Iron Chelator Deferoxamine Alleviates Progression of Diabetic Nephropathy by Relieving Inflammation and Fibrosis in Rats
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals and Design
2.2. Serum and Urine Biochemical Assays
2.3. Histological Analysis of Renal Tissues
2.4. Quantitative PCR Analysis
2.5. Statistical Analysis
3. Results
3.1. Effects of DFO on the Body Weight and Biochemical Parameters
3.2. Effects of DFO on Iron Levels in Diabetic Kidneys
3.3. Effects of DFO on Renal Function in DN Rats
3.4. Effects of DFO on Kidney Structures in DN Rats
3.5. Effects of DFO on Podocyte Foot in DN Rats
3.6. Effects of DFO on Kidney Fibrosis in DN Rats
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Samsu, N. Diabetic Nephropathy: Challenges in Pathogenesis, Diagnosis, and Treatment. BioMed Res. Int. 2021, 2021, 1497449. [Google Scholar] [CrossRef] [PubMed]
- Fineberg, D.; Jandeleit-Dahm, K.A.M.; Cooper, M.E. Diabetic nephropathy: Diagnosis and treatment. Nat. Rev. Endocrinol. 2013, 9, 713–723. [Google Scholar] [CrossRef] [PubMed]
- Lang, J.; Shlipak, M.G. Kidney Disease, Income, and Life Expectancy. Am. J. Kidney Dis. 2016, 68, 674–676. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Altamura, S.; Kopf, S.; Schmidt, J.; Müdder, K.; da Silva, A.R.; Nawroth, P.; Muckenthaler, M.U. Uncoupled iron homeostasis in type 2 diabetes mellitus. J. Mol. Med. 2017, 95, 1387–1398. [Google Scholar] [CrossRef]
- Moreno-Navarrete, J.M.; Rodríguez, A.; Becerril, S.; Valentí, V.; Salvador, J.; Frühbeck, G.; Fernández-Real, J.M. Increased Small Intestine Expression of Non-Heme Iron Transporters in Morbidly Obese Patients with Newly Diagnosed Type 2 Diabetes. Mol. Nutr. Food Res. 2017, 62, 1700301. [Google Scholar] [CrossRef]
- Ma, W.; Feng, Y.; Jia, L.; Li, S.; Li, J.; Wang, Z.; Chen, X.; Du, H. Dietary Iron Modulates Glucose and Lipid Homeostasis in Diabetic Mice. Biol. Trace Element Res. 2018, 189, 194–200. [Google Scholar] [CrossRef]
- Cooksey, R.C.; Jones, D.; Gabrielsen, S.; Huang, J.; Simcox, J.A.; Luo, B.; Soesanto, Y.; Rienhoff, H.; Abel, E.D.; McClain, D.A. Dietary iron restriction or iron chelation protects from diabetes and loss of β-cell function in the obese (ob/ob lep−/−) mouse. Am. J. Physiol. Endocrinol. Metab. 2010, 298, E1236–E1243. [Google Scholar] [CrossRef]
- Pollak, Y.; Mechlovich, D.; Amit, T.; Bar-Am, O.; Manov, I.; Mandel, S.A.; Weinreb, O.; Meyron-Holtz, E.G.; Iancu, T.C.; Youdim, M.B.H. Effects of novel neuroprotective and neurorestorative multifunctional drugs on iron chelation and glucose metabolism. J. Neural Transm. 2012, 120, 37–48. [Google Scholar] [CrossRef]
- Malik, A.; Firke, S.D.; Patil, R.R.; Shirkhedkar, A.A.; Surana, S.J. Determination of Iron Chelating Agents by Analytical Methods: A Review. Crit. Rev. Anal. Chem. 2020, 50, 254–264. [Google Scholar] [CrossRef]
- Elalfy, M.S.; Adly, A.M.; Wali, Y.; Tony, S.; Samir, A.; Elhenawy, Y.I. Efficacy and safety of a novel combination of two oral chelators deferasirox/deferiprone over deferoxamine/deferiprone in severely iron overloaded young beta thalassemia major patients. Eur. J. Haematol. 2015, 95, 411–420. [Google Scholar] [CrossRef]
- Andrews, N.C. Disorders of Iron Metabolism. N. Engl. J. Med. 1999, 341, 1986–1995. [Google Scholar] [CrossRef] [PubMed]
- Guo, C.; Zhang, Y.-X.; Wang, T.; Zhong, M.-L.; Yang, Z.-H.; Hao, L.-J.; Chai, R.; Zhang, S. Intranasal deferoxamine attenuates synapse loss via up-regulating the P38/HIF-1α pathway on the brain of APP/PS1 transgenic mice. Front. Aging Neurosci. 2015, 7, 104. [Google Scholar] [CrossRef] [PubMed]
- Bulucu, F.; Ocal, R.; Karadurmus, N.; Sahin, M.; Kenar, L.; Aydin, A.; Oktenli, C.; Koc, B.; Inal, V.; Yamanel, L.; et al. Effects of N-Acetylcysteine, Deferoxamine and Selenium on Doxorubicin-Induced Hepatotoxicity. Biol. Trace Element Res. 2009, 132, 184–196. [Google Scholar] [CrossRef]
- Xue, H.; Chen, D.; Zhong, Y.; Zhou, Z.; Fang, S.; Li, M.; Guo, C. Deferoxamine ameliorates hepatosteatosis via several mechanisms in ob/ob mice. Ann. N. Y. Acad. Sci. 2016, 1375, 52–65. [Google Scholar] [CrossRef]
- Dongiovanni, P.; Valenti, L.; Ludovica Fracanzani, A.; Gatti, S.; Cairo, G.; Fargion, S. Iron Depletion by Deferoxamine Up-Regulates Glucose Uptake and Insulin Signaling in Hepatoma Cells and in Rat Liver. Am. J. Pathol. 2008, 172, 738–747. [Google Scholar] [CrossRef] [PubMed]
- Srinivasan, K.; Viswanad, B.; Asrat, L.; Kaul, C.; Ramarao, P. Combination of high-fat diet-fed and low-dose streptozotocin-treated rat: A model for type 2 diabetes and pharmacological screening. Pharmacol. Res. 2005, 52, 313–320. [Google Scholar] [CrossRef]
- Zou, C.; Liu, X.; Liu, R.; Wang, M.; Sui, M.; Mu, S.; Li, L.; Ji, L.; Xie, R. Effect of the oral iron chelator deferiprone in diabetic nephropathy rats. J. Diabetes 2016, 9, 332–340. [Google Scholar] [CrossRef]
- Wang, Q.; Li, S.; Tang, X.; Liang, L.; Wang, F.; Du, H. Lipocalin 2 Protects Against Escherichia coli Infection by Modulating Neutrophil and Macrophage Function. Front. Immunol. 2019, 10, 2594. [Google Scholar] [CrossRef]
- Qi, M.-Y.; Wang, X.-T.; Xu, H.-L.; Yang, Z.-L.; Cheng, Y.; Zhou, B. Protective effect of ferulic acid on STZ-induced diabetic nephropathy in rats. Food Funct. 2020, 11, 3706–3718. [Google Scholar] [CrossRef]
- Fernández-Real, J.M.; Manco, M. Effects of iron overload on chronic metabolic diseases. Lancet Diabetes Endocrinol. 2014, 2, 513–526. [Google Scholar] [CrossRef]
- Cheng, K.; Ho, K.; Stokes, R.; Scott, C.; Lau, S.M.; Hawthorne, W.J.; O’connell, P.J.; Loudovaris, T.; Kay, T.W.; Kulkarni, R.N.; et al. Hypoxia-inducible factor-1α regulates β cell function in mouse and human islets. J. Clin. Investig. 2010, 120, 2171–2183. [Google Scholar] [CrossRef]
- Gabrielsen, J.S.; Gao, Y.; Simcox, J.A.; Huang, J.; Thorup, D.; Jones, D.; Cooksey, R.C.; Gabrielsen, D.; Adams, T.D.; Hunt, S.C.; et al. Adipocyte iron regulates adiponectin and insulin sensitivity. J. Clin. Investig. 2012, 122, 3529–3540. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Simcox, J.; Mitchell, T.C.; Jones, D.; Cox, J.; Luo, B.; Cooksey, R.C.; Boros, L.G.; McClain, D.A. Iron regulates glucose homeostasis in liver and muscle via AMP-activated protein kinase in mice. FASEB J. 2013, 27, 2845–2854. [Google Scholar] [CrossRef] [PubMed]
- Jais, A.; Einwallner, E.; Sharif, O.; Gossens, K.; Lu, T.T.-H.; Soyal, S.M.; Medgyesi, D.; Neureiter, D.; Paier-Pourani, J.; Dalgaard, K.; et al. Heme Oxygenase-1 Drives Metaflammation and Insulin Resistance in Mouse and Man. Cell 2014, 158, 25–40. [Google Scholar] [CrossRef] [PubMed]
- Orban, E.; Schwab, S.; Thorand, B.; Huth, C. Association of iron indices and type 2 diabetes: A meta-analysis of observational studies. Diabetes/Metab. Res. Rev. 2014, 30, 372–394. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Fang, X.; Zheng, W.; Zhou, J.; Song, Z.; Xu, M.; Min, J.; Wang, F. Genetic Support of a Causal Relationship Between Iron Status and Type 2 Diabetes: A Mendelian Randomization Study. J. Clin. Endocrinol. Metab. 2021, 106, e4641–e4651. [Google Scholar] [CrossRef]
- Italia, K.; Colah, R.; Ghosh, K. Experimental animal model to study iron overload and iron chelation and review of other such models. Blood Cells Mol. Dis. 2015, 55, 194–199. [Google Scholar] [CrossRef]
- Duscher, D.; Neofytou, E.; Wong, V.W.; Maan, Z.N.; Rennert, R.C.; Inayathullah, M.; Januszyk, M.; Rodrigues, M.; Malkovskiy, A.V.; Whitmore, A.J.; et al. Transdermal deferoxamine prevents pressure-induced diabetic ulcers. Proc. Natl. Acad. Sci. USA 2014, 112, 94–99. [Google Scholar] [CrossRef]
- Li, Y.; Pan, K.; Chen, L.; Ning, J.-L.; Li, X.; Yang, T.; Terrando, N.; Gu, J.; Tao, G. Deferoxamine regulates neuroinflammation and iron homeostasis in a mouse model of postoperative cognitive dysfunction. J. Neuroinflammation 2016, 13, 268. [Google Scholar] [CrossRef]
- Nagata, M. Podocyte injury and its consequences. Kidney Int. 2016, 89, 1221–1230. [Google Scholar] [CrossRef]
- Barisoni, L.; Mundel, P. Podocyte Biology and the Emerging Understanding of Podocyte Diseases. Am. J. Nephrol. 2003, 23, 353–360. [Google Scholar] [CrossRef] [PubMed]
- Barisoni, L.; Schnaper, H.W.; Kopp, J.B. A Proposed Taxonomy for the Podocytopathies: A reassessment of the primary nephrotic diseases. Clin. J. Am. Soc. Nephrol. 2007, 2, 529–542. [Google Scholar] [CrossRef] [PubMed]
- Dai, H.; Liu, Q.; Liu, B. Research Progress on Mechanism of Podocyte Depletion in Diabetic Nephropathy. J. Diabetes Res. 2017, 2017, 2615286. [Google Scholar] [CrossRef]
- Kostovska, I.; Trajkovska, K.T.; Topuzovska, S.; Cekovska, S.; Labudovic, D.; Kostovski, O.; Spasovski, G. Nephrinuria and podocytopathies. Adv. Clin. Chem. 2022, 108, 1–36. [Google Scholar] [CrossRef]
- Kandasamy, Y.; Smith, R.; Lumbers, E.R.; Rudd, D. Nephrin—A biomarker of early glomerular injury. Biomark. Res. 2014, 2, 21. [Google Scholar] [CrossRef] [PubMed]
- Kostovska, I.; Tosheska-Trajkovska, K.; Topuzovska, S.; Cekovska, S.; Spasovski, G.; Kostovski, O.; Labudovic, D. Urinary nephrin is earlier, more sensitive and specific marker of diabetic nephropathy than microalbuminuria. J. Med. Biochem. 2019, 39, 83–90. [Google Scholar] [CrossRef] [PubMed]
- Roselli, S.; Gribouval, O.; Boute, N.; Sich, M.; Benessy, F.; Attié, T.; Gubler, M.-C.; Antignac, C. Podocin Localizes in the Kidney to the Slit Diaphragm Area. Am. J. Pathol. 2002, 160, 131–139. [Google Scholar] [CrossRef] [PubMed]
- Huber, T.B.; Köttgen, M.; Schilling, B.; Walz, G.; Benzing, T. Interaction with Podocin Facilitates Nephrin Signaling. J. Biol. Chem. 2001, 276, 41543–41546. [Google Scholar] [CrossRef]
- Fukuda, A.; Minakawa, A.; Kikuchi, M.; Sato, Y.; Nagatomo, M.; Nakamura, S.; Mizoguchi, T.; Fukunaga, N.; Shibata, H.; Naik, A.S.; et al. Urinary podocyte mRNAs precede microalbuminuria as a progression risk marker in human type 2 diabetic nephropathy. Sci. Rep. 2020, 10, 18209. [Google Scholar] [CrossRef]
- Ozkan, S.; Isildar, B.; Ercin, M.; Gezginci-Oktayoglu, S.; Konukoglu, D.; Neşetoğlu, N.; Oncul, M.; Koyuturk, M. Therapeutic potential of conditioned medium obtained from deferoxamine preconditioned umbilical cord mesenchymal stem cells on diabetic nephropathy model. Stem Cell Res. Ther. 2022, 13, 438. [Google Scholar] [CrossRef]
- Zeng, L.-F.; Xiao, Y.; Sun, L. A Glimpse of the Mechanisms Related to Renal Fibrosis in Diabetic Nephropathy. Adv. Exp. Med. Biol. 2019, 1165, 49–79. [Google Scholar] [CrossRef] [PubMed]
- Mehta, K.J.; Farnaud, S.J.; Sharp, P.A. Iron and liver fibrosis: Mechanistic and clinical aspects. World J. Gastroenterol. 2019, 25, 521–538. [Google Scholar] [CrossRef] [PubMed]
- Meng, X.-M.; Nikolic-Paterson, D.J.; Lan, H.Y. Inflammatory processes in renal fibrosis. Nat. Rev. Nephrol. 2014, 10, 493–503. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primers | Reverse Primers |
---|---|---|
β-actin | CGCCAACCGCGAGAAGAT | CGTCACCGGAGTCCATCA |
FtH | TCAGTCACTACTGGAACTGC | CGTGGTCACCCAGTTCTTTA |
Hepcidin | TTGCGATACCAATGCAGAAG | TGCAACAGATACCACACTGG |
FPN | GAATAATGGGAACTGTGG | AAGTGGCTCTGTCTGAAT |
Nephrin | GACACGAGAAGCTCCACGGTTA | GTCGTAGATTCCCCTCGGATC |
Podocin | GCCTCCCTTCTTCTAAGCAGTCTA | TCAGTTCTCTCCACTTTGATGCC |
Fibronectin 1 | ACAGAGCTCAACCTCCCTGA | TGTGCTCCTGGTTCTCCT |
Collagen I | TCACCACAATGCCGTTC | GCCACTAATTGGAGCCATGT |
IL-1β | ACAAAAGCCCGTCTTCCTG | ATGTGGACCTCTGGGTATGG |
NF-κB | AAGCACTGCAGGGAGACTGT | ATCTTGAGCTCGGCAGTGTT |
MCP-1 | CAAGAGAATCACCAGCAGCA | AAGCTCATGCAAATGGAAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Feng, Y.; Jia, L.; Ma, W.; Tian, C.; Du, H. Iron Chelator Deferoxamine Alleviates Progression of Diabetic Nephropathy by Relieving Inflammation and Fibrosis in Rats. Biomolecules 2023, 13, 1266. https://doi.org/10.3390/biom13081266
Feng Y, Jia L, Ma W, Tian C, Du H. Iron Chelator Deferoxamine Alleviates Progression of Diabetic Nephropathy by Relieving Inflammation and Fibrosis in Rats. Biomolecules. 2023; 13(8):1266. https://doi.org/10.3390/biom13081266
Chicago/Turabian StyleFeng, Yunfei, Li Jia, Wan Ma, Chenying Tian, and Huahua Du. 2023. "Iron Chelator Deferoxamine Alleviates Progression of Diabetic Nephropathy by Relieving Inflammation and Fibrosis in Rats" Biomolecules 13, no. 8: 1266. https://doi.org/10.3390/biom13081266
APA StyleFeng, Y., Jia, L., Ma, W., Tian, C., & Du, H. (2023). Iron Chelator Deferoxamine Alleviates Progression of Diabetic Nephropathy by Relieving Inflammation and Fibrosis in Rats. Biomolecules, 13(8), 1266. https://doi.org/10.3390/biom13081266