Pectobacterium carotovorum subsp. odoriferum to species level as Pectobacterium odoriferum sp. nov., proposal of Pectobacterium brasiliense sp. nov. and Pectobacterium actinidiae sp. nov., emended description of Pectobacterium carotovorum and. Int. J. Syst. Evol. Microbiol. 2019, 10, 3207–3216. [Google Scholar] [CrossRef]
- Paul, B.; Kavia Raj, K.; Murali, T.S.; Satyamoorthy, K. Species-specific genomic sequences for classification of bacteria. Comput. Biol. Med. 2020, 123, 103874. [Google Scholar] [CrossRef]
- Deshpande, A.A.; Sharma, M.; Bachhawat, A.K. Insights into the molecular basis for substrate binding and specificity of the fungal cystine transporter CgCYN1. Biochim. Biophys. Acta-Biomembr. 2017, 1859, 2259–2268. [Google Scholar] [CrossRef]
- Jack, D.L.; Paulsen, I.T.; Saier, M.H. The amino acid/polyamine/organocation (APC) superfamily of transporters specific for amino acids, polyamines and organocations. Microbiology 2000, 146, 1797–1814. [Google Scholar] [CrossRef]
- Santos, R.G.; Hurtado, R.; Gomes, L.G.R.; Profeta, R.; Rifici, C.; Attili, A.R.; Spier, S.J.; Giuseppe, M.; Morais-Rodrigues, F.; Gomide, A.C.P.; et al. Complete genome analysis of Glutamicibacter creatinolyticus from mare abscess and comparative genomics provide insight of diversity and adaptation for Glutamicibacter. Gene 2020, 741, 144556. [Google Scholar] [CrossRef]
- Fernandes, J.D.S.; Martho, K.; Tofik, V.; Vallim, M.A.; Pascon, R.C. The role of amino acid permeases and tryptophan biosynthesis in Cryptococcus neoformans survival. PLoS ONE 2015, 10, e0132369. [Google Scholar] [CrossRef]
- Stamatakis, A. RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 2006, 22, 2688–2690. [Google Scholar] [CrossRef]
- Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef]
- Stakheev, A.A.; Khairulina, D.R.; Zavriev, S.K. Four-locus phylogeny of Fusarium avenaceum and related species and their species-specific identification based on partial phosphate permease gene sequences. Int. J. Food Microbiol. 2016, 225, 27–37. [Google Scholar] [CrossRef]
- Ryazantsev, D.Y.; Abramova, S.L.; Evstratova, S.V.; Gagkaeva, T.Y.; Zavriev, S.K. FLASH-PCR diagnostics of toxigenic fungi of the genus Fusarium. Russ. J. Bioorganic Chem. 2008, 34, 716–724. [Google Scholar] [CrossRef]
- Fu, J.; Li, D.; Xia, S.; Song, H.; Dong, Z.; Chen, F.; Sun, X.; Tang, Z. Absolute quantification of plasmid DNA by real-time PCR with genomic DNA as external standard and its application to a biodistribution study of an HIV DNA vaccine. Anal. Sci. 2009, 25, 675–680. [Google Scholar] [CrossRef]
- Rajesh Kumar Ranjan and Dinesh Singh. Effect of temperature and inoculums level on development of soft rot of potato caused by Erwinia carotovora subsp. carotovora and their molecular detection through poymearse chain reaction. J. Pharmacogn. Phytochem. 2020, 9, 1414–1419. [Google Scholar] [CrossRef]
Primer F 5′-CAGTAGGTTTGGGAGCAGGG |
Primer R 5′-CCACTACCGATGATGCTCCC |
Probe 5′-(6-FAM)-CGCGTCTTTTTT-(dT-BHQ-1)-GGGGTGTCGGCA-(Pi) |
Amplicon, 271 bp CAGTAGGTTTGGGAGCAGGGTTAATGGCTGCAGTCTCTTATTTCCTTCTTCTTGCTGGTGTCGCGTCTTT TTTTGGGGTGTCGGCATCTGAGCTTATGAAAGGGATAACTGGAAGTTCATTACCCTGGTATGCCTATGC GCTAATTTGTTGGGCAGCGGTTGCATTACTGGGCTATTTGCATGTTGAACTTTCTGCAAAAGTATTGTC ATGGGTTATGCTTAGCGAAGTGATAATTTGTCTGGTTTTTTCTGGGAGCATCATCGGTAGTGG |
Plasmid DNA per Reaction | Genomic DNA per Reaction | |||||
---|---|---|---|---|---|---|
№ | Plasmid Copies | Mean Cq | Standard Deviation | Genome Copies | Mean Cq | Standard Deviation |
1 | 3.7 × 109 | 7.03 | 0.96 | 8.7 × 105 | 19.35 | 0.83 |
2 | 3.7 × 108 | 9.98 | 0.54 | 8.7 × 104 | 21.82 | 0.77 |
3 | 3.7 × 107 | 12.02 | 1.28 | 8.7 × 103 | 24.26 | 0.40 |
4 | 3.7 × 106 | 16.58 | 0.35 | 8.7 × 102 | 29.67 | 1.40 |
5 | 3.7 × 105 | 20.01 | 0.51 | 87 | 33.3 | 2.40 |
6 | 3.7 × 104 | 22.95 | 1.02 | 8.7 | - | - |
7 | 3.7 × 103 | 26.75 | 0.95 | 0.87 | - | - |
8 | 3.7 × 102 | 30.05 | 0.33 | 0.087 | - | - |
№ | Variety | Type | qPCR Assay | Pathogen Concentration, Copies of Pathogen DNA/mL of Potato Extract | |
---|---|---|---|---|---|
Cq Mean | Cq Error | ||||
1 | Red Scarlett | Neg. control | - | - | |
2 | Red Scarlett | Inoculated | 28.46 | 0.56 | 5 × 105 |
3 | Gala | Neg. control | - | - | |
4 | Gala | Inoculated | 29.55 | 0.95 | 3.6 × 105 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lukianova, A.A.; Evseev, P.V.; Stakheev, A.A.; Kotova, I.B.; Zavriev, S.K.; Ignatov, A.N.; Miroshnikov, K.A. Development of qPCR Detection Assay for Potato Pathogen Pectobacterium atrosepticum Based on a Unique Target Sequence. Plants 2021, 10, 355. https://doi.org/10.3390/plants10020355
Lukianova AA, Evseev PV, Stakheev AA, Kotova IB, Zavriev SK, Ignatov AN, Miroshnikov KA. Development of qPCR Detection Assay for Potato Pathogen Pectobacterium atrosepticum Based on a Unique Target Sequence. Plants. 2021; 10(2):355. https://doi.org/10.3390/plants10020355
Chicago/Turabian StyleLukianova, Anna A., Peter V. Evseev, Alexander A. Stakheev, Irina B. Kotova, Sergey K. Zavriev, Alexander N. Ignatov, and Konstantin A. Miroshnikov. 2021. "Development of qPCR Detection Assay for Potato Pathogen Pectobacterium atrosepticum Based on a Unique Target Sequence" Plants 10, no. 2: 355. https://doi.org/10.3390/plants10020355
APA StyleLukianova, A. A., Evseev, P. V., Stakheev, A. A., Kotova, I. B., Zavriev, S. K., Ignatov, A. N., & Miroshnikov, K. A. (2021). Development of qPCR Detection Assay for Potato Pathogen Pectobacterium atrosepticum Based on a Unique Target Sequence. Plants, 10(2), 355. https://doi.org/10.3390/plants10020355